Коксаки вирус у детей в россии: Лечение вируса Коксаки в Москве: педиатр в клинике и на дому, точная диагностика

Содержание

Вирус Коксаки: эпидемиология, клиника, профилактика

Энтеровирусные инфекции – большая группа острых вирусных заболеваний, вызываемых энтеровирусами группы Коксаки и ECHO, характеризующихся многообразием клинических проявлений от легких лихорадочных состояний до тяжелых менингитов.

Энтеровирусы распространены повсеместно, устойчивы во внешней среде и длительное время могут сохраняться в сточных водах, плавательных бассейнах, открытых водоемах, предметах обихода, продуктах питания (молоко, фрукты, овощи). Вирус быстро погибает при прогревании, кипячении.

Возможные пути передачи инфекции: фекально-оральный (пищевой и водный), воздушно-капельный, контактно-бытовой (грязные руки, игрушки). Энтеровирусные инфекции характеризуются быстрым распространением заболевания среди людей.

Источником инфекции являются больные люди, в том числе бессимптомной формой, и вирусоносители. Наиболее интенсивно вирусы выделяются от человека в первые дни болезни, однако возможно их выделение до нескольких месяцев.

Восприимчивость людей к вирусу высокая. Часто наблюдаются групповые заболевания, возможны семейные вспышки

Заболевание начинается остро, с подъема температуры тела до 39-40 градусов. Появляется сильная головная боль, головокружение, рвота, иногда боли в животе, спине, у детей возможен судорожный синдром, нередко выраженные катаральные проявления со стороны ротоглотки, верхних дыхательных путей, болезненные высыпания на коже. Серозный вирусный менингит является наиболее типичной и тяжелой формой энтеровирусной инфекции. При появлении перечисленных жалоб необходимо срочно изолировать больного, так как он является источником заражения для окружающих, и обратиться к врачу.

Несмотря на яркую клинику и выраженность проявлений течение энтеровирусной инфекции благоприятное, осложнения встречаются редко.

Меры личной профилактики должны заключаться в соблюдении правил личной гигиены, соблюдении питьевого режима (кипяченая вода, бутилированная вода), тщательной обработки употребляемых фруктов, овощей и последующим ополаскиванием кипятком. Рекомендуется влажная уборка жилых помещений не реже 2 раз в день, проветривание помещений.

Ни в коем случае не допускать посещения ребенком организованного детского коллектива с любыми проявлениями заболевания.

При первых признаках заболевания необходимо немедленно обращаться за медицинской помощью, не заниматься самолечением!

Похожие на синдром Кавасаки симптомы у детей связывают с коронавирусом

Автор фото, PA Media

Десятки британских и американских детей за последнее время были поражены редким воспалительным заболеванием, которое медики связывают с коронавирусом.

В небольшом количестве случаев возникли серьезные осложнения. Нескольким детям потребовалась реанимация.

В Британии соответствующие симптомы проявились примерно у 100 детей. По данным исследований, аналогичные реакции имели место и в континентальной Европе.

Как предполагают медики, они вызваны запоздалой иммунной реакцией на вирус и напоминают симптомы другого, давно известного заболевания - синдрома Кавасаки.

Болезнь Кавасаки (ее также называют синдромом Кавасаки) - редкое заболевание, названное по имени японского врача, впервые описавшего его в 1967 году. Оно характеризуется, прежде всего, воспалением кровеносных сосудов, а также сыпью, отеком миндалин и пересыханием губ, и поражает почти исключительно детей в возрасте до пяти лет.

В апреле врачам Национальной системы здравоохранения Британии было рекомендовано обратить внимание на редкие, но опасные болезненные проявления у детей, после того как они были отмечены у восьми несовершеннолетних пациентов в Лондоне. Один 14-летний подросток тогда скончался.

Все они проходили лечение в лондонской детской клинике "Эвелина", и у всех были одинаковые симптомы: высокая температура, сыпь, покраснение глаз, отечность, ломота во всем теле.

Большинство из них не имели серьезных проблем с дыханием, однако семерым врачи предписали принудительную вентиляцию легких для облегчения сердечной деятельности и кровообращения.

Постинфекционный синдром

Врачи называют это новым феноменом, сходным с болезнью Кавасаки. Однако, в отличие от последней, он поражает не только дошкольников, но и подростков в возрасте до 16 лет, а в некоторых случаях вызывает тяжелые осложнения.

По мнению Лиз Уиттакер, практикующего врача и преподавателя детских инфекционных болезней и иммунологии в Имперском колледже Лондона, тот факт, что синдром проявил себя в разгар пандемии коронавируса, вероятно, указывает на связь этих двух явлений.

"Мы проходим пик Covid-19, а через три или четыре недели наблюдаем пик нового заболевания. Это заставляет думать, что мы имеем дело с постинфекционным синдромом, вероятно, связанным с накоплением в организме антител", - считает эксперт.

Профессор Рассел Винер, президент Королевского колледжа педиатрии и детского здоровья, указывает, что большинство детей, у которых проявились эти симптомы, хорошо реагируют на лечение и начинают выписываться домой.

Синдром пока является исключительно редким и не должен останавливать родителей, выпускающих детей из карантина, добавил ученый.

По словам профессора Винера, изучение данного синдрома поможет объяснить, почему некоторые дети тяжело переносят Covid-19, тогда как большинство не заражается или болеет бессимптомно.

Дети составляют 1-2% случаев коронавируса в Британии, и менее чем 500 из них понадобилась госпитализация.

Вирусы Коксаки B1–6 как этиологический фактор энтеровирусной инфекции | Романенкова

1. Лобзин, Ю.В. Энтеровирусные инфекции: руководство для врачей / Ю.В. Лобзин, Н.В. Скрипченко, Е.А. Мурина. – СПб.: НИИДИ, 2012. – 432 с.

2. Романенкова, Н.И. Надзор за полиомиелитом и энтеровирусной инфекцией на ряде территорий Российской Федерации / Н.И. Романенкова, М.А. Бичурина, Н.Р. Розаева // Журнал микробиологии, эпидемиологии и иммунобиологии. – 2011. – № 6. – С. 32–36.

3. Kemball CC, Alirezaei M, Whitton JL. Type B coxsackieviruses and their interactions with the innate and adaptive immune systems. Future Microbiol. 2010 Sep; 5(9):1329-47.

4. Euscher E, Davis J, Holzman I, Nuovo GJ. Coxsackie virus infection of the placenta associated with neurodevelopmental delays in the newborn. Obstet. Gynecol. 2001 Dec; 98(6): 1019–26.

5. Schlapbach LJ, Ersch J, Balmer C, et al. Enteroviral myocarditis in neonates. J. Paediatr. Child. Health. 2013 Sep; 49(9): 451-4.

6. Бичурина, М.А. Сезонный подъем заболеваемости энтеровирусным менингитом в Новгородской области / М.А. Бичурина [и др.] // Инфекция и иммунитет. – 2012. – Т. 2, № 4. – С. 747–752.

7. Бичурина, М.А. Роль энтеровируса ECHO30 в этиологии энтеровирусной инфекции на Северо-Западе России в 2013 году / М.А. Бичурина [и др.] // Журнал инфектологии. – 2014. – Т. 6, № 3. – С. 84–91.

8. Шишко, Л.А. Этиология сезонных подъёмов заболеваемости энтеровирусной инфекцией в Архангельской области / Л.А. Шишко [и др.] // Инфекция и иммунитет. – 2013. – Т. 3, № 1. – C. 65–72.

9. Rhoades RE, Tabor-Godwin JM, Tsueng G, Feuer R. Enterovirus Infections of the Central Nervous System. Virology. 2011 Mar; 411(2): 288-305.

10. Лукашев, А.Н. Социально-экономическая значимость энтеровирусной инфекции и ее роль в структуре инфекционной патологии в мире / А.Н. Лукашев, О.Е. Иванова, Л.В. Худякова // Журнал микробиологии, эпидемиологии и иммунобиологии. – 2010. – № 5. – С. 113–120.

11. Lee BE, Davies HD. Aseptic meningitis. Curr. Opin. Infect. Dis. 2007 Jun; 20(3): 272-7.

12. Бессергенева, И.К. Тенденция эпидемического процесса неполиомиелитных энтеровирусных заболеваний в условиях мегаполиса / И.К. Бессергенева [и др.] // ЗНиСО. – 2010. – №6. – С. 25–28.

13. Сапега, Е.Ю. Анализ проявлений эпидемического процесса энтеровирусной инфекции в Дальневосточном регионе в 2010 году / Е. Ю. Сапега [и др.] // Дальневосточный Журнал инфекционной патологии. – 2011. – № 19. – C. 18–22.

14. CDC. Outbreaks of aseptic meningitis associated with echovirus 9 and 30 and preliminary surveillance reports on enterovirus activity – United States, 2003. Morbid. Mortal. Wkly Rep. 2003 Aug; 52(32): 761-4.

15. Лукашев, А.Н. Молекулярная эпидемиология вируса ECHO 30 на территории России и стран СНГ / А.Н. Лукашев [и др.] // Вопросы вирусологии. – 2004. – Т. 49, № 5. – С. 12–16.

16. Лукашев, А.Н. Молекулярная эпидемиология вируса ECHO 6 – возбудителя вспышки серозного менингита в Хабаровске в 2006 г. / А.Н. Лукашев [и др.] // Вопросы вирусологии – 2008. – Т. 53, № 1. – С. 16–21.

17. Khetsuriani N, LaMonte-Fowlkes A, Oberste MS, Pallansch MA. Enterovirus surveillance – United States, 1970–2005. Morbid. Mortal. Wkly Rep. 2006 Sep; 55(8): 1–20.

18. Романенкова, Н.И. Детекция неполиомиелитных энтеровирусов у больных острыми вялыми параличами, детей из организованных коллективов и детей из семей мигрантов / Н.И. Романенкова [и др.] // Журнал инфектологии. – 2014. – Т. 6, № 4. – С. 43–48.

19. Tam PE. Coxsackievirus myocarditis: interplay between virus and host in the pathogenesis of heart disease. Viral Immunol. 2006 Summer; 19(2):133-46.

20. Polio laboratory manual. WHO/IVB/04.10.World Health Organization, Geneva, Switzerland. c 2004. 157 p.

21. Голицына, Л. Н. Эпидемические варианты неполиомиелитных энтеровирусов в России / Л.Н. Голицына [и др.] // Медицинский альманах. – 2015. – № 5. – С. 136–140.

СОВРЕМЕННЫЕ ВОЗМОЖНОСТИ ДИАГНОСТИКИ, ПРОФИЛАКТИКИ И ЛЕЧЕНИЯ ЭНТЕРОВИРУСНОЙ ИНФЕКЦИИ КОКСАКИ У ДЕТЕЙ | Ботвиньева

1. Сейбиль В. Б., Малышкина Л. П. Всемирная организация здравоохранения и проблема ликвидации инфекционных заболеваний в мире. Вопросы вирусологии. 2005; 50: 3.

2. Амвросьева Т. В., Богуш З. Ф. и др. Вспышка энтеровирусной инфекции в Витебске в условиях загрязнения питьевой воды. Вопросы вирусологии. 2004; 1: 7–9.

3. Ежлова Е. Б., Чернявская О. П., Михайлов М. И. Эпидемио логический надзор и профилактика энтеровирусной (неполио) инфекции. Методические указания 3.1.1.2363-08. Москва. 2008.

4. Кузнецова В. Г., Мечетина А. А. и др. Клинико-эпидемиологическая характеристика энтеровирусного менингита по данным вспышки 2004 года. Сборник материалов XV Научно-практической конференции врачей. Новосибирск. 2005. С. 415–416.

5. Лашкевич В. А., Дроздов С. Г., Грачев В. П. и др. Неполиомиелитные энтеровирусные инфекции: Эпидемиология, характеристика энтеровирусов, клиника, диагностика, профилактика. Методическое пособие. Федеральный центр Госсанэпиднадзора РФ. Москва. 2004.

6. Melnick J. L., Shaw E. W., Curnen E. C. A virus irom patients diagnosed as non-paralytic poliomyelitis or aseptic meningitis. Proc. Soc. Exp. Biol. 1949; 71: 344–349.

7. Abubakar S., Chee H. Y., Shafee N. et al. Molecular detection of enteroviruses from an outbreak of hand, foot and mouth disease in Malaysia in 1997. Scand. J. Infect. Dis. 1999; 31 (4): 331–335.

8. Ang L. W., Koh B.K., Chan K. P. et al. Epidemiology and control of hand, foot and mouth disease in Singapore, 2001–2007. Ann. Acad. Med. Singapore. 2009; 38 (2): 106–112.

9. Энтеровирусные заболевания: клиника, лабораторная диагностика, эпидемиология, профилактика. Методические указания (МУ 3.1.1.2130-06). Москва. 2006.

10. Ding N. Z., Wang X. M., Sun S. W. et al. Appearance of mosaic enterovirus 71 in the 2008 outbreak of China. Virus Res. 2009; 45 (1): 157–161.

11. Osterback R. , Vuorinen T., Linna M. et al. Coxsackievirus A6 and hand, foot and mouth disease, Finland. Emerg. Infect. Dis. 2009; 15 (9): 1485–1488.

12. Yamashita T., Ito M., Taniguchi A., Sakae K. Prevalence of coxsackievirus A5, A6, and A10 in patients with herpangina in aichi prefecture. J. Infect. Dis. 2005; 58: 390–391.

13. Бочаров Е. Ф., Ерман Б. А., Фомин В. В. и др. Энтеровирусная инфекция: Новые аспекты. Новосибирск: Наука. Сибирское отделение РАМН. 1990. С. 224.

14. Лозовская Л. С. и др. Значение вертикальной передачи энтеровирусов в эпидемиологии врожденных вирусных инфекций. Акушерство и гинекология. 1995; 2: 26–30.

15. Mori M., Takagi K., Kuwabara S. et al. Guillain-Barre syndrome following hand-foot-and-mouth disease. Intern. Med. 2000; 39 (6).

16. Cabral L. A., Almeida J. D., de Oliveria M. L., Meza A. C. Hand, foot and mouth disease: a case report. Quintessence Int. 1998; 29: 194–196.

17. Злобин В. И. Энтеровирусные инфекции. Инфекционные болезни. 1999. С. 302–307.

18. Демина А. В., Маркович Н. А., Нетесов С.В. Энтеровирусы. Часть 1. История открытия, таксономия, строение генома, эпидемиология. Бюллетень СО РАМН. 2008; 1 (129): 92–100.

19. Демина А. В. и др. Энтеровирусы. Часть 2. Энтеровирусные инфекции: Многообразие клинических проявлений. Бюллетень СО РАМН. 2009; 6 (140): 116–125.

20. Лобзин Ю. В., Пилипенко В. В., Громыко Ю. Н. Менингиты и энцефалиты. СПб.: Фолиант. 2001. С. 55–110.

21. Михайлов Е. В., Штейнберг А. В., Еремеева И. Г. Менингиты энтеровирусной этиологии у детей: Современные подходы к диагностике и особенности клинического течения. Инфекционные болезни. 2008; 6 (1): 31–34.

22. McMinn P., Stratov I., Nagarajan L., Davis S. Neurological manifestations of enterovirus 71 infection in children during an outbreak of hand, foot, and mouth disease in western australia. Clin. Infect. Dis. 2001; 32 (2): 236–242.

23. Nix W. A., Oberste M. S., Pallansch M. A. Sensitive, seminested PCR amplification of VP1 sequences for direct identification of all enterovirus serotypes from original clinical specimens. J. Clin. Microbiol. 2006; 44 (8): 2698–2704.

24. Logotheti M., Pogka V., Horefti E. et al. Laboratory investigation and phylogenetic analysis of enteroviruses involved in an aseptic meningitis outbreak in greece during the summer of 2007. J. Clin. Virol. 2009; 46 (3): 270–274.

25. Sasidharan C. K., Sugathan P., Agarwal R. et al. Hand-foot-andmouth disease in calicut. Indian J. Pediatr. 2005; 72 (1): 17–21.

26. Tu P., Thao N., Perera D. et al. Epidemiologic and virologic investigation of hand, foot, and mouth disease, southern vietnam, 2005. Emerging Infectious Diseases. 2007; 13 (11).

27. Zhang Y., Nan L. J., Wu G. S. et al. The epidemiologic and virological analysis of an outbreak of hand, foot, and mouth disease in inner Mongolia in 2007. Bing Du Xue Bao. 2009; 25 (3): 159–165.

Вирус Коксаки.

Памятка туристу

10.08.2017

«Вестник АТОР» собрал основные вопросы, волнующие туристов в связи с распространившейся информацией о вирусе Коксаки в Турции, и ответы на них со стороны  специалистов – врачей, юристов и профессионалов туриндустрии.

 

В ТУРЦИИ ДЕЙСТВИТЕЛЬНО ЭПИДЕМИЯ КОКСАКИ?

Нет. Ни один федеральный орган власти ни в России, ни в Турции не подтверждает наличия эпидемии. О том, что сегодняшняя ситуация не может характеризоваться как эпидемия, говорят не только турецкий Минздрав, но и российский Роспотребнадзор. Генконсульство РФ в Анталье также не видит массовых обращений россиян по данному поводу.

Этот вид вируса свойственен южным приморским странам и его проявления наблюдались, как в Турции, так и в других странах и ранее – на форумах отелей можно найти панические вопросы от туристов, касающиеся вируса Коксаки и «эпидемии», датирующиеся 2014 и 2015 гг.

Наконец, страховые компании, имеющие реальную возможность оперативно посчитать,тех, кто заболел, единодушно говорят, что количество обращений за медицинской помощью в связи с энтеровирусными заболеваниями в Турции в этом году находится в пределах статистической нормы для летнего сезона, - другими словами "так было и раньше, это не эпидемия".

ЧТО ТАКОЕ ЭПИДЕМИЯ И КТО О НЕЙ ОБЪЯВЛЯЕТ? 

Эпидемия – это быстрое и непрерывное распространение инфекционной болезни в пределах определенной группы населения или определенного региона. При этом распространение заболевания должно значительно превышать обычно регистрируемый на данной территории уровень заболеваемости и таким образом быть возможным источником чрезвычайной ситуации.

Обычно официальное объявление об эпидемии в какой-то стране дает ее министерство здравоохранения. В России информирует граждан об эпидемиологической обстановке Роспотребнадзор. В дальнейшем информация о небезопасной ситуации в той или иной стране появляется на сайте Ростуризма. Именно на эту информацию должны ориентироваться туристы и турагентства. Отметим, со своей стороны, что даже предупреждений о «необходимости соблюдать осторожность» на отдыхе в Турции со стороны госорганов на данный момент нет.

КАК ПРОЯВЛЯЕТСЯ ВИРУС КОКСАКИ, ЧТО ЭТО ТАКОЕ?

Вирус, называемый Коксаки (Coxsackie) относится к группе энтеровирусов. Болезнь проявляется лихорадкой (высокой температурой) и сыпью (красными или коричневатыми пятнами на теле с пузырьками в центре). Сыпь обычно располагается на руках, ногах и во рту. Поэтому вирус Коксаки называют вирусом «рука-нога-рот».

Сыпь на коже может напоминать ветрянку (красные пятна/папулы, и/или полноценные водянистые пузырьки) – но вирус Коксаки никакого отношения к ветряной оспе (ветрянке) не имеет – поэтому не надо делать от нее прививки в надежде избежать энтеровируса Коксаки. Сыпь во рту может напоминать герпетический стоматит – однако если это Коксаки, то лекарства типа «зиртек» не помогут.

КТО МОЖЕТ ЗАБОЛЕТЬ КОКСАКИ?

Чаще всего заболевают дети до 5-6 лет – как правило, на пляжном отдыхе. Нередко дети, тем не менее, «приносят» вирус из обычного детского сада (возможно, его приносят вернувшиеся с отдыха другие дети).

Взрослые также могут заболеть вирусом Коксаки. Считается, что риск повторного заболевания крайне маловероятен – Коксаки дает пожизненный иммунитет.

В КАКИХ СТРАНАХ МОЖНО ЗАБОЛЕТЬ КОКСАКИ? ЭТО ТОЛЬКО ТУРЦИЯ?

Нет, вирус «рука-нога-рот» встречается и распространяется и в других странах мира (выше мы указали страны, в которых вирус отмечен в последние несколько лет). Наиболее благоприятными условиями распространения вируса является жаркая погода и влажный климат.

В «Росгосстрахе» отмечают, что бо́льшая часть обращений с энтеровирусной инфекцией в этом году – это обращения по поводу болезни детей до 7 лет на пляжном отдыхе – не только в Турции, но и, например, в Таиланде, Болгарии, Испании и др.

Наконец, вспышки заражения вирусом в разные годы неоднократно фиксировались и в различных регионах России – в особенности в те периоды, когда в том или ином регионе устанавливалась жаркая погода.

КАК ПЕРЕДАЕТСЯ КОКСАКИ? ЕСТЬ ЛИ ПРИВИВКА ОТ ВИРУСА КОКСАКИ?

Если в семье заболел один ребенок, то все другие члены семьи под угрозой, особенно дети до 10 лет, рассказывает педиатр Сергей Бутрий. Вирус не «летает по воздуху», а передается только контактно. Поэтому заболевший ребенок должен иметь свои отдельные посуду и игрушки, а всем членам семьи рекомендуется почаще обрабатывать руки спиртосодержащими антисептиками.

Прививок от энтеровируса Коксаки не существует - ни у нас в стране, ни за рубежом.

КАК МОЖНО ПРЕДОТВРАТИТЬ ЗАБОЛЕВАНИЕ РЕБЕНКА ВИРУСОМ КОКСАКИ НА ОТДЫХЕ?

Турагент и врач Светлана Обоянская дает такие рекомендации для родителей, желающих минимизировать риски заболевания ребенка вирусом Коксаки на отдыхе:

  • Обязательно соблюдать личную гигиену – мыть руки, овощи и фрукты, детскую пластиковую посуду.
  • По возможности избегать посещения детского бассейна, стараться купаться только в море.
  • В детском клубе детям находиться только в носочках, в периоды пика сезона с большим количеством детей лучше вообще исключить его посещение.
  • Поднимать иммунитет ребенка еще до отдыха: свежие овощи, фрукты, физические упражнения, много свежего воздуха в обыденной «до-отпускной» жизни ребенка снижают риск заболеть на отдыхе, т.к. в первую очередь жертвами любых вирусов становятся дети со слабым иммунитетом.

КАК ДОЛГО ДЛИТСЯ КОКСАКИ?

Как правило, период заболевания вирусом длится около 10 дней. Температуры может длиться в течение 1-4 дней, затем она как правило нормализуется самостоятельно. Боль при глотании сохраняется 1-6 дней.

Переболевший Коксаки человек может вернуться в коллектив после нормализации температуры тела и общего состояния, но главным показателем станет исчезновение элементов сыпи. До этого момента заболевший может быть заразен.

КАК ЛЕЧИТЬ РЕБЕНКА ПРИ КОКСАКИ? НУЖНО ЛИ ПРИНИМАТЬ АНТИБИОТИКИ?

Нет, антибиотики принимать не нужно – так считают врачи. Коксаки – это вирус, а антибиотики убивают только бактерии. Заболевание относится к разряду проходящих самостоятельно. Заболевшему требуется лишь облегчение состояния. Родителям и врачам нужно лишь не допускать обезвоживания и следить за осложнениями (только тогда антибиотики могут понадобиться, но их должен назначить врач).

Для снижения температуры тела можно принимать жаропонижающие типа ибупрофена или парацетамола. Во избежание обезвоживания, в особенности у детей, рекомендуется часто давать больному пить прохладную воду – холод может служить анестетиком, т.к. язвы осложняют глотание. Педиатр Сергей Бутрий также рекомендует давать больному мороженое – это и дополнительные калории, и легкая анестезия в горле.

КАК НЕ ПРОПУСТИТЬ ОСЛОЖНЕНИЯ ПРИ КОКСАКИ И ВОВРЕМЯ ВЫЗВАТЬ ВРАЧА

Самыми частыми осложнениями этих заболеваний являются обезвоживание и вторичная бактериальная инфекция.

Доктор Евгений Комаровский рекомендует СРОЧНО обратиться к врачу или вызывать скорую помощь в двух случаях:

Если ребенок обезвожен из-за полного отказа от еды и питья. Признаки этого состояния:

·         ребенок не мочился более 8 часов

·         у младенца прощупывается резко впавший родничок на голове

·         ребенок плачет без слез

·         его губы потрескались и сухие.

Если есть признаки вторичной бактериальной инфекции. Они могут быть такими:

·         Пузырьки на теле наполнились гноем или стали резко болезненными.

·         Афты в полости рта вашего ребенка настолько болезненные, что он не открывает рот, полностью отказываясь от еды и питья.

ОТМЕНА ТУРА В ТУРЦИЮ. НА КАКУЮ КОМПЕНСАЦИЮ МОЖНО РАССЧИТЫВАТЬ?

Официальные лица не вводили никаких ограничений на продажу и формирование туров в Турцию. Таким образом, при аннуляции тура до даты его начала туроператор имеет законное право удержать расходы, понесенные на организацию этого тура.

Окончательная сумма фактически понесенных им расходов зависит от даты расторжения договора и многих других факторов. Точная цифра в законе не указывается и зависит только от условий договора о реализации турпродукта, но чем ближе к дате поездки, тем штраф будет больше.

ЕСЛИ ВДРУГ СИТУАЦИЮ ПРИЗНАЮТ НЕБЕЗОПАСНОЙ, ТО ТОГДА МОЖНО БУДЕТ ВЕРНУТЬ ВСЮ СУММУ ТУРА?

Руководитель правовой службы АТОР Надежда Ефремова поясняет, что заявления Ростуризма в случае опасности туристам в той или иной стране можно условно разделить на два вида.

Первый – рекомендация соблюдать осторожность на отдыхе. Подобная формулировка не вводит никаких запретов и ограничений на путешествия в страну. В данном случае, если турист желает отказаться от тура «потому что он боится», возврат денежных средств производится согласно условиям договора о реализации турпродукта – на тех условиях, которые подписаны сторонами.

Второй вариант может предусматривать ограничение на формирование и реализацию туров в ту или иную страну. В связи с этим может также производится изменение полетных программ. В данном случае возврат денежных средств по неисполненным обязательствам туристу производится в полном объеме – но таких уведомлений по Турции в настоящее время нет.

КАК ВЕРНУТЬ ДЕНЬГИ ЗА ДОСРОЧНОЕ ВОЗВРАЩЕНИЕ ДОМОЙ.

Такой вопрос могут задать туристы, которые опасаются, что по приезде в отелm обнаружат отдыхающих с подозрительными высыпаниями. В случае, если ситуация не признана эпидемией, турист может обратиться к оператору с просьбой о компенсации недополученных услуг.

Однако, т.к. отказ от услуг произошел в момент их оказания, то партнеры туроператора не сумеют их реализовать другим туристам. То же касается и обратного авиабилета. Таким образом возврат средств за неиспользованные услуги маловероятен.

ЧТО ДЕЛАТЬ, ЕСЛИ ТУРИСТ ИЛИ ЕГО РЕБЕНОК ЗАБОЛЕЛ НА ОТДЫХЕ НАКАНУНЕ ВЫЛЕТА ОБРАТНО НА РОДИНУ, А ВРАЧ НЕ РЕКОМЕНДУЕТ ПЕРЕЛЕТ ИЗ-ЗА РИСКОВ ДЛЯ СОБСТВЕННОГО ЗДОРОВЬЯ ИЛИ РИСКОВ ЗАРАЖЕНИЯ ДРУГИХ ЛЮДЕЙ?

По этому вопросу есть смысл обратиться в вашу страховую компанию. Ответ на вопрос будет зависеть от условий страхования компании, в которой была приобретен полис. Иногда подобные риски включаются в стандартный пакет, но случается, что договором это не предусмотрено.

Исполнительный директор ERV Юлия Алчеева рекомендует туристам обратиться к своему страховщику накануне поездки и уточнить, покрываются ли страховым полисом подобные риски по карантину. Если стандартный полис такие риски не включает, имеет смысл приобрести расширенную страховку.

НА ЧТО ЕЩЕ ОБРАТИТЬ ВНИМАНИЕ ПРИ ОФОРМЛЕНИИ СТРАХОВКИ ДЛЯ ВЫЕЗЖАЮЩИХ ЗА РУБЕЖ?

Страховой полис дешевле, если он предусматривает так называемую франшизу. Обычно это сумма около 50-100 евро, которую за лечение туристу придется заплатить из своего кармана. Затраты лишь свыше указанной суммы компенсирует страховая компания.

В «Росгосстрахе» подсчитали, что средняя стоимость медицинской помощи, оказываемой в связи с вирусом, зависит от страны обращения и тяжести течения заболевания и может варьировать от 60 евро в Болгарии, 80 евро в Турции и до 1500 USD на территории США.

Если полис включен в турпакет, следует проверить заранее, предусматривает ли он франшизу. Если предусматривает, и есть опасения о вероятном заболевании Коксаки на отдыхе, то туристу (особенно с детьми) имеет смысл рассмотреть возможность купить дополнительный страховой полис – без франшизы

Вернуться назад

Вирус Коксаки

Вирус Коксаки относится к семейству энтеровирусов, Вместе со своими ближайшими родственниками – эховирусами – они вызывают энтеровирусные инфекции.   Энтеровирусные инфекции – это группа острых инфекционных болезней, вызываемых несколькими разновидностями вирусов, характеризующееся большим вариантом клинического течения.   За 7 месяцев 2017 года в Удмуртской Республике зарегистрировано 66 случаев заболевания энтеровирусной инфекцией, показатель заболеваемости составил 4,3 на 100 тысяч населения, что выше  уровня заболеваемости аналогичного периода 2016 года в 1, 3 раза. Энтеровирусная инфекция протекала клинически в виде менингита у 27 человек. Случаи энтеровирусной инфекции отмечены в Малопургинском (27 сл.), Увинском (13 сл.), Як-Бодьинском (4 сл.), Ярском (2 сл.) районах и городах Ижевске (19 сл.), Можге (1 сл.).
В связи с активизацией и дальнейшим распространением эпидемических вариантов вирусов энтеровирусной инфекции в России, разгара туристического сезона в Турции, существует риск  сохранения  напряженной эпидемической ситуации  в 2017 году.
        Протекать энтеровирусные инфекции могут в самых разных формах, от легкого недомогания и повышения температуры в течение 1-3 дней до серьезных поражений сердца и мозга. Многие впервые узнали об этой инфекции, когда СМИ начали распространять информацию о «турецкой эпидемии» и «сотнях пострадавших российских туристов». Новое и непонятное зачастую вызывает страх, особенно если выясняется, что «неведомая инфекция» в основном поражает детей. Заразиться можно по-разному – через грязную пищу, воду, различные предметы, через детские игрушки, воздушно-капельным путем, при купании в бассейнах и других водоемах. Источником заражения может стать исключительно больной человек или носитель. Зачастую энтеровирусную инфекцию невозможно отличить от банальной простуды.
        Клиника определяется как свойствами возбудителя, так и особенностями индивидуальной реактивности организма больного. Чаще болеют дети от 2 до 10 лет.  От момента заражения до появления первых симптомов заболевания проходит от 2 до 10 дней, но чаще 3-4 дня. Клиническая картина может протекать в различных вариантах. Общими клиническими признаками  энтеровирусной инфекции служат острое начало заболевания, кратковременная (2-5, реже 7 дней) лихорадка, нередко имеющая двухволновой характер. Одна из наиболее частых форм инфекции – энтеровирусная лихорадка. Характеризуется кратковременной лихорадкой без выраженных локальных поражений, головной болью, умеренными болями в мышцах, животе. В практике эта форма диагностируется как «острая респираторная инфекция». Герпетическая ангина – одна из часто встречающихся форм заболевания. На фоне высокой температуры на слизистой полости рта, зеве появляются мелкие красные пятнышки, которые превращаются в пузырьки. Через 1-2 дня пузырьки вскрываются, образуя эрозии. В течение последующих дней элементы постепенно заживают. Увеличиваются подчелюстные лимфатические узлы. Энтеровирусная экзантема – сыпь, которая может появиться на коже на 2-3 день болезни в период снижения температуры. Сыпь распространяется по лицу, телу, реже на ногах, держится 2-3 дня, затем бесследно проходит. Энтеровирусная экзантема может проявляться как самостоятельная клиническая форма, так и сопровождать другие формы энтеровирусных инфекций (серозный менингит, герпетическую ангину). Иногда при энтеровирусной инфекции может поражаться нервная система в виде серозного менингита, энцефалита. Для таких форм характерно повышение температуры до 39-40 С, к концу первого дня заболевания появляется сильная головная боль, многократная рвота, возможны судороги и даже потеря сознания. Энтеровирусная диарея проявляется частным жидким стулом на фоне повышенной температуры, болями в животе, вздутием, рвотой. Нередко эти симптомы сочетаются с катаральными явлениями. Геморрагический конъюнктивит – тоже одна из форм заболевания. Поражается сначала один глаз, а через 1-3 дня – другой. Появляется светобоязнь, слезотечение, отечность век.  В более тяжелых случаях может быть поражение сердечной мышцы с развитием миокардита.
         Если ребенок  почувствовал себя плохо,  появилась непонятная сыпь, боль в горле, повысилась температура – немедленно обратитесь к врачу!
Специфического лечения не существует. Болезнь продолжается 1-2 недели, после чего наступает самоизлечение. Из лекарств могут потребоваться только  жаропонижающие. Ребенок должен пить достаточное количество воды.
Такая картина отмечается в большинстве случаев, но иногда вирусы Коксаки могут вызывать более серьезные заболевания: энцефалиты (поражение головного мозга), миокардиты и перикардиты (поражение сердца). В таких случаях показано лечение в стационаре в течение 2–3 неделью. Больного лучше изолировать для предупреждения заражения окружающих.
После перенесенной инфекции сохраняется стойкий иммунитет, но только по отношению к одному штамму вируса. Если человек заразится другим штаммом, он снова заболеет. Специальных вакцин не существует.

Как защититься от заражения:
•    соблюдайте элементарные правила гигиены, мойте чаще руки;
•    пейте только бутилированную или кипяченую воду;
•    обращайте внимание на срок  годности при покупке продуктов в магазинах;
•    храните пищу в холодильнике;
•    тщательно мойте ягоды, овощи, фрукты;
•    содержите в чистоте детские игрушки.
Будьте здоровы!

Все, что нужно знать про вирус Коксаки

Что такое вирус Коксаки?

Вирус Коксаки относится к энтеровирусам, которые размножаются в желудочно-кишечном тракте. Энтеровирусы хорошо переносят низкие температуры, сохраняются в воде. Источником инфекции является только человек — больной или здоровый носитель.

Кто находится в зоне риска заражения вирусом Коксаки

Эти вирусы считаются «детскими», поскольку заболевают преимущественно дети от 3 до 10 лет. У взрослых заболевание встречается редко. Считается, что дети до 3-месячного возраста защищены от этого энтеровируса, а после 10-12 лет практически все уже имеют за плечами опыт заражения, после которого вырабатывается устойчивый иммунитет. Таким образом, в группу риска заражения вирусом Коксаки попадают дети старше 3 месяцев и до 12 лет, однако пик заболевания выпадает на период от 3 до 10 лет.

Как происходит заражение вирусом Коксаки

Любые энтеровирусные инфекции считаются болезнями грязных рук, и вирус Коксаки не исключение. Заразиться вирусом Коксаки можно от человека-носителя, причем как заболевшего, так и при отсутствии признаков заболевания. Распространяется вирус орально-фекальным путем — то есть заносится в рот с грязными руками.

Также возможно заражение воздушно-капельным путем, через зараженные продукты, которые не прошли термическую обработку, и даже воду.

Симптомы и признаки заражения вирусом Коксаки

Инкубационный период длится от 2 до 10 дней, чаще всего заболевание проявляется на 3-4-й день.

Первым симптомом вируса Коксаки может стать появление язвочек и водянистых прыщиков. Как правило, они становятся следствием развивающейся инфекции. Местом их локализации обычно выступают ноги и руки, однако врачи обнаруживают их и в ротовой полости. Со временем и развитием вируса язвы могут появиться по всему телу, но преимущественно они будут располагаться вокруг рта. Также часто наблюдается синдром рука-нога-рот — сыпь появляется одновременно на слизистой рта, ладонях и ступнях.

Вторым симптомом вируса Коксаки может стать плохое самочувствие. возможны сильная головная боль, рвота и диарея. Также поражается слизистая глотки, из-за чего больному трудно принимать пищу.

Третьим признаком вируса Коксаки может стать высокая температура. Она поднимается буквально за несколько часов и может не снижаться около трех дней. Так как этот вирус — инфекционное заболевание, которое не напрямую связано с данным показателем, жаропонижающие медикаментозные препараты окажутся бессильными в борьбе против высокой температуры.

Как правило, врачи рекомендуют уже при обнаружении первых язвочек обращаться в медицинское учреждение, чтобы появления дальнейших симптомов можно было избежать. Для того чтобы выявить вирус, нужно проводить лабораторное исследование.

Профилактика вируса Коксаки

На сегодняшний день вакцины от вируса Коксаки, впрочем, как и от других энтеровирусов, не получено. Единственная профилактика — соблюдение личной гигиены. Но поскольку один из путей передачи вируса — воздушно-капельный, то и этот способ не панацея. Желательно, чтобы ребенок меньше бывал в людных местах, особенно в эпидемический период. Не стоит глотать воду из бассейна, рекомендуется пить только специальную питьевую воду из чистой посуды.

В большинстве случаев болезнь постепенно проходит в течение 7-10 дней при симптоматическом лечении. В редких случаях могут развиваться осложнения в виде обезвоживания, менингита или энцефалита (воспаление головного мозга).

В целях профилактики возникновения заболеваний вирусом Коксаки и другими энтеровирусными инфекциями необходимо придерживаться следующих правил:

  • соблюдать правила личной гигиены, тщательно мыть руки с мылом перед едой, после посещения туалета, после возвращения с прогулок;
  • использовать для питья только бутилированную или кипяченую воду;
  • соблюдать температурные условия хранения пищи, употреблять в пищу продукты с известными сроками хранения;
  • тщательно мыть фрукты, ягоды, овощи;
  • при ухудшении эпидемиологической ситуации ограничивать допуск детей в бассейны.

         При первых признаках ухудшения самочувствия следует обращаться за медицинской помощью. При стандартном течении болезни симптомы исчезают за одну-две недели. В таких случаях помощь больному сводится к облегчению состояния: снижению температуры, предупреждению обезвоживания и созданию необходимых гигиенических условий.

Болезнь рук, ног и рта (вирусная инфекция Коксаки)

Последняя редакция: октябрь 2011 г.

Что такое болезнь рук, ящура и рта?

Болезнь рук, ящура и рта - это вирусная инфекция, вызываемая штаммом вируса Коксаки. Это вызывает сыпь в виде волдырей, которая, как следует из названия, охватывает руки, ноги и рот. (Болезнь рук, ящура отличается от ящура, который представляет собой инфекцию крупного рогатого скота, свиней, овец, коз и оленей и вызывается другим вирусом.)

Кто заболевает руками, ногами и ртом?

Инфекция обычно возникает у детей младше 10 лет, но иногда может возникать и у молодых людей.

Как распространяется?

Вирус передается при прямом контакте с выделениями из носа и горла, волдырями и фекалиями инфицированных людей.

Каковы симптомы и когда они появляются?

Симптомы лихорадки, плохого аппетита, насморка и боли в горле могут появиться через 3-5 дней после заражения.Сыпь в виде пузырей на руках, ногах и во рту обычно появляется через 1-2 дня после появления первых симптомов.

Когда и как долго можно распространять болезнь?

Человек заразен при появлении первых симптомов и может продолжаться до исчезновения волдырей на коже. Известно, что вирус выделяется с калом в течение нескольких недель.

Как диагностируется болезнь рук, ящура и рта?

Диагноз обычно ставится при появлении волдырей на руках, ногах и во рту у ребенка с легкой лихорадкой.Хотя для подтверждения диагноза доступны специальные вирусные тесты, они редко выполняются из-за затрат и продолжительности времени, необходимых для выполнения тестов.

Обеспечивает ли иммунитет человека предшествующее заражение вирусом Коксаки?

Может возникнуть специфический иммунитет, но возможен второй эпизод от другого штамма вируса Коксаки.

Что такое лечение?

Специального лечения нет. Лечение направлено на борьбу с лихорадкой и поддержание хорошей гидратации полости рта.

Могут ли быть осложнения, связанные с заболеваниями рук, ящура и рта?

Заболевание обычно протекает в легкой форме, осложнения возникают редко. В последнее время в Индонезии наблюдались более серьезные инфекции, вызванные определенным штаммом вирусной инфекции Коксаки.

Что можно сделать, чтобы предотвратить распространение этой болезни?

Детей, которые плохо себя чувствуют или у которых поднялась температура, следует исключать из группы до тех пор, пока температура не пройдет и ребенок не почувствует себя хорошо. Также важно тщательно мыть руки и заботиться о смене подгузников.

Есть ли риск для беременных?

Ведутся споры о любых врожденных заболеваниях, связанных с вирусными инфекциями Коксаки и беременностью. Беременным женщинам следует проконсультироваться со своим акушером для получения дополнительной информации.

[Групповая энтеровирусная инфекция, вызванная вирусом Коксаки A16 на Северо-Западе России]

Цель: Изучить особенности эпидемического процесса и этиологии заболеваний ротовой полости и конечностей энтеровирусной группы экзантемы на ряде территорий Северо-Запада России.

Материалы и методы: Выделение и идентификация неполиомиелитных энтеровирусов из материала пациентов проводилась в соответствии с рекомендациями ВОЗ. Проведено фенотипирование и филогенетический анализ энтеровирусов.

Полученные результаты: На 3 территориях Северо-Запада России зарегистрированы заболевания группы энтеровирусов полости рта и конечностей.Выявлена ​​вовлеченность в эпидемический процесс детей младше 14 лет, преимущественно младше 3 лет. Энтеровирусы Коксаки A16 из 27 образцов пациентов были выделены в клеточных культурах и идентифицированы с использованием специфических сывороток. Энтеровирусы Коксаки A16 из 16 образцов были идентифицированы с помощью частичного секвенирования области генома VP1. Филогенетический анализ показал, что идентифицированные вирусы Коксаки A16 распределены по 2 филогенетическим группам.

Заключение: Энтеровирусы Коксаки A16, ранее никогда не обнаруженные в регионе, являются этиологическим фактором заболевания ротовой полости и энтеровирусной экзантемы конечностей на 3 территориях Северо-Запада России.Полученные данные свидетельствуют о необходимости эпидемиологического и вирусологического контроля за энтеровирусной инфекцией с целью получения новой информации о циркуляции неполиомиелитных энтеровирусов среди населения и установления закономерностей развития эпидемического процесса этой инфекции.

Школьная медсестра / вирус Коксаки

Что такое болезнь рук, ног и рта?

Болезнь рук, ног и рта (HFMD) - распространенное заболевание младенцев и детей.Для него характерны лихорадка, язвы во рту и сыпь с волдырями. HFMD начинается с легкой лихорадки, плохого аппетита, недомогания ("тошнота") и часто боли в горле. Через 1-2 дня после начала лихорадки во рту появляются болезненные язвочки. Они начинаются с маленьких красных пятен, которые покрываются волдырями, а затем часто становятся язвами. Обычно они располагаются на языке, деснах и внутренней стороне щек. Кожная сыпь появляется в течение 1-2 дней с плоскими или выступающими красными пятнами, некоторые с волдырями. Сыпь не чешется, обычно она располагается на ладонях рук и подошвах ног.Также он может появиться на ягодицах. У человека с HFMD может быть только сыпь или язвы во рту.

HFMD - это то же самое, что ящур?

Нет. HFMD часто путают с ящуром крупного рогатого скота, овец и свиней. Хотя названия схожи, эти два заболевания совершенно не связаны и вызываются разными вирусами. Для получения информации о ящуре посетите веб-сайт Министерства сельского хозяйства США.

Что вызывает HFMD?

Вирусы из группы энтеровирусов вызывают HFMD.Наиболее частая причина - вирус Коксаки А16; иногда HFMD вызывается энтеровирусом 71 или другими энтеровирусами. Группа энтеровирусов включает полиовирусы, вирусы Коксаки, эховирусы и другие энтеровирусы.

Является ли HFMD серьезным?

Обычно нет. HFMD, вызванный инфекцией, вызванной вирусом Коксаки A16, является легким заболеванием, и почти все пациенты выздоравливают без лечения в течение 7-10 дней. Осложнения случаются редко. В редких случаях у пациента с инфекцией, вызванной вирусом Коксаки A16, также может развиться «асептический» или вирусный менингит, при котором у человека наблюдается лихорадка, головная боль, ригидность шеи или боли в спине, и может потребоваться госпитализация на несколько дней.Другая причина HFMD, EV71, также может вызывать вирусный менингит и, в редких случаях, более серьезные заболевания, такие как энцефалит или полиомиелитоподобный паралич. Энцефалит EV71 может быть смертельным. Случаи смертельного энцефалита произошли во время вспышек HFMD в Малайзии в 1997 г. и на Тайване в 1998 г.

Является ли HFMD заразным?

Да, HFMD умеренно заразен. Инфекция передается от человека к человеку при прямом контакте с выделениями из носа и горла, слюной, жидкостью из волдырей или стулом инфицированных людей.Человек наиболее заразен в первую неделю болезни. HFMD не передается домашним или другим животным или от них.

Как скоро кто-то заболеет после заражения?

Обычный период от заражения до появления симптомов («инкубационный период») составляет от 3 до 7 дней. Лихорадка часто является первым признаком HFMD.

Кто подвержен риску HFMD?

HFMD встречается в основном у детей младше 10 лет, но может встречаться и у взрослых.Все подвержены риску заражения, но не все инфицированные заболевают. Младенцы, дети и подростки с большей вероятностью будут восприимчивы к инфекциям и болезням, вызванным этими вирусами, потому что они реже, чем взрослые, будут иметь антитела и иметь иммунитет от предыдущего контакта с ними. Инфекция приводит к появлению иммунитета к конкретному вирусу, но второй эпизод может возникнуть после заражения другим членом группы энтеровирусов.

Каковы риски для беременных женщин, контактирующих с детьми с HFMD?

Поскольку энтеровирусы, в том числе вызывающие HFMD, очень распространены, беременные женщины часто контактируют с ними, особенно в летние и осенние месяцы.Как и для любых других взрослых, риск заражения выше для беременных женщин, у которых нет антител от более раннего контакта с этими вирусами, и которые контактируют с маленькими детьми - основными распространителями энтеровирусов.

Большинство энтеровирусных инфекций во время беременности вызывают у матери легкое заболевание или не вызывают его вовсе. Хотя доступная информация ограничена, в настоящее время нет четких доказательств того, что материнская энтеровирусная инфекция вызывает неблагоприятные исходы беременности, такие как аборт, мертворождение или врожденные дефекты.Однако матери, инфицированные незадолго до родов, могут передать вирус новорожденному. Дети, рожденные от матерей, у которых во время родов проявляются симптомы энтеровирусного заболевания, с большей вероятностью будут инфицированы. Большинство новорожденных, инфицированных энтеровирусом, имеют легкое заболевание, но в редких случаях у них может развиться обширная инфекция многих органов, включая печень и сердце, и они умирают от инфекции. Риск этого тяжелого заболевания у новорожденных выше в течение первых двух недель жизни.

Строгое соблюдение обычно рекомендуемых правил гигиены беременной женщиной может помочь снизить риск заражения во время беременности и во время родов.

Когда и где возникает HFMD?

Отдельные случаи и вспышки HFMD происходят во всем мире, чаще летом и в начале осени. В недавнем прошлом в некоторых странах Юго-Восточной Азии были зарегистрированы крупные вспышки HFMD, связанные с энтеровирусом 71 (Малайзия, 1997 г .; Тайвань, 1998 г.).

Как диагностируется HFMD?

HFMD - одна из многих инфекций, в результате которых возникают язвы во рту. Другой частой причиной является оральная герпесвирусная инфекция, которая вызывает воспаление ротовой полости и десен (иногда называемое стоматитом).Обычно врач может различить HFMD и другие причины язв во рту в зависимости от возраста пациента, характера симптомов, о которых сообщает пациент или его родитель, а также появления сыпи и язв при осмотре. Мазок из зева или образец стула можно отправить в лабораторию, чтобы определить, какой энтеровирус вызвал заболевание. Поскольку для получения окончательного ответа на тестирование часто требуется от 2 до 4 недель, врач обычно не назначает эти тесты.

Как лечится HFMD?

Специфического лечения этой или других энтеровирусных инфекций не существует.Симптоматическое лечение применяется для облегчения лихорадки, болей или боли от язв во рту.

Специальная профилактика HFMD или других энтеровирусных инфекций, не связанных с полиомиелитом, недоступна, но риск заражения можно снизить с помощью надлежащей гигиенической практики. Профилактические меры включают частое мытье рук, особенно после смены подгузников, очистку загрязненных поверхностей и грязных предметов сначала водой с мылом, а затем их дезинфекцию разбавленным раствором хлорсодержащего отбеливателя (приготовленного путем смешивания примерно чашки отбеливателя с 1 галлоном воды. .Избегание тесного контакта (поцелуи, объятия, совместное использование посуды и т. Д.) С детьми с HFMD также может помочь снизить риск инфицирования лиц, осуществляющих уход.

HMFD в учреждениях по уходу за детьми

Вспышки HFMD в детских учреждениях чаще всего возникают в летние и осенние месяцы и обычно совпадают с увеличением числа случаев заболевания в сообществе.

CDC не дает конкретных рекомендаций относительно исключения детей с HFMD из программ по уходу за детьми, школ или других групповых учреждений.Детей часто исключают из групп в течение первых нескольких дней болезни, что может снизить распространение инфекции, но не полностью его прекратит. Исключение больных людей не может предотвратить появление новых случаев, поскольку вирус может выделяться в течение нескольких недель после исчезновения симптомов. Кроме того, у некоторых людей, выделяющих вирус, в том числе у большинства взрослых, симптомы могут отсутствовать. Однако некоторую пользу можно получить, исключив детей с волдырями во рту и слюнотечением или с мокнущими высыпаниями на руках.

Если вспышка произошла в детском учреждении:

Убедитесь, что все дети и взрослые правильно мыть руки, особенно после смены подгузников.

Тщательно вымойте и продезинфицируйте загрязненные предметы и поверхности разбавленным раствором хлорсодержащего отбеливателя.

Долгосрочное наблюдение за энтеровирусной инфекцией на некоторых территориях России

Аннотация

Автор (ы): Наталья Романенкова, Людмила Голицына, Надежда Розаева, Ольга Канаева, Майна Бичурина и Надежда Новикова

В рамках глобальной ликвидации полиомиелита дополнительный надзор за энтеровирусной инфекцией стал более важным на последних этапах ликвидации полиомиелита Инициатива.С 2006 по 2019 год на 14 административных территориях Российской Федерации под руководством Субнациональной лаборатории ВОЗ по полиомиелиту в Санкт-Петербурге исследовано более 35000 проб от больных энтеровирусной инфекцией. Процент выделения полиовируса от таких больных был достаточно стабильным - от 0,1% до 0,4%. Мы подтвердили, что все обнаруженные полиовирусы, выделенные от недавно вакцинированных детей, были классифицированы как вакцинные штаммы в соответствии с внутритиповой дифференциацией.Доля выявленных неполиомиелитных энтеровирусов в ходе эпиднадзора за энтеровирусами колебалась от 8,5% до 24,3%. Эпидемический процесс и клиническая картина энтеровирусной инфекции на разных территориях имели свои особенности. На одних территориях преобладающей формой инфекции был энтеровирусный менингит, на других - энтеровирусная инфекция с экзантемой. В Санкт-Петербурге, Архангельской и Саратовской областях процент случаев энтеровирусной инфекции с клинической картиной энтеровирусного менингита значительно превышал процент энтеровирусной инфекции с экзантемой.В Республике Коми, Ленинградской и Мурманской областях процент энтеровирусной инфекции экзантемой был статистически выше, чем доля энтеровирусного менингита. Эпидемические пики энтеровирусной инфекции с преобладанием разных клинических форм инфекции зависят от разных этиологических агентов. В 2007-2008 годах мы часто выделяли от больных энтеровирусной инфекцией Echovirus 6 и Echovirus 30 на многих территориях Северо-Запада России, где энтеровирусный менингит был ведущей формой инфекции.В этот период возбудителем вспышек менингита был эховирус 30 генотипа Ec2. В 2013 году вспышки менингита на Северо-Западе России также были вызваны Echovirus 30. С помощью молекулярных исследований мы выявили, что линия Echovirus 30, которая в основном циркулировала в России в 2013 году, принадлежит новому генотипу H. Филогенетический анализ показал. что выделенные в России штаммы эховирусов 30 были тесно связаны со штаммами этого генотипа, обнаруженными в Китае в 2010-2013 гг.Поскольку ранее выделенные в России эховирусы 30 принадлежали к генотипу Ec2, который ранее был распространен в Европе, вполне вероятно, что генотип H, ранее не обнаруженный в стране, был импортирован в Россию из Юго-Восточной Азии. В 2016 году эховирус 30 различных вариантов генотипа H был замешан в пиках эпидемии энтеровирусного менингита в Костромской и Саратовской областях, где 77% случаев энтеровирусной инфекции были представлены менингитом. Через год в Саратовской области 65% случаев энтеровирусной инфекции имели клиническую картину энтеровирусного менингита.Этиологическим агентом заболевания стал эховирус 18, спровоцировавший огромный пик энтеровирусного менингита впервые с 2006 года. Штаммы эховируса 18, циркулирующие в России, были распределены по трем кластерам. Штаммы, вызывающие энтеровирусный менингит в Саратовской области, относились к кластеру 3; эти штаммы были сформированы отдельно от других штаммов этого типа энтеровирусов и отличались от эховирусов 18, периодически циркулирующих на Северо-Западе России. Вспышки и групповые случаи вирусной экзантемы рта и конечностей (кисты, ящура) зарегистрированы на Северо-Западе России в 2011-2012 гг.Вирус Коксаки А16 - этиологический агент этого энтеровирусного заболевания, ранее не обнаруженного в Северо-Западном регионе, был выделен из образцов пациентов с болезнью рук, ящура и рта. Молекулярный анализ показал, что вирусы Коксаки А16 были представлены двумя генетическими вариантами, которые были тесно связаны со штаммами, выделенными во Франции в 2010 г. и в Японии в 2011 г. Таким образом, мы предположили, что вирусы Коксаки А16, участвовавшие в вспышках, были занесены на северо-запад Россия двумя случаями завоза.В 2016 году еще один тип энтеровируса - вирус Коксаки А6 был этиологическим фактором заболевания рук, ящура в Мурманской и Ленинградской областях. В Мурманской области и Республике Коми, где в 2017 г. энтеровирусная инфекция экзантемой достигла 95% и 60% соответственно, случаи также были связаны в основном с вирусом Коксаки А6. Выявленные на Северо-Западе России штаммы вирусов Коксаки А6 относились к трем субгенотипам 5, 6 и 8 пандемического генотипа вирусов Коксаки А6.Большинство идентифицированных штаммов относились к субгенотипам 6 и 8, которые в 2017 г. доминировали в структуре вирусов Коксаки А6 на Северо-Западе России и в целом по России. В 2018-2019 годах значительных вспышек энтеровирусной инфекции не зарегистрировано. В ходе наблюдения в образцах пациентов, страдающих энтеровирусной инфекцией, были обнаружены энтеровирусы 30 различных типов, относящиеся к видам A и B энтеровирусов. Определена этиология спорадических и эпидемических случаев энтеровирусной инфекции, представленных различными клиническими формами.На некоторых территориях выявлены локальные эпидемические очаги энтеровирусной инфекции среди детей. Этиологическими агентами локальных вспышек энтеровирусного менингита в Санкт-Петербурге, Мурманской и Саратовской областях были вирус Коксаки В5, вирус Коксаки В4 и эховирус 30. Возникли эпидемические очаги энтеровирусной инфекции с экзантемой в Архангельской, Ленинградской, Мурманской и Новгородской областях. вирусов Коксаки A10, A16 и A6. Субнациональная лаборатория ВОЗ по полиомиелиту осуществляет дополнительное наблюдение за детьми из групп риска, исследуя образцы от здоровых детей до пяти лет, прибывших на Северо-Запад России из небезопасных по полиомиелиту территорий, в основном из стран Центральной Азии.Некоторые из этих детей не были вакцинированы против полиомиелита. С 2006 по 2019 год было обследовано более 1500 детей, процент изолированных полиовирусов колебался от 1,7% до 10,1%, в том числе четыре диких полиовируса типа 1, выделенных в 2010 году от таджикских детей. В ходе 14-летнего наблюдения было всего три года, когда все пробы, взятые у детей из семей мигрантов, были свободны от полиовирусов. Процент выявленных неполиомиелитных энтеровирусов при наблюдении за группами риска составлял от 7,8% до 12,9%.Спектр видов энтеровирусов, выделенных от детей, постоянно проживающих на Северо-Западе России (вирусы Коксаки А4, А10, вирусы Коксаки B1-6 и эховирусы 6, 11, 13 и 30), существенно отличается от спектра типов выделенных энтеровирусов. от детей мигрантов, прибывших на Северо-Запад России из территорий, небезопасных по полиомиелиту. От детей мигрантов были выделены энтеровирусы, такие как вирусы Коксаки А13, 17, 24, энтеровирус 99 (все они принадлежали к виду С энтеровирусов), энтеровирусы 75 и 120, ранее не циркулировавшие на Северо-Западе России Ã ¢ ÃÃ Семьи, прибывшие из территорий, небезопасных по полиомиелиту.В 2010 году вирус Коксаки А13 был изолирован от здорового таджикского ребенка, инфицированного диким полиовирусом типа 1, который был возбудителем вспышки полиомиелита в Таджикистане. Оба вируса, полиовирус дикого типа 1 и вирус Коксаки А13, принадлежащие к виду C энтеровирусов, одновременно сохранялись в организме ребенка и были импортированы на северо-запад страны. Россия из стран Средней Азии. Филогенетический анализ показал, что регулярно выявляемые на Северо-Западе России серотипы энтеровирусов, такие как вирусы Коксаки В1-6, выделенные у детей-мигрантов, отличались от вирусов такого же типа, который был распространен в нашем регионе.Сравнение нуклеотидных последовательностей вирусов Коксаки A13 и A17, выделенных от детей из Таджикистана, с известными нуклеотидными последовательностями, представленными в базе данных Международного GenBank, выявило большую разницу между ними. Полученные результаты показали необходимость обязательного обследования детей из групп риска. мониторинг циркуляции полиовирусов и неполиомиелитных энтеровирусов необходим для поддержания статуса Российской Федерации, свободного от полиомиелита, посредством высококачественного лабораторного контроля с использованием вирусологических и молекулярных методов.Определение особенностей эпидемического процесса энтеровирусной инфекции необходимо для предотвращения распространения этой инфекции и ограничения циркуляции энтеровирусов, включая завезенные новые серотипы и генотипы неполиомиелитных энтеровирусов.


Высокая распространенность вируса Коксаки А2 у детей с герпангиной в Таиланде в 2015 г.

  • 1.

    Chen SP, Huang YC, Li WC, Chiu CH, Huang CG, Tsao KC, Lin TY. Сравнение клинических характеристик вируса Коксаки А2 и энтеровируса 71 во время вспышки энтеровируса на Тайване, 2008 г .: опыт детской больницы.J Microbiol Immunol Infect. 2010. 43: 99–104.

    Артикул PubMed Google Scholar

  • 2.

    Chu PY, Lu PL, Tsai YL, Hsi E, Yao CY, Chen YH, Hsu LC, Wang SY, Wu HS, Lin YY, Su HJ, Lin KH. Пространственно-временной филогенетический анализ и молекулярная характеристика вируса Коксаки A4. Заразить Genet Evol. 2011; 11: 1426–35.

    CAS Статья PubMed Google Scholar

  • 3.

    Gaunt E, Harvala H, Österback R, Sreenu VB, Thomson E, Waris M, Simmonds P. Генетическая характеристика вариантов вируса Коксаки А6 человека, связанных с атипичной болезнью рук, ящура и рта: потенциальная роль рекомбинации в возникновении и патогенности. J Gen Virol. 2015; 96: 1067–79.

    CAS Статья PubMed PubMed Central Google Scholar

  • 4.

    Ху ЮФ, Ян Ф, Ду Дж, Донг Дж, Чжан Т, Ву ЗК, Сюэ Ю, Джин К.Полный анализ генома штаммов вируса Коксаки A2, A4, A5 и A10, выделенных у пациентов с заболеваниями рук, ног и рта в Китае, выявил частую рекомбинацию энтеровируса человека A. J Clin Microbiol. 2011; 49: 2426–34.

    CAS Статья PubMed PubMed Central Google Scholar

  • 5.

    Lee ST, Ki CS, Lee NY. Молекулярная характеристика энтеровирусов, выделенных от пациентов с асептическим менингитом в Корее, 2005 г.Arch Virol. 2007; 152: 963–70.

    CAS Статья PubMed Google Scholar

  • 6.

    Линсуванон П., Пайунгпорн С., Самрансамруаджкит Р., Посуван Н., Маккох Дж., Теанбунлерс А., Поовораван Ю. Высокая распространенность инфекции человеческого риновируса С у тайских детей с острым заболеванием нижних дыхательных путей. J Infect. 2009. 59: 115–21.

    Артикул PubMed Google Scholar

  • 7.

    Луго Д., Крогстад ​​П. Энтеровирусы в начале 21 века: новые проявления и проблемы. Curr Opin Pediatr. 2016; 28: 107–13.

    Артикул PubMed PubMed Central Google Scholar

  • 8.

    Mauleekoonphairoj J, Puenpa J, Korkong S., Vongpunsawad S, Poovorawan Y. Распространенность энтеровируса человека среди пациентов с заболеваниями рук, стоп и ротовой полости и герпангиной в Таиланде. Юго-Восточная Азия J Trop Med Public Health.2015; 46: 1013–20.

    PubMed Google Scholar

  • 9.

    Molet L, Saloum K, Marque-Juillet S, Garbarg-Chenon A, Henquell C, Schuffenecker I, Peigue-Lafeuille H, Rozenberg F, Mirand A. Энтеровирусные инфекции в больницах региона Иль-де-Франс в течение 2013 г. J Clin Virol. 2016; 74: 37–42.

    Артикул PubMed Google Scholar

  • 10.

    Понс-Салорт М., Паркер Э.П., Грассли, Северная Каролина.Эпидемиология неполиомиелитных энтеровирусов: последние достижения и нерешенные вопросы. Curr Opin Infect Dis. 2015; 28: 479–87.

    CAS Статья PubMed Google Scholar

  • 11.

    Puenpa J, Chieochansin T, Linsuwanon P, Korkong S, Thongkomplew S, Vichaiwattana P, Theamboonlers A, Poovorawan Y. Заболевания рук, стопы и рта, вызванные вирусом Коксаки A6, Таиланд, 2012. Emerg Infect Dis. 2013; 19: 641–3.

    Артикул PubMed PubMed Central Google Scholar

  • 12.

    Соломон Т., Льютуэйт П., Перера Д., Кардоса М.Дж., Макминн П., Оои М.Х. Вирусология, эпидемиология, патогенез и борьба с энтеровирусом 71. Lancet Infect Dis. 2010; 10: 778–90.

    Артикул PubMed Google Scholar

  • 13.

    Тамура К., Петерсон Д., Петерсон Н., Стечер Г., Ней М., Кумар С. MEGA5: анализ молекулярной эволюционной генетики с использованием методов максимального правдоподобия, эволюционного расстояния и максимальной экономии. Mol Biol Evol.2011; 28: 2731–9.

    CAS Статья PubMed PubMed Central Google Scholar

  • 14.

    Ип СС, Лау С.К., Ву ПК, Вонг СС, Цанг ТХ, Ло Дж.Й., Лам В.К., Цанг СС, Чан К.Х., Юэнь К.Ю. Рекомбинантный вирус Коксаки А2 и смертность детей, Гонконг, 2012 г. Emerg Infect Dis. 2013; 19: 1285–8.

    Артикул PubMed PubMed Central Google Scholar

  • Границы | Анализ генома изолятов вируса Коксаки А4, выявленных при заболеваниях рук, ног и рта в Шаньдуне, Китай

    Введение

    Энтеровирусы человека (EV), вирусы с одноцепочечной РНК без оболочки, таксономически классифицируются по роду Enterovirus (Dalldorf, 1953), семейству Picornaviridae и состоят из четырех видов: EV-A, EV-B, EV-C и EV-D (Ноулз и др., 2012). Вирус Коксаки A4 (CVA4), представитель вида EV-A, в настоящее время состоит из 25 типов, включая общие возбудители энтеровируса A71 (EVA71) и вируса Коксаки A16 (CVA16), которые являются наиболее распространенными агентами, выделенными в педиатрических случаях кистей рук и ног. - болезнь рта (HFMD), распространенное инфекционное заболевание среди детей, которое спорадически встречается во всем мире (Wang et al., 2017).

    Штамм-прототип CVA4, High Point (инвентарный номер GenBank: AY421762), был впервые выделен из городских сточных вод во время вспышки полиомиелита в Северной Каролине, США, в 1948 году (Melnick, 1950; Oberste et al., 2004). В Carey and Myers (1969) другой штамм CVA4 был выделен из сыворотки крови ребенка со смертельным исходом, отмеченным тяжелыми проявлениями центральной нервной системы. Эстрада Гонсалес и Мас (1977) обнаружили, что CVA4 ассоциирован с возникновением острого полирадикулоневрита. Примечательно, что CVA4 также упоминался как патоген во вспышках HFMD (Hu et al., 2011). Связь между инфекцией CVA4 и герпангиной (Cai et al., 2015), синдромом кожно-слизистых лимфатических узлов (Ueda et al., 2015) и двусторонним идиопатическим васкулитом сетчатки (Mine et al., 2017). Эти клинические данные подчеркивают, что инфекции CVA4 представляют собой бремя болезней для глобального общественного здравоохранения, особенно для новорожденных и маленьких детей, что требует более глубокого понимания генетического разнообразия этого патогена.

    Несколько полных геномов штаммов CVA4 были секвенированы до 2004 г. и были преимущественно из Азии и США (Oberste et al., 2004). Однако в 2004 и 2006 годах CVA4 вызвал две эпидемии HFMD на Тайване (Chu et al., 2011). После 2006 г. большее количество штаммов CVA4 было выделено в Европе и Азии, в основном из Китая. Например, в семи образцах от пациентов с острым вялым параличом (ОВП) в провинции Шэньси, собранных в период с 2006 по 2010 год, была диагностирована инфекция CVA4 (Wang et al., 2016). С 2008 г. в клинических образцах из педиатрических случаев HFMD в материковом Китае, таких как Gansu, были зарегистрированы преимущественно частичные последовательности VP1 и гораздо меньшее количество полных геномных последовательностей нескольких штаммов CVA4 (Liu et al., 2009), Шэньчжэнь (Hu et al., 2011; Cai et al., 2015), Гуандун (Zhen et al., 2014) и Пекин (Li et al., 2015).

    Геном РНК CVA4 (~ 7434 нуклеотида) можно подразделить на 5'-нетранслируемую область (UTR), 3'-UTR и открытую рамку считывания (ORF) (~ 6606 нуклеотидов), кодирующую один полипротеин, содержащий четыре структурных белки ( VP4, VP2, VP3 и VP1 в области P1) и семь неструктурных белков ( 2A, 2B и 2C в области P2 и 3A, 3B, 3C и 3D в районе P3).Ген VP1 обычно используется для таксономической классификации типов EV в пределах рода Enterovirus (Palacios et al., 2002). В настоящее время в базе данных GenBank доступно несколько полноразмерных последовательностей генома CVA4 ( n = 10), что ограничивает понимание эволюции генома CVA4 и требует более глубокого понимания генетического разнообразия этого патогена для обеспечения доказательной базы для рациональное развитие молекулярной диагностики, разработки лекарств и дизайна вакцин.

    В настоящем исследовании мы описываем полноразмерные последовательности генома ( n = 21) изолятов CVA4 от педиатрических пациентов с HFMD из провинции Шаньдун, Китай, идентифицированные между 2014 и 2016 годами, а также филогенетические и молекулярные характеристики последовательностей CVA4 VP1 . ( n = 175). Эти результаты углубляют наше понимание разнообразия и эволюции CVA4 и имеют важное значение для снижения глобального бремени болезней, связанных с этим патогеном.

    Материалы и методы

    Клинические образцы

    В этом исследовании образцы стула у детей младше 6 лет с HFMD были собраны в период с 2014 по 2016 год, а клинические образцы, которые были лабораторно подтверждены как инфекции, не связанные с EVA71 и CVA16, были любезно предоставлены Шаньдун. Центр по контролю и профилактике заболеваний.

    Выделение CVA4 и извлечение РНК из клинических образцов

    Клетки рабдомиосаркомы человека (RD) выращивали в MEM (минимальная необходимая среда, Gibco) с добавлением 10% FBS (фетальная бычья сыворотка, Gibco), 50 МЕ / мл пенициллина и 50 мкг / мл стрептомицина. Образцы трижды размножали в клетках RD человека при 37 ° C во влажной атмосфере в атмосфере 5% CO 2 .

    Суммарную РНК экстрагировали из супернатанта RD после развития цитопатического эффекта (CPE) с использованием набора RNAiso Plus (TaKaRa, 9109).РНК подвергали обратной транскрипции в кДНК с использованием случайных гексамеров с помощью набора реагентов PrimeScript RT (TaKaRa, RR037A). Анализ ПЦР в реальном времени на основе TaqMan проводился для обнаружения присутствия ЭВ с использованием системы ПЦР в реальном времени ABI 7500, как описано ранее (Zhang et al., 2017a, b). EV-положительные образцы ( n = 21) были секвенированы с использованием платформы высокопроизводительного секвенирования MiSeq, и данные секвенирования были проанализированы с использованием программы CLC для получения полных последовательностей вирусного генома.Образцы без EVA71 и без CVA16 из случаев HFMD были дополнительно протестированы с помощью CVA4-специфичного ПЦР в реальном времени с использованием олигонуклеотидных праймеров и зонда, разработанного на основе гена VP1 прототипа штамма CVA4 (номер доступа в GenBank: AY421762): CVA4-F: TATGGGCTTTGTCCAACTCC, CVA4-R: GTCTAGGGACCCATGCCCTCACT, CVA4-зонд: FAM-TGGGGACATTTTCAGCTAGAGTTGTGAGCAAG-BHQ1.

    Филогенетический анализ CVA4

    Для филогенетического анализа из GenBank были загружены два набора данных, включающие все доступные полные геномные последовательности ( n = 10) и полноразмерные последовательности гена VP1 ( n = 154) штаммов CVA4.Множественное выравнивание последовательностей для двух наборов данных было выполнено с использованием Muscle (Edgar, 2004) вместе с секвенированными геномами Shandong CVA4 ( n = 21). Модель нуклеотидного замещения была выбрана с помощью jModeltest (Darriba et al., 2012), а общая модель обратимого времени (GTR) всегда была лучшей моделью для анализа обоих наборов данных. Филогенетический анализ двух наборов данных был проведен с использованием RAxML v8.1.6 (Stamatakis et al., 2005) с моделью нуклеотидных замен GTRGAMMA с 1000 повторениями начальной загрузки.Нуклеотидные и аминокислотные расстояния оценивали с помощью MEGA 5 (Tamura et al., 2011).

    Генетическое разнообразие по генам полипротеина CVA4

    Среднее попарное генетическое разнообразие геномов CVA4 было рассчитано с помощью Phylip со скользящим окном в 300 нуклеотидов и размером шага в 50 нуклеотидов (Faria et al., 2017). Чтобы определить, в каком сайте кодонов чаще всего встречаются нуклеотидные вариации, энтропия Шеннона (Sn) в положениях 1, 2 и 3 каждого кодона выровненных полипротеиновых генов и VP4, VP2, VP3, VP1, 2A , Гены 2B, 2C, 3A, 3B, 3C и 3D соответственно были рассчитаны, как сообщалось ранее (Ramirez et al., 2013). Обработка данных выполнялась в среде R с открытым исходным кодом (R Development Core Team, 2012) с использованием пакета ggplot2.

    Эволюционная динамика глобальных штаммов CVA4

    Для определения структуры, подобной молекулярным часам, в данных CVA4 VP1 , дерево максимального правдоподобия последовательностей гена VP1 , оцененных на предыдущем этапе, было использовано для изучения связи между расхождением последовательностей и временем выборки с помощью TempEst (Rambaut et al. al., 2016). Чтобы лучше понять эволюционную динамику CVA4, набор данных VP1 ( n = 175) был использован для оценки скорости нуклеотидных замен с использованием выборки методом Монте-Карло байесовской цепи Маркова (MCMC), реализованной в пакете BEAST v1.8.4 (Drummond и Рамбаут, 2007). Модель SRD09 была использована в качестве модели нуклеотидного замещения. Байесовский процесс MCMC выполнялся для 100 миллионов шагов с частотой дискретизации каждые 5000 шагов, и первые 10% шагов отбрасывались как выгорание.Чтобы выбрать лучшую комбинацию молекулярных часов и предшествующего дерева, использовались как выборка по пути, так и выборка по траектории (Baele et al., 2012). Наилучшей комбинацией моделей было предварительное байесовское дерево горизонта и модель некоррелированных расслабленных молекулярных часов с логарифмически нормально распределенными вариациями скоростей между ветвями (дополнительная таблица S1) (Drummond et al., 2005). Апостериорные распределения были оценены с помощью Tracer v1.6, где предполагаемый размер выборки (ESS) был не менее 200. Байесовское дерево максимального доверия (MCC) было создано с помощью TreeAnnotator v1.8.4, а затем визуализировали с помощью FigTree v1.4.3. Кроме того, мы выполнили байесовский анализ графика горизонта с помощью программы Tracer v1.6 для реконструкции эволюционной истории на основе 175 полноразмерных последовательностей гена VP1 штаммов CVA4.

    Результаты

    Сводка набора данных

    В этом исследовании в общей сложности 21 штамм CVA4 был выделен из образцов стула пациентов с HFMD в провинции Шаньдун, в том числе пять из Ляочэна, три из Хэцзэ, по два из Дэчжоу, Линьи, Вэйхай, Яньтай и отдельные образцы из Биньчжоу, Лайу и др. Тайан, Циндао и Жичжао (рис. 1 и дополнительная таблица S2).Полногеномные последовательности 21 изолята были депонированы в базу данных GenBank: MH086030-MH086050 (дополнительная таблица S2).

    Рисунок 1. Филогенетическое дерево максимального правдоподобия последовательностей полного генома CVA4 ( n = 31). 21 изолят CVA4, описанный в этом исследовании, окрашен в розовый цвет, а узлы эталонных красителей, загруженных из GenBank, окрашены в сиреневый. Три клады (I, II и III) окрашены в синий, фиолетовый и светло-зеленый цвета, а штамм-прототип CVA4 High Point (AY421762) окрашен в красный цвет.

    Десять полных геномов CVA4 в период с 1948 по 2015 год были общедоступны в GenBank, восемь штаммов из Китая и два из США. Полноразмерные последовательности гена CVA4 VP1 ( n = 175) штаммов также были извлечены. Они были изолированы от Азербайджанской Республики ( n = 1), Китая ( n = 145), Индии ( n = 8), Кении ( n = 1), России ( n = 15). ), Туркменистан ( n = 1) и США ( n = 4) (дополнительный рисунок S1), соответственно.Даты сбора варьировались с 1948 по 2016 год (дополнительный рисунок S1). Примечательно, что 94,9% ( n = 166) из них были отобраны с 2006 года, а 84,9% ( n = 141) были собраны из 16 провинций и городов Китая, включая Шаньдун ( n = 60), Сычуань ( n = 18), Пекин ( n = 14), Шанхай ( n = 11), Шэньчжэнь ( n = 9), Хунань ( n = 7), Юньнань ( n = 4) , Чунцин ( n = 4), Цзилинь ( n = 3), Нинся ( n = 2), Цзянсу ( n = 2), Хайнань ( n = 2), Гуандун ( n = 2), Аньхой ( n = 1), Хэнань ( n = 1) и Чжэцзян ( n = 1).

    Филогенетическая характеристика CVA4

    Филогенетический анализ 31 целого генома показал, что 21 изолят из настоящего исследования разделились на три строго поддерживаемые клады (рис. 1). 17 штаммов были локализованы в основной кладе вместе с семью китайскими штаммами, собранными в период с 2008 по 2011 гг. Два изолята, SDLC / 16114 / China / 2016-05-08 и SDQD / QD384R / China / 2016-06-17, сгруппированы в одну независимую кладу а изоляты SDLY / 2014LY124R / China / 2014-04-23 и SDHZ / h437 / China / 2015-04-28, а также ранее описанные KP289442 / P1033 / 2013 / China / 2013 принадлежали к отдельной третьей кладе.Кроме того, 21 шаньдунский изолят имел более высокую гомологию нуклеотидных последовательностей с восемью ранее описанными китайскими штаммами (82,0–99,8%), чем с штаммом-прототипом High Point / United States / 1948 (77,8–79,3%) и американским штаммом 2015-OB2038. / TN / United States / 2015-04-16 (75,5–78,3%).

    В дереве максимального правдоподобия для генов VP1 (дополнительный рисунок S2) изоляты CVA4 были разделены на четыре высоко поддерживаемых генотипа: A ( n = 1), B ( n = 1), C ( n = 28) и D ( n = 145).Прототип штамма High Point, выделенного из США в 1948 г., был классифицирован как генотип A, а один изолят из Кении в 1999 г. был обозначен как генотип B. Штаммы CVA4, расщепляющиеся с генотипом C, были собраны в России в 2006–2014 гг. = 14), Индия в 2010 г. ( n = 8), США в 1999 г. ( n = 1) и 2015 г. ( n = 1), провинция Сычуань, Китай в 2006 г. ( n = 1) и 2007 г. ( n = 1), Азербайджан ( n = 1) и Туркменистан ( n = 1), соответственно.Поразительно, но генотип D был преобладающим генотипом в Китае. Генотип D можно разделить на два субгенотипа с высокой степенью поддержки: D1 ( n = 5) и D2 ( n = 140). Более подробно, пять китайских штаммов, выделенных до 2006 года, принадлежали к субгенотипу D1, а остальные китайские штаммы сгруппированы в субгенотипе D2, включая 21 изолят, описанный в настоящем исследовании. Однако наши секвенированные штаммы не группировались вместе, а были вкраплены в субгенотип D2.Примечательно, что был один штамм CVA4 из России, KC879539 / 40238 / Russia / 2011, подпадающий под субгенотип D2 и обладающий высокой гомологией (97,5%) с KY978552 / 11142 / SD / China / 2011.

    Среднее значение между групповыми нуклеотидными и аминокислотными расстояниями составляло 21,8 и 2,4% (генотип CVA4 A против B), 22,5 и 2,8% (A против C), 21,7 и 2,3% (A против D), 28,9 и 2,6%. (B против C), 28,0 и 2,9% (B против D) и 20,4 и 3,2% (C против D), соответственно. Кроме того, среднее расстояние между нуклеотидами (и аминокислотами) между группами D1 и D2 составляло 15.2% (2,2%). Средние нуклеотидные (и аминокислотные) расстояния в группах C и D составляли 13,2% (2,8%) и 6,0% (1,3%) соответственно, т.е. 15%. Средние нуклеотидные (и аминокислотные) расстояния в группах D1 и D2 составляли 10,4% (2,0%) и 5,3% (1,2%) соответственно.

    Парное генетическое разнообразие вдоль генома CVA4

    Используя анализ скользящих окон по геномам CVA4 ( n = 31), мы обнаружили, что попарное генетическое разнообразие в областях P2 (включая гены 2A, 2B, и 2C, ) и P3 (включая 3A, 3B , 3C и 3D ) был выше, чем в области P1 (включая гены VP4, VP2, VP3 и VP1 ) (рис. 2A).Кроме того, 3A, 3B и 3'-конец 3D показали более высокое попарное генетическое разнообразие, чем другие области гена. Ген полипротеина 21 генома CVA4 из настоящего исследования имел 82,6–99,2% гомологии нуклеотидной последовательности и соответствующую гомологию аминокислотной последовательности 97,1–99,9%, что позволяет предположить наличие многочисленных синонимичных мутаций. В соответствии с этим наблюдением, среднее значение Sn в третьей позиции кодонов гена полипротеина штаммов CVA4 было равно 0.224, что значительно выше, чем в положениях 1 и 2 кодонов (Рисунок 2B). Кроме того, средние значения Sn в третьей позиции кодонов 2B, 2C, 3A, 3C и 3D генов были значительно выше, чем у VP1, VP2, VP3 и VP4 . гены в области P1 (рис. 2C).

    Рисунок 2. Генетическое разнообразие генов полипротеина CVA4 ( n = 31). (A) Среднее попарное генетическое разнообразие всех генов полипротеина CVA4 было рассчитано с использованием скользящего окна в 300 нт с размером шага 50 нс. (B) Значения позиционной энтропии и значения Sn в разделах 1, 2 и 3 каждого кодона были оценены соответственно. ∗∗∗ p -значение <0,001 в тесте суммы рангов Вилкоксона. (C) Значения Sn нуклеотидов в трех положениях кодонов были оценены в генах VP4, VP2, VP3, VP1, 2A, 2B, 2C, 3A, 3B, 3C и 3D соответственно. . ∗∗∗ p -значение <0,001 в тесте суммы рангов Вилкоксона между генами 2B, 2C, 3A, 3C, 3D и генами VP4, VP2, VP3, VP1 соответственно.

    Эволюционная динамика мирового CVA4

    Байесовское филогенетическое дерево всех генов CVA4 VP1 ( n = 175), реконструированное с использованием модели наилучшего соответствия, выявило ту же топологию, что и филогенетическое дерево максимального правдоподобия (рис. 3). Анализ структуры молекулярных часов Tempest выявил сильную временную корреляцию в гене VP1 ( R 2 = 0,86). Средняя скорость нуклеотидных замен для генов CVA4 VP1 была оценена как 5.12 × 10 -3 замен / участок / год (95% наивысшая апостериорная плотность (HPD): 4,45 × 10 -3 –5,81 × 10 -3 замен / участок / год). Примерно в 1941 году (95% HPD: 1931–1948) вирусы CVA4, по оценкам, разделялись на генотип A и общее происхождение генотипов B, C и D. Предполагалось, что генотип B отклонился от общего происхождения примерно в 1951 году. (95% HPD: 1933–1966), и, наконец, генотипы C и генотип D разошлись примерно в 1970 году (95% HPD: 1961–1977).Кроме того, генотип D был далее разделен на субгенотипы D1 и D2, которые произошли примерно в 1979 году (95% HPD: 1974–1985), и время до самого последнего общего предка (tMRCA) субгенотипа D2 можно было проследить. назад в 2001 г. (95% HPD: 1999–2003 гг.).

    Рисунок 3. Байесовский филогенетический анализ и демографическая реконструкция последовательностей гена CVA4 VP1 (915 нт). (A) Байесовская филогения была проведена BEAST с предварительным байесовским деревом горизонта и расслабленной моделью молекулярных часов. (B) - ось x - это шкала времени (в годах), а ось y - эффективный размер популяции в логарифмической шкале Neτ. Толстая сплошная линия указывает средние оценки, а заштрихованная область указывает на 95% -ную самую высокую апостериорную плотность.

    Кроме того, мы выполнили байесовский анализ графика горизонта, чтобы восстановить демографическую историю CVA4 на основе последовательностей гена VP1 (рис. 3). Наши результаты показали, что эффективный размер популяции (аналог количества инфицированных людей) вируса CVA4 прошел пять основных стадий с момента описания прототипа штамма High Point в 1948 году (рис. 3).Первый этап охватывал период с 1948 по 2000 год, когда численность популяции была относительно постоянной, с признаками небольшого увеличения. На этой стадии генотипы B, C и D уже присутствовали до 1975 года, а также возникновение генотипа D1 в начале 1980-х и последующая совместная циркуляция генотипов B, C и субгенотипа D1. На втором этапе размер популяции резко и быстро уменьшился с 2000 г. примерно до середины 2003 г., возможно, из-за снижения распространенности генотипа B и субгенотипа D1 (или, возможно, отсутствия данных наблюдения), поскольку генотип C и субгенотип D2 разнообразились за этот период.Вскоре после середины 2003 г. численность популяции CVA4 резко и быстро росла до 2010 г., когда широко распространялись генотип C в России и Индии и субгенотип D2 в Китае. После 2010 г. произошло еще одно резкое и резкое уменьшение эффективного размера популяции, которое могло быть вызвано уменьшением распространенности генотипа C. С 2011 г. CVA4, по-видимому, вступил в стадию восстановления, и размер популяции снова стал стабильным с субгенотипом. D2 доминирует в Китае.

    Молекулярные характеристики

    По сравнению с прототипом штамма CVA4 High Point, 40 аминокислотных замен было идентифицировано в полипротеине в> 75% наших изолятов, в том числе 1 в VP4 , 2 в VP2 , 2 в VP3 , 6 в VP1 , 6 дюймов 2A , 1 дюйм 2B , 5 дюймов 2C , 1 дюйм 3A , 3 дюйма 3C и 11 дюймов 3D (дополнительная таблица S3). В EVA71 ранее сообщалось, что 14 критических аминокислотных остатков и два генных мотива связаны с вирусной инфекционностью in vitro и in vivo (Таблица 1) (30–43).Интересно, что штаммы CVA4 содержали те же аминокислотные остатки в нескольких сайтах, что и штамм EVA71 BrCr, такие как остатки 37, 113 и 192 белка VP1 , 84, 82–86 и 154–156 белка. Белка 3C и 73 и 363 белка 3D (таблица 1). Однако, в отличие от VP1 169L прототипа штамма EVA71, VP1 169F был обнаружен в High Point и в каждом из наших 21 изолята CVA4, что указывает на то, что CVA4, возможно, адаптировался для связывания с классом мышиного мусорщика. Участник B 2 (SCARB2) (Victorio et al., 2016). Примечательно, что присутствовали разные аминокислотные остатки на VP2 149 , VP1 97 , VP1 98 , VP1 123 , VP1 167

    24254 9025 между EVA71 BrCr и штаммами CVA4, а VP1 145K наблюдался среди наших изолятов CVA4.

    Таблица 1. Сравнение потенциальных критических аминокислотных остатков прототипных штаммов EV71 и CVA4 и 21 изолята, описанного в настоящем исследовании.

    Обсуждение

    Хотя EVA71 и CVA16 известны как основные возбудители HFMD в Китае, сообщалось, что ряд других видов EV-A, включая CVA6, CVA10, CVA2 и CVA4, связаны с HFMD. Кроме того, CVA4 также был одним из распространенных патогенов, связанных со случаями асептического менингита, герпетической ангины и вирусного миокардита (Carey and Myers, 1969; Estrada Gonzalez and Mas, 1977; Lee et al., 2014; Wang et al., 2016), что вызвало серьезную озабоченность в области общественного здравоохранения и вызвало предположения о том, существует ли измененный тропизм или патогенность, связанная с этим типом СС.Однако подробный анализ генома был проблематичным, поскольку на сегодняшний день в базе данных GenBank доступно только десять полных геномов CVA4 (Hu et al., 2011). Следовательно, молекулярно-эпидемиологическая характеристика CVA4 остается гораздо менее понятной из-за недостатка доступных геномных данных.

    В этом исследовании мы описали 21 новый геном CVA4, выделенный от детей с HFMD, и выявили, что наши изоляты сгруппированы в три хорошо поддерживаемых клады на дереве максимального правдоподобия, оцененном с использованием полных геномов.Это свидетельствует о наличии определенного генетического разнообразия китайских вирусов CVA4, которое было бы недооценено из-за ограниченности имеющихся данных эпиднадзора. Филогенетический анализ последовательностей гена VP1 показал, что штаммы CVA4 можно разделить на четыре отдельных генотипа, A-D, со средним генетическим расстоянием в пределах генотипа 0,00–13,2% и средним генетическим расстоянием между генотипами 20,4–28,9%. Следовательно, в соответствии с предыдущими отчетами (Rico-Hesse et al., 1987; Hu et al., 2011), различные генотипы CVA4 могут быть определены с> 15% нуклеотидного расстояния между генотипами в гене VP1 . Однако, в отличие от предыдущего отчета (Hu et al., 2011), штамм-прототип High Point образовал независимую ветвь как генотип А в нашей классификации. Подавляющее большинство китайских штаммов, включая 21 изолят в этом исследовании, принадлежали к генотипу D, и только два штамма, идентифицированные в провинции Сычуань в 2006 и 2007 годах, принадлежали к генотипу C.Кроме того, на основании имеющихся данных субгенотип D2, по-видимому, вытеснил D1 и стал преобладающим в Китае за предыдущее десятилетие.

    Дальнейший анализ показал, что мутации с большей вероятностью возникают в областях P2 и P3, кодирующих неструктурные белки, и в третьем положении кодонов, что согласуется с предыдущими сообщениями о том, что существует общий образец использования синонимичных кодонов для многих типов энтеровирусов ( Liu et al., 2011; Ma et al., 2014; Zhang et al., 2014; Su et al., 2017). Более того, ген VP1 был наиболее консервативной областью в нашем анализе, что позволяет предположить, что он может быть потенциальной мишенью для разработки чувствительного и специфичного к CVA4 диагностического анализа RT-qPCR, а также может быть эпитопом-кандидатом для разработки вакцин.

    С середины 1950-х годов генетическое разнообразие CVA4 постепенно увеличивалось с 1948 по 1999 год и резко увеличивалось в период с середины 2003 по 2009 год, параллельно с увеличением распространенности CVA4 в Китае. Однако численность популяции, по оценкам, испытала более существенное сокращение в 1999 г., середине 2003 г. и с 2009 по 2011 г., чем в предыдущем отчете (Chen et al., 2018). Учитывая, что точность анализа демографической реконструкции чувствительна к выборке, определение резкого уменьшения размера популяции CVA4 в период с 1999 по середину 2003 года потребует дополнительных усилий по выборке. Следовательно, срочно необходим национальный надзор за различными энтеровирусами человека, вызывающими HFMD, для выяснения сложной эволюционной динамики и совместной циркуляции энтеровирусов, чтобы обеспечить доказательную базу для рациональных диагностических и профилактических подходов к снижению бремени болезней.

    Средняя скорость эволюции гена CVA4 VP1 была оценена как 5,12 × 10 -3 замен / сайт / год, немного ниже, но в том же диапазоне, что и 6,4 × 10 -3 замен / сайт / год. Чен и др. (2018). По нашим оценкам, общий предок известного CVA4 существовал приблизительно 75 лет назад, что также сходно с предыдущей оценкой (71,8 года назад) (Tee et al., 2010). Интересно, что скорость эволюции EVA71 VP1 оценивается примерно в 4.6 × 10 -3 замен / сайт / год для обеих геногрупп EVA71 B и C (Tee et al., 2010; Chen et al., 2018). Скорость эволюции CVA6 оценивается в 8,1 × 10 -3 замен / сайт / год (Puenpa et al., 2016), а CVA16 - 6,7 × 10 -3 замен / сайт / год (Zhao et al. ., 2016). Следовательно, CVA4, по-видимому, эволюционирует с той же скоростью, что и другие основные патогены HFMD, что заслуживает дальнейшего внимания.

    Coxsackievirus A4 имеет общие фенотип-ассоциированные аминокислотные замены по сравнению с прототипным штаммом EVA71, BrCr.Особо следует отметить, что VP1 169F , идентифицированный в EVA71, возможно, придавал способность связывания вируса с рецептором SCARB2 млекопитающих, также обнаруживаемым в изолятах CVA4 (Yamayoshi et al., 2012). Кроме того, у вирусов BrCr и CVA4 было несколько сайтов с разными аминокислотными мотивами. Однако следует отметить, что, хотя биологическая значимость этих сайтов со специфическими аминокислотными заменами была подтверждена в EVA71, они были идентифицированы путем сравнения последовательностей между CVA4 и EVA71. Следовательно, влияние этих критических аминокислот в CVA4 на связывание с рецептором , вирусная инфекционность, адаптация млекопитающих к репликации и патогенез требуют дальнейших исследований.

    Кроме того, мы также обнаружили потенциальные события генетической рекомбинации в геномах CVA4 ( n = 31) с помощью программы обнаружения рекомбинации (RDP) v4.16 (Martin et al., 2015) и Simplot v3.5.1 (Hu et al. , 2011). Однако нам не удалось обнаружить убедительные события рекомбинации в 21 недавно секвенированном вирусе CVA4 (данные не показаны). В целом, похоже, что генетическая замена, а не рекомбинация, сыграла более важную роль в эволюции и диверсификации CVA4, несмотря на то, что события рекомбинации часто идентифицируются в других энтеровирусах человека (Hu et al., 2011). Однако ограниченные данные эпиднадзора могли также привести к недооценке количества событий генетической рекомбинации в эволюции CVA4.

    Таким образом, мы описали 21 новую последовательность генома CVA4, которая значительно обогащает доступные геномные данные для CVA4. Филогенетический анализ показал, что генотипы C, D1 и D2 совместно циркулировали в начале 2000-х годов, а теперь D2 вытеснил D1 и стал преобладающим субгенотипом в Китае. Генетическое разнообразие китайского CVA4 обнаруживается в областях, кодирующих неструктурные белки, и в третьей позиции колебания кодонов.Напротив, меньше мутаций произошло в области гена VP1 , что делает ее оптимальной областью-кандидатом для разработки молекулярных анализов и потенциально в качестве консервативного эпитопа для вакцинации. Примечательно, что CVA4 может обладать более высокой аффинностью связывания с SCARB2 из-за замены L169F в белке VP1 , и то, как эта замена влияет на вирусную инфекционность и клинический исход, следует исследовать в будущем. В дополнение к мониторингу EVA71 и CVA16 в Китае срочно необходим усиленный надзор за все более распространенными, а также вирулентными агентами, включая CVA4, для лучшего понимания динамики циркуляции и эволюции энтеровирусов человека, что предоставит бесценную информацию для диагностических и профилактических подходов к содержать болезнь.

    Авторские взносы

    MW, JL и W-FS разработали исследование, участвовали во всех тестах и ​​составили рукопись. M-XY, Y-WZ, S-JD и X-JW участвовали в сборе и тестировании образцов. TH, MC, SD, X-CZ, Z-JZ, HZ и Y-GT разработали исследование, внесли свой вклад в анализ результатов и подготовку исправленных версий рукописей. Все авторы прочитали и одобрили окончательную рукопись.

    Финансирование

    Работа выполнена при поддержке Национальной программы исследований и разработок в области ключевых технологий Китая (проект №2017ZX10104001-006), Фонд естественных наук провинции Шаньдун (ZR2018PH034), Проекты развития медицины и здравоохранения провинции Шаньдун (2013WS0157 и 2017WS066), Муниципальная программа развития науки и технологий Тайань (2017NS0107) и Национальный фонд естественных наук Китая (81601773). W-FS был поддержан программой стипендиатов Тайшань провинции Шаньдун (ts201511056).

    Заявление о конфликте интересов

    Авторы заявляют, что исследование проводилось при отсутствии каких-либо коммерческих или финансовых отношений, которые могут быть истолкованы как потенциальный конфликт интересов.

    Дополнительные материалы

    Дополнительные материалы к этой статье можно найти в Интернете по адресу: https://www.frontiersin.org/articles/10.3389/fmicb.2019.01001/full#supplementary-material

    Сноски

    1. http: /beast.bio.ed.ac.uk/Tracer
    2. http: /tree.bio.ed.ac.uk/software/figtree/
    3. www.picornaviridae.com

    Список литературы

    Арита, М., Симидзу, Х., Нагата, Н., Ами, Ю., Сузаки Ю., Сата Т. и др. (2005). Чувствительные к температуре мутанты энтеровируса 71 демонстрируют ослабление у яванских макак. J. Gen. Virol. 86 (Pt 5), 1391–1401. DOI: 10.1099 / vir.0.80784-0

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Баэле, Г., Лемей, П., Бедфорд, Т., Рамбаут, А., Сушард, М. А., Алексеенко, А. В. (2012). Повышение точности сравнения моделей демографических и молекулярных часов с учетом филогенетической неопределенности. Мол. Биол. Evol. 29, 2157–2167. DOI: 10.1093 / molbev / mss084

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Цай К., Яо X., Чжо Ф., Хэ Ю. и Ян Г. (2015). [Генная характеристика области VP1 вируса Коксаки A4 из случаев герпетической ангины в Шэньчжэне, Китай]. Чжунхуа И Сюэ За Чжи 95, 1226–1229.

    PubMed Аннотация | Google Scholar

    Каин, Э. А., Монкла, Л. Х., Рондерос, М. Д., Фридрих, Т. К., и Осорио, Дж.Э. (2016). Единственная мутация в VP1 энтеровируса 71 ответственна за повышенную вирулентность и нейротропизм у взрослых мышей с дефицитом интерферона. J. Virol. 90, 8592–8604. DOI: 10.1128 / JVI.01370-16

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Кэри Д. Э. и Майерс Р. М. (1969). Выделение вируса Коксаки типа A4 из сыворотки крови ребенка с быстро смертельным заболеванием с тяжелыми проявлениями центральной нервной системы. Индиан Дж.Med. Res. 57, 765–769.

    PubMed Аннотация | Google Scholar

    Chen, P., Wang, H., Tao, Z., Xu, A., Lin, X., Zhou, N., et al. (2018). Множественные цепи передачи вируса Коксаки A4, одновременно циркулирующего в Китае и соседних странах в последние годы: филогенетический и пространственно-временной анализ на основе вирусологического надзора. Мол. Филогенет. Evol. 118, 23–31. DOI: 10.1016 / j.ympev.2017.09.014

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Чу, П.Ю., Лу, П. Л., Цай, Ю. Л., Си, Э., Яо, К. Ю., Чен, Ю. Х. и др. (2011). Пространственно-временной филогенетический анализ и молекулярная характеристика вируса Коксаки A4. Заражение. Genet. Evol. 11, 1426–1435. DOI: 10.1016 / j.meegid.2011.05.010

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Чуа, Б. Х., Фуэктес, П., Сандерс, С. А., Николлс, П. К., и Макминн, П. К. (2008). Молекулярные основы адаптации мышей к энтеровирусу человека 71. J. Gen.Virol. 89 (Pt 7), 1622–1632. DOI: 10.1099 / vir.0.83676-0

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Cordey, S., Petty, T. J., Schibler, M., Martinez, Y., Gerlach, D., van Belle, S., et al. (2012). Идентификация сайт-специфических адаптаций, вызывающих повышенный тропизм нервных клеток во время инфицирования энтеровирусом человека 71. PLoS Pathog. 8: e1002826. DOI: 10.1371 / journal.ppat.1002826

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Дальдорф, Г.(1953). Группа вирусов Коксаки. Ann. Акад. Sci. 56, 583–586. DOI: 10.1111 / j.1749-6632.1953.tb30251.x

    CrossRef Полный текст | Google Scholar

    Драммонд, А. Дж., Рамбо, А., Шапиро, Б., и Пибус, О. Г. (2005). Байесовский объединенный вывод прошлой динамики популяции на основе молекулярных последовательностей. Мол. Биол. Evol. 22, 1185–1192. DOI: 10.1093 / molbev / msi103

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Эстрада Гонсалес, Р., и Мас, П. (1977). Вирусологические исследования при остром полирадикулоневрите ЛГБС-типа. Различные выводы в отношении вируса Коксаки A4. Neurol. Neurocir. Psiquiatr. 18 (2–3 приложения), 527–531.

    PubMed Аннотация

    Фариа, Н. Р., Квик, Дж., Кларо, И. М., Тезе, Дж., Де Хесус, Дж. Г., Джованетти, М. и др. (2017). Установление и загадочная передача вируса Зика в Бразилии и Америке. Природа 546, 406–410. DOI: 10.1038 / nature22401

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Ху, Ю.F., Yang, F., Du, J., Dong, J., Zhang, T., Wu, Z.Q., et al. (2011). Полный анализ генома штаммов вируса Коксаки A2, A4, A5 и A10, выделенных у пациентов с заболеваниями рук, ног и рта в Китае, выявил частую рекомбинацию энтеровируса человека A. J. Clin. Microbiol. 49, 2426–2434. DOI: 10.1128 / JCM.00007-11

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Хуанг, С. В., Ван, Ю. Ф., Ю, К. К., Су, И. Дж., И Ван, Дж. Р. (2012). Мутации в капсидных белках VP2 и VP1 увеличивают инфекционность и летальность энтеровируса 71 для мышей за счет связывания вируса и увеличения накопления РНК. Вирусология 422, 132–143. DOI: 10.1016 / j.virol.2011.10.015

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Келли, Дж. Т., Де Колибус, Л., Эллиотт, Л., Фрай, Э. Э., Стюарт, Д. И., Роулендс, Д. Дж., И др. (2015). Сильные противовирусные агенты не вызывают генетически стабильных мутаций устойчивости ни в энтеровирусе 71, ни в вирусе Коксаки А16. Антивирь. Res. 124, 77–82. DOI: 10.1016 / j.antiviral.2015.10.006

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Ноулз, Н.J., Hovi, T., Hyypiä, T., King, A.MQ., Lindberg, A.M., Pallansch, M.A., et al. (2012). «Picornaviridae» в таксономии вирусов : классификация и номенклатура вирусов: девятый доклад Международного комитета по таксономии вирусов , ред. А. М. К. Кинг, М. Дж. Адамс, Э. Лефковиц и Э. Б. Карстенс (Сан-Диего, Калифорния: Эльзевьер).

    Google Scholar

    Ли, К.Дж., Хуанг, Ю.С., Янг, С., Цао, К.С., Чен, К.Дж., Се, Ю.С., и др. (2014). Клинические особенности инфекций, вызванных вирусом Коксаки A4, B3 и B4, у детей. PLoS One 9: e87391. DOI: 10.1371 / journal.pone.0087391

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Ли, Дж. С., Дун, Х. Г., Цинь, М., Се, З. П., Гао, Х. К., Ян, Дж. Й. и др. (2015). Вспышка лихорадочного заболевания, вызванного вирусом Коксаки A4, в детском саду в Пекине, Китай. Virol. J. 12:92. DOI: 10.1186 / s12985-015-0325-1

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Лю Дж. Ф., Чжан Ю. и Ли Х.(2009). [Генетическая характеристика VP4-VP2 двух вирусов Коксаки A4, выделенных от пациентов с болезнью рук, ящура и рта]. Чжунго И Мяо Хэ Мянь И 15, 345–349.

    PubMed Аннотация | Google Scholar

    Лю Ю. С., Чжоу, Дж. Х., Чен, Х. Т., Ма, Л. Н., Пейсак, З., Дин, Ю. З. и др. (2011). Характеристики использования синонимичных кодонов в вирусе энтеровируса 71 и влияние хозяина на вирус в структуре использования кодонов. Заражение. Genet. Evol. 11, 1168–1173.DOI: 10.1016 / j.meegid.2011.02.018

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Ма, М. Р., Хуэй, Л., Ван, М. Л., Тан, Ю., Чанг, Ю. В., Цзя, К. Х. и др. (2014). Общая картина использования кодонов энтеровируса 71. Genet. Мол. Res. 13, 336–343. DOI: 10.4238 / 2014. 21 января.1

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Мартин Д. П., Мюррелл Б., Голден М., Хосал А. и Мухир Б. (2015). RDP4: обнаружение и анализ паттернов рекомбинации в вирусных геномах. Virus Evol. 1: vev003. DOI: 10.1093 / ve / vev003

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Мельник, Дж. Л. (1950). Исследования вирусов Коксаки; свойства, иммунологические аспекты и распространение в природе. Bull. Акад. Med. 26, 342–356.

    PubMed Аннотация | Google Scholar

    Mine, I., Taguchi, M., Sakurai, Y., and Takeuchi, M. (2017). Двусторонний идиопатический васкулит сетчатки после инфицирования вирусом Коксаки A4: отчет о клиническом случае. BMC Ophthalmol. 17: 128. DOI: 10.1186 / s12886-017-0523-2

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Миямура, К., Нисимура, Ю., Або, М., Вакита, Т., и Симидзу, Х. (2011). Адаптивные мутации в геномах штамма энтеровируса 71 после инфицирования клеток мыши, экспрессирующих лиганд-1 гликопротеина Р-селектина человека. J. Gen. Virol. 92 (Pt 2), 287–291. DOI: 10.1099 / vir.0.022418-0

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Нисимура, Ю., Ли, Х., Хафенштейн, С., Катаока, К., Вакита, Т., Бергельсон, Дж. М. и др. (2013). Связывание энтеровируса 71 с PSGL-1 на лейкоцитах: VP1-145 действует как молекулярный переключатель, контролирующий взаимодействие рецепторов. PLoS Pathog. 9: e1003511. DOI: 10.1371 / journal.ppat.1003511

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Оберсте, М.С., Пенаранда, С., Махер, К., и Палланш, М.А. (2004). Полные последовательности генома всех представителей вида Энтеровирус человека А. J. Gen. Virol. 85 (Pt 6), 1597–1607. DOI: 10.1099 / vir.0.79789-0

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Паласиос, Г., Касас, И., Тенорио, А., Фрейре, К. (2002). Молекулярная идентификация энтеровируса путем анализа частичной области генома VP1 различными методами. J. Clin. Microbiol. 40, 182–192. DOI: 10.1128 / jcm.40.1.182-192.2002

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Пуэнпа, Дж., Vongpunsawad, S., Osterback, R., Waris, M., Eriksson, E., Albert, J., et al. (2016). Молекулярная эпидемиология и эволюция вируса Коксаки человека A6. J. Gen. Virol. 97, 3225–3231. DOI: 10.1099 / jgv.0.000619

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Основная группа разработчиков

    R (2012 г.). R: язык и среда для статистических вычислений . Вена: Фонд R для статистических вычислений.

    Google Scholar

    Рамбаут, А., Лам Т. Т., Макс Карвалью Л. и Пибус О. Г. (2016). Изучение временной структуры гетерохронных последовательностей с помощью TempEst (ранее Path-O-Gen). Virus Evol. 2: vew007. DOI: 10.1093 / ve / vew007

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Рамирес К., Грегори Дж., Бути М., Табернеро Д., Камос С., Касильяс Р. и др. (2013). Сравнительное исследование сверхглубокого пиросеквенирования и клонирования для количественного анализа квазивидов вируса с использованием инфекции вируса гепатита В в качестве модели. Антивирь. Res. 98, 273–283. DOI: 10.1016 / j.antiviral.2013.03.007

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Рико-Гессен Р., Палланш М. А., Ноттай Б. К. и Кью О. М. (1987). Географическое распространение генотипов дикого полиовируса типа 1. Вирусология 160, 311–322. DOI: 10.1016 / 0042-6822 (87)

    -8

    CrossRef Полный текст | Google Scholar

    Ши, С. Р., Чанг, К., Чен, Т. К., Ву, К. Н., Сюй, Дж. Т., Ли, Дж.C., et al. (2004a). Мутации в доменах KFRDI и VGK протеазы 3C энтеровируса 71 влияют на его РНК-связывающую и протеолитическую активность. J. Biomed. Sci. 11, 239–248. DOI: 10.1159 / 000076036

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Ши, С. Р., Цай, М. К., Ценг, С. Н., Вон, К. Ф., Шиа, К. С., Ли, В. Т. и др. (2004b). Мутация в капсидном белке VP1 энтеровируса 71 придает устойчивость к ингибирующим эффектам пиридилимидазолидинона. Антимикробный.Агенты Chemother. 48, 3523–3529. DOI: 10.1128 / AAC.48.9.3523-3529.2004

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Стаматакис А., Людвиг Т. и Мейер Х. (2005). RAxML-III: быстрая программа для вывода больших филогенетических деревьев на основе максимального правдоподобия. Биоинформатика 21, 456–463. DOI: 10.1093 / биоинформатика / bti191

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Су, В., Ли, Х., Чен, М., Дай, В., Сан, С., Wang, S., et al. (2017). Анализ использования синонимичных кодонов вирусов болезней рук, ящура: сравнительное исследование вируса Коксаки A6, A10, A16 и энтеровируса 71 с 2008 по 2015 годы. Infect. Genet. Evol. 53, 212–217. DOI: 10.1016 / j.meegid.2017.06.004

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Тамура, К., Петерсон, Д., Петерсон, Н., Стечер, Г., Ней, М., и Кумар, С. (2011). MEGA5: анализ молекулярной эволюционной генетики с использованием методов максимального правдоподобия, эволюционного расстояния и максимальной экономии. Мол. Биол. Evol. 28, 2731–2739. DOI: 10.1093 / molbev / msr121

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Ти, К. К., Лам, Т. Т., Чан, Ю. Ф., Библия, Дж. М., Камарулзаман, А., Тонг, К. Ю. и др. (2010). Эволюционная генетика энтеровируса человека 71: происхождение, популяционная динамика, естественный отбор и сезонная периодичность гена VP1. J. Virol. 84, 3339–3350. DOI: 10.1128 / JVI.01019-09

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Целигка, Е.Д., Собо, К., Стоппини, Л., Каньо, В., Абдул, Ф., Пиуз, И. и др. (2018). Мутация VP1, приобретенная во время диссеминированной инфекции энтеровируса 71, придает способность связывать гепарансульфат и модулирует тропизм ex vivo. PLoS Pathog. 14: e1007190. DOI: 10.1371 / journal.ppat.1007190

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Уэда Ю., Кензака Т., Нода А., Ямамото Ю. и Мацумура М. (2015). Болезнь Кавасаки у взрослых (синдром кожно-слизистых лимфатических узлов) и сопутствующая инфекция, вызванная вирусом Коксаки A4: отчет о болезни. Внутр. Med. Case Rep. J. 8, 225–230. DOI: 10.2147 / IMCRJ.S

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Викторио, К. Б., Сюй, Ю., Нг, К., Мэн, Т., Чоу, В. Т., и Чуа, К. Б. (2016). Совместное действие аминокислот 98E, 145A и 169F VP1 в продуктивной инфекции линий мышиных клеток энтеровирусом 71 (штамм BS). Emerg. Микробы заражают. 5: e60. DOI: 10.1038 / emi.2016.56

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Ван, Д., Xu, Y., Zhang, Y., Zhu, S., Si, Y., Yan, D., et al. (2016). [Генетические характеристики вируса Коксаки группы А типа 4, выделенного от пациентов с острым вялым параличом в Шэньси, Китай]. Бинг Ду Сюэ Бао 32, 145–149.

    PubMed Аннотация | Google Scholar

    Wang, J., Hu, T., Sun, D., Ding, S., Carr, M.J., Xing, W., et al. (2017). Эпидемиологические характеристики болезней рук, ног и рта в Шаньдуне, Китай, 2009-2016 гг. Sci. Отчет 7: 8900. DOI: 10.1038 / s41598-017-y, мы выполнили байесовский sk09196-z

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Ямаёси, С., Иидзука, С., Ямасита, Т., Минагава, Х., Мизута, К., Окамото, М., и др. (2012). SCARB2-зависимая инфекция человека, вызванная вирусом Коксаки А7, А14 и А16 и энтеровирусом 71. J. Virol. 86, 5686–5696. DOI: 10.1128 / JVI.00020-12

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Зайни, З., Макминн, П. (2012).Одиночная мутация в капсидном протеине VP1 (Q145E) штамма геногруппы C4 энтеровируса человека 71 генерирует вирулентный фенотип мыши. J. Gen. Virol. 93 (Pt 9), 1935–1940. DOI: 10.1099 / vir.0.043893-0

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Zaini, Z., Phuektes, P., and McMinn, P. (2012). Мышиная адаптация штамма подгеногруппы B5 энтеровируса 71 человека связана с заменой нового лизина на глутаминовую кислоту в положении 244 в белке VP1. Virus Res. 167, 86–96. DOI: 10.1016 / j.virusres.2012.04.009

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Zhang, H., Cao, H. W., Li, F. Q., Pan, Z. Y., Wu, Z. J., Wang, Y. H., et al. (2014). Анализ использования синонимичных кодонов в энтеровирусе 71. Вирусная болезнь 25, 243–248. DOI: 10.1007 / s13337-014-0215-y

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Чжан, З., Донг, З., Ли, Дж., Карр, М. Дж., Чжуан, Д., Wang, J., et al. (2017a). Защитная эффективность инактивированной формальдегидом цельновирусной вакцины и противовирусных препаратов на мышиной модели инфекции Коксаки вируса a10. J. Virol. 91: e00333-17. DOI: 10.1128 / JVI.00333-17

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Zhang, Z., Dong, Z., Wei, Q., Carr, M.J., Li, J., Ding, S., et al. (2017b). Модель инфекции Коксаки вируса А6 на неонатальных мышах для оценки противовирусной эффективности и эффективности вакцины. Дж.Virol. 91: e02450-16. DOI: 10.1128 / JVI.02450-16

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Чжао, Г., Чжан, X., Ван, К., Ван, Г., и Ли, Ф. (2016). Характеристика последовательности VP1 изолятов вируса Коксаки А16 байесовским эволюционным методом. Virol. J. 13: 130. DOI: 10.1186 / s12985-016-0578-3

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Zhen, R., Zhang, Y., Xie, H., Chen, C., Geng, J., He, P., et al.(2014). [Анализ последовательности VP1-области вируса Коксаки A4 и вируса Коксаки A10 в городе Гуанчжоу, 2010-2012 гг.]. Чжунхуа Ю Фан И Сюэ За Чжи 48, 445–450.

    PubMed Аннотация | Google Scholar

    Турция готова сотрудничать с российскими специалистами в борьбе с вирусом Коксаки

    17 августа 2017 16:28 (UTC + 04: 00)

    5 625

    Али Мустафаев

    Турция готова сотрудничать с Федеральной службой по надзору в сфере защиты прав потребителей и благополучия (Роспотребнадзор) для оценки ситуации с распространением вируса Коксаки, сообщили «Вести».

    Ранее СМИ сообщали, что количество туристов, инфицированных вирусом Коксаки (энтеровирусная инфекция), в Турции растет, причем десятки туристов якобы были вынуждены прервать свой отпуск досрочно.

    Роспотребнадзор объявил, что работает над этим вопросом с турецкими коллегами, сообщают «Вести».

    По состоянию на 16 августа на горячую линию Роспотребнадзора поступило более 500 обращений от заболевших туристов и членов их семей, передает «Россия 24».Более 70 процентов пострадавших - дети. Большинство заболевших туристов во второй половине июля составили посетители отелей, расположенных в Аланье, Кемере и Белеке.

    Вирус Коксаки передается воздушно-капельным путем. Наиболее частыми признаками и симптомами инфекций, вызванных вирусом Коксаки, являются изначально лихорадка, плохой аппетит и респираторные заболевания, включая боль в горле, кашель и недомогание (чувство усталости).

    Инкубационный период длится от одного до двух дней. Болезненные участки во рту развиваются примерно через день или два после первоначальной лихорадки и превращаются в маленькие волдыри, которые часто изъязвляются.У многих инфицированных людей (обычно это дети в возрасте 10 лет и младше) появляется сыпь, которая чешется на ладонях рук и подошвах ног.

    На прошлой неделе Минздрав России выпустил буклет с инструкциями для туристов, планирующих отдых в Турции.

    Турция - одно из самых популярных летних направлений для российских туристов. Ранее сообщалось, что турецкие курорты Анталии в 2017 году примут более 3 миллионов российских туристов.

    Эта волна болезни может отрицательно сказаться на туристическом секторе Турции, поскольку подавляющее большинство туристов приехали из России.

    Этим летом турецкий туризм восстанавливается после тревожного периода, связанного с инцидентом со стрельбой по российскому самолету турецкими вооруженными силами в конце 2015 года. Число иностранцев, посетивших Турцию, снизилось до 25,3 миллиона в 2016 году. Это на 30 процентов меньше, чем в 2015 году.

    После разрешения конфликта между Анкарой и Москвой российские туристические компании вернули туристические путевки в Турцию.

    Число российских туристов в 2017 году достигло пика в летние месяцы. С начала года курорты Турции посетили более 2 миллионов российских туристов.

    ---

    Следуйте за нами в Twitter @AzerNewsAz

    .

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *