Гус инфекция: Гемолитико-уремический синдром — причины, симптомы, диагностика и лечение

Содержание

Гемолитико-уремический синдром/ГУС у детей и взрослых

Гемолитико-уремический синдром – клинико-гематологический симптомокомплекс, отличающийся разнообразием этиологических факторов и возникновением тяжелейших нарушений в организме человека. Эта патология характеризуется гемолизом эритроцитов, снижением количества тромбоцитов в крови, дисфункцией почек. Тромботическая микроангиопатия сопровождается множественным образованием тромбов и окклюзией мелких кровеносных сосудов. При этом развивается тромбоцитопения, появляются очаги ишемии и некроза в мозговой ткани и внутренних органах.

Гемолитико-уремический синдром имеет еще одно наименование — болезнь Гассера, полученное в честь своего первооткрывателя С. Gasser в середине прошлого столетия. У пациентов с данной патологией появляется боль в животе, понос с кровью, бледность кожи, иктеричность склер, отечность лица, петехиальная сыпь, анурия, симптомы поражения ЦНС, печени, сердца. Диагностика заболевания основывается на клинических симптомах и результатах лабораторных исследований.

Своевременная и грамотная терапия ГУС позволяет сделать прогноз патологии благоприятным.

Болезнь Гассера развивается у грудничков, детей дошкольного возраста, школьников, подростков и очень редко у взрослых людей. У женщин после родов патология протекает наиболее тяжело и часто приобретает рецидивирующий характер. Гемолитико-уремический синдром не имеет определенной сезонности. Заболеваемость достигает максимального уровня в летне-осенний период: с июня по сентябрь. Патология кишечной этиологии регистрируется обычно в летнее время, а заболевания вирусного происхождения – осенью и зимой.

Атипичный гемолитико-уремический синдром (аГУС) — редко встречающаяся патология, которая отличается тяжелым течением и имеет неблагоприятный прогноз. Поражение капилляров, артериол и венул нарушает функционирование внутренних органов, что проявляется разнообразной клинической симптоматикой.

Классификация

Гемолитико-уремический синдром по этиологии и клинике подразделяется на два вида:

  • Типичный, взаимосвязанный с диарейным синдромом — Д+,
  • Атипичный, не связанный с диареей — Д-.

Диарейные формы возникают у детей младше 5 лет, проживающих в эндемических регионах – Поволжье, Подмосковье. Атипичный ГУС развивается у детей школьного возраста и взрослых лиц.

ГУС может протекать в легкой или тяжелой форме:

  1. Легкая форма бывает двух типов. Тип А проявляется классической триадой: анемией, тромбоцитопенией и патологией почек. Тип Б проявляется той же триадой, а также судорогами и гипертонией.
  2. Тяжелая форма подразделяется на два типа. Тип А проявляется триадой симптомов и длится более суток. Тип Б имеет аналогичные симптомы, к которым присоединяются судороги, анурия и выраженная гипертензия.

Этиологическая классификация атипичного ГУС:

  • поствакцинальный,
  • постинфекционный,
  • наследственный,
  • лекарственный,
  • идиопатический.

Этиология

Типичный ГУС

патогенез бактериальной диареи

Возбудителями ГУС, связанного с диареей, являются энтерогеморрагическая кишечная палочка, шигелла, стафилококк, а более редких случаях — сальмонеллы, кампилобактерии, клостридии.

Эшерихия продуцирует шига-подобный веротоксин, который поражает клетки сосудов почек у детей младше 3 лет. Эндотелиоциты погибают, возникает воспаление, гемолиз эритроцитов, адгезия и агрегация тромбоцитов, развивается ДВС-синдром. Микроциркуляторные расстройства приводят к гипоксии внутренних органов. У больных на фоне ОКИ происходит воспаление клубочков почек, нарушение фильтрационной функции, развитие ишемии, образование очагов некроза, снижение работоспособности почек.

Острая кишечная инфекция — болезнь грязных рук. Микробы проникают в организм человека при контакте с инфицированными животными или людьми. Заражение возможно при употреблении сырого молока, плохо вымытых фруктов и овощей. Недостаточно эффективная тепловая обработка мяса также становится причиной кишечных расстройств.

Атипичный ГУС

Существует несколько теорий возникновения атипичного ГУС:

  1. Инфекционная — возбудителями патологии являются микробы: пневмококк, вирус ветряной оспы, ВИЧ, гриппа, Эпштейна-Барра, Коксаки.
  2. Лекарственная — развитие патологии после приема некоторых медикаментов: антибиотиков, гормональных контрацептивов, цитостатиков.
  3. Наследственная – выявлены семейные случаи заболевания с аутосомно-доминантным и аутосомно-рецессивным типом наследования.
  4. Поствакцинальная — развитие ГУС происходит после введения живых вакцин.

аГУС развивается у лиц:

  • перенесших обширное хирургическое вмешательство,
  • имеющих раковые заболевания,
  • страдающих системными заболеваниями – склеродермией, гломерулонефритом,
  • имеющих в анамнезе злокачественную гипертонию,
  • беременных женщин,
  • ВИЧ-инфицированных,
  • наркоманов.

Атипичный гемолитико-уремический синдром (АГУС) является осложнением основного заболевания, отличается от типичной формы этиологией, клиникой, гистологической и патоморфологической картиной, неблагоприятным прогнозом и высоким уровнем летальности. Патология развивается в 10% случаев.

Патогенез

Типичный ГУС

Патогенетические звенья типичного гемолитико-уремического синдрома:

  1. проникновение микробов в организм человека,
  2. взаимодействие бактерий со специфическими рецепторами кишечника,
  3. их активное размножение,
  4. поражение кишечноклеточных структур,
  5. продукция токсина,
  6. повреждение эндотелиального слоя сосудов внутренних органов,
  7. активация и адгезия тромбоцитов в зоне поражения,
  8. образование тромбов,
  9. истощение запасов тромбоцитов,
  10. развитие тромбоцитопении,
  11. внутрисосудистое свертывание с отложением фибрина на эндотелии капилляров,
  12. развитие тромботической микроангиопатии,
  13. ишемия органов и тканей,
  14. развитие их дисфункции.

Бактериальные токсины поражают клетки кишечника, что приводит к развитию геморрагического колита. В легких возникает дистресс-синдром. Почечная ткань очень чувствительна к действию бактериальных токсинов. Нарушение фильтрационной функции почек приводит к накоплению продуктов обмена, развитию уремии и интоксикации организма. Микроциркуляторные метаморфозы во внутренних органах обуславливают симптоматику ГУС.

Атипичный ГУС

Патогенетические звенья атипичного ГУС:

  • гиперактивность и дисфункция системы комплимента,
  • образование иммунных комплексов и их отложение на эндотелии сосудов,
  • повреждение эндотелиальных клеток и их разрушение,
  • ишемия тканей,
  • нарушение работы внутренних органов.

У здоровых людей система комплимента разрушает патогенные биологические агенты — бактерии и вирусы. При гемолитико-уремическом синдроме повышенная иммунная активность способствует образованию антител, которые «атакуют» собственные клетки организма — эндотелиоциты и уничтожают здоровые органы. Непрерывная активация тромбоцитов приводит к тромбообразованию и сбою в работе пораженных органов.

Симптоматика

Периоды гемолитико-уремического синдрома — продрома, разгар, восстановление.

Продромальный период длится 2-7 суток и начинается с появления неспецифической симптоматики — недомогания, слабости, катаральных явлений. Кишечные симптомы представлены проявлениями гастроэнтероколита: поносом с кровью, диспепсией, болью в животе. Респираторные клинические признаки — ринит, боль и першение в горле, чихание, кашель.

В разгар болезни общее состояния пациентов ухудшается, повышенная возбудимость, беспокойство и судорожная готовность сменяются вялостью, апатией. Больные дети не кричат и не плачут, они слабо реагируют на внешние раздражители. Возникают симптомы анемии, тромбоцитопении и дисфункции почек. В организме развивается обезвоживание, нарушается периферическое кровообращение. У трети пациентов развивается внепочечный тромбоз.

  • Кожа становится бледной, склеры иктеричными, веки пастозными. По мере нарастания гемолитических процессов бледность кожи сменяется желтушностью.
  • Геморрагический синдром проявляется носовыми кровотечениями, петехиями или экхимозами на коже и слизистой, кровоизлиянием в стекловидное тело или сетчатку глаза.
  • Симптомами почечного синдрома являются олигурия или анурия, гематурия, протеинурия.
  • Неврологические нарушения — угнетение сознания, прогрессирующая вялость, нервный тик, нистагм, атаксия, судорожный синдром, ступорозное состояние, кома.
  • Поражение сердца и сосудов — учащенное сердцебиение, приглушенность тонов, систолический шум, экстрасистолия, признаки кардиомиопатии, инфаркта миокарда, гипертонии, диффузной васкулопатии, сердечной недостаточности.
  • Поражение бронхо-легочной системы — одышка, жесткое дыхание, мелкопузырчатые хрипы.
  • Симптомы поражения ЖКТ — отрыжка, изжога, горечь во рту, тошнота, рвота, боль в животе, метеоризм, урчание, неустойчивый стул, патологические примеси в кале.

Если своевременно начать патогенетическую терапию, то олигоанурическая стадия сменится полиурической. Организм больного начнет катастрофически быстро терять воду и электролиты. После разгара заболевания наступает следующая стадия — восстановление. Общее состояние больных стабилизируется, нарушенные функции постепенно нормализуются. У пациентов в крови увеличивается содержание тромбоцитов, улучшается мочеотделение, нормализуется уровень гемоглобина и уменьшается интоксикация.

Среднетяжелое течение гемолитико-уремического синдрома характеризуется быстрым прогрессированием почечной дисфункции: нарастанием интоксикации, анурией, возникновением внепочечных патологий, лихорадкой. В запущенных случаях формируется декомпенсация почечной недостаточности и летальный исход.

 

Симптомы атипичного ГУС аналогичны клиническим проявлениям его типичной формы. Заболевание отличается бурным течением и развитием серьезных осложнений. Диагноз ставят, если нет ассоциации с диареей и отсутствует лабораторное подтверждение наличия шига-токсина в организме.

Диагностика

Диагностика ГУС основывается на жалобах больных, данных осмотра и результатах лабораторных испытаний.

  1. В общем анализе крови больных обнаруживают снижение уровня эритроцитов и тромбоцитов. Красные кровяные тельца фрагментируются и приобретают искаженную форму палочек или треугольников.
  2. В биохимическом исследовании крови определяют повышенное содержание мочевины, креатинина, билирубина, трансаминаз, калия, магния, остаточного азота, снижение белка, хлора и натрия. Такое соотношение микроэлементов указывает на нарушение водно-электролитного баланса и развитие дегидратации в организме.
  3. В моче определяют много белка и эритроцитов.
  4. В результате микробиологического исследования кала выявляют энтерогеморрагическую кишечную палочку в значительном количестве, в копрограмме – эритроциты.

Лечение

Лечение гемолитико-уремического синдрома у детей проводится в условиях стационара. Больным показан постельный режим и диетотерапия. Детям назначают диету, разрешающую употреблять только грудное молоко и молочнокислые смеси. Рацион расширяют постепенно. Взрослым рекомендуют соблюдать диету, ограничивающую использование соли.

  • Этиотропная терапия — противомикробная. Больным проводят антибиотикотерапию с помощью препаратов широкого спектра действия. В настоящее время широко используют стафилококковый, сальмонеллезный, клебсиеллезный и прочие бактериофаги.
  • Патогенетическая терапия заключается в устранении и предупреждении процессов тромбообразования. Больным назначают антикоагулянты и антиагреганты – «Курантил», «Гепарин», а также препараты, улучшающие микроциркуляцию крови – «Трентал», «Кавинтон», «Пирацетам», «Винпоцетин».
  • Дезинтоксикационная терапия — введение коллоидных и кристаллоидных растворов.
  • Антиоксидантная терапия витамином Е.
  • Заместительная терапия – переливание свежезамороженной плазмы, эритроцитарной массы.
  • Во время олигоурического периода назначают мочегонные средства – «Фуросемид», «Лазикс»; проводят плазмаферез, перитонеальный диализ или гемодиализ.
  • При тахикардии и гипертензии – адреноблокаторы: «Атенолол», «Бетапролол» и ингибиторы АПФ: «Капотен», «Анаприл».
  • При отеке легких – «Эуфиллин», искусственная вентиляция легких.

Гемолитико-уремический синдром — тяжелая патология, имеющая серьезный прогноз. У маленьких детей часто наступает смертельный исход, у подростков и взрослых лиц развивается почечная недостаточность и снижается клубочковая фильтрация. Типичный ГУС протекает намного легче недиарейного синдрома, который отличается частым рецидивированием и высоким уровнем смертности.

Профилактика типичной формы ГУС заключается в выполнении некоторых правил. Специалисты рекомендуют:

  1. соблюдать правила личной гигиены,
  2. не купаться в сомнительных водоемах,
  3. пить только кипяченую воду,
  4. придерживаться технологии обработки и приготовления мясных блюд,
  5. не употреблять сырое молоко,
  6. хорошо мыть овощи и фрукты,
  7. избегать контакта с людьми, страдающими острой кишечной инфекцией.

Видео: презентация по гемолитико-уремическому синдрому

Гемолитико-уремический синдром: клинические рекомендации

Содержание страницы

Гемолитический уремический синдром (ГУС)

Характеризуется микроангиопатической гемолитической анемией, тромбоцитопенией и нефропатией. Девяносто процентов случаев приходится на детское население, связанное с вспышками гастроэнтерита, вызванными продуцирующей веротоксин Escherichia coli. У взрослых встречается спорадическая форма, которую трудно отличить от тромботической тромбоцитопенической пурпуры. Это результат повреждения эндотелиальных клеток, вызывающего микрососудистый тромбоз.

Этиология

Хотя ГУС можно увидеть в самых разных клинических сценариях, общим знаменателем в ситуациях, когда этиологический агент может быть идентифицирован, является повреждение эндотелия клубочкового капиллярного слоя. В эпидемической форме это вызвано заражением продуцирующими веротоксин штаммами Escherichia coli. Инфекционный ГУС (связанный с не веротоксинами) вызван не-E-coli-организмами, включая стрептококковые.

В приблизительно 50% семейного ГУС обнаружен дефект в одном из белков, участвующих в регуляции системы комплемента. Причина спорадического, не веротоксин-ассоциированного ГУС неизвестна, хотя в некоторых случаях были обнаружены те же дефекты, что и в семейных синдромах. Причины вторичного ГУС включают в себя воздействие лекарств (например, циклоспорин, некоторые химиотерапевтические агенты, целевые раковые агенты), трансплантацию костного мозга и беременность.

Патофизиология

Эпидемический: веротоксины (токсины Шига), продуцируемые E coli O157: H7, связываются с почечными гломерулярными эндотелиальными клетками, вызывая повреждение и отслоение клеток, повреждая мембрану основания с результирующим микрососудистым тромбозом, фрагментацию эритроцитов и разрушение тромбоцитов и, в конечном счете, вызывая почечную недостаточность.

Инфекционные: нейраминидаза, продуцируемая стрептококковыми видами, а также другие организмы, изменяет поверхность клубочковых клеток, чтобы выявить антигены, которые распознаются естественными антителами, вызывая иммунную реакцию и повреждение эндотелия. Другие механизмы, с помощью которых возбуждающие агенты запускают ГУС, неизвестны.

Семейный: в некоторых семейных случаях были обнаружены дефекты в производстве или функции одного из белков в альтернативном пути комплемента. Считается, что эти дефекты приводят к чрезмерной активации комплемента и приводят к повреждению эндотелия, что приводит к почечной дисфункции, а иногда и к вовлечению нескольких органов.

Вторичный: также считается, что он вызван повреждением эндотелиальных клеток, хотя точный механизм неизвестен. Совсем недавно появились сообщения о тромботической микроангиопатии, связанной с использованием целевых раковых агентов (например, иммунотоксинов, моноклональных антител и ингибиторов тирозинкиназы).

Спорадический: патофизиология неизвестна, но считается, что она связана с повреждением эндотелиальных клеток. Обнаружено, что у некоторых пациентов без известного семейного заболевания имеются дефекты в регуляции комплемента, подобные тем, которые встречаются в семейных случаях (т. е. влияют на структуру и / или функцию фактора H).

Диагностика

Анамнестические и факторы обследования при ГУС различаются в зависимости от типа. У всех пациентов с подозрением на ГУС исследования, которые помогают установить диагноз, включают следующее: ОАК, периферический мазок, креатинин, ПВ и ЧПВ. Это должно быть сделано в рамках первоначальной оценки. Наличие значительного количества фрагментов эритроцитов в периферическом мазке подтверждает диагноз тромботической микроангиопатии.

ЛДГ и гаптоглобин также определяют для дальнейшей оценки гемолиза. Если есть диарея, посев стула следует делать в начале диареи, так как отсроченный анализ может показать отрицательный результат культуры.

Диагностика и дифференциальная диагностика причин тромботической микроангиопатии и последующая терапия — сложная задача. Гематологическая консультация рекомендуется при планировании и лечении ГУС. Альтернативными диагнозами, которые необходимо исключить, являются тромботическая тромбоцитопеническая пурпура (ТТП), злокачественная гипертензия, системный васкулит и у беременных пациентов, преэклампсия и HELLP (уровень гемолиза, повышенный уровень ферментов печени и низкий уровень тромбоцитов). Уровень ADAMTS 13 (также известный как von Willebrand factor-cleaving protease [VWFCP]) полезен для различения TTП (более стабильно низкий уровень при TTП) от ГУС.

Дальнейшие факторы диагностики зависят от типа ГУС.

Оценка эпидемического ГУС

Инфекцию Escherichia coli O157: H7 следует подозревать у пациентов с абдоминальной болью и кровавой диареей, особенно при отсутствии лихорадки. Болезнь чаще встречается у детей в возрасте <5 лет, но можно наблюдать в любом возрасте. Могут присутствовать тошнота и рвота. На момент постановки диагноза может наблюдаться известная вспышка токсической E coli. Иногда обнаруживается анамнез употребления недоваренного мяса, сыра, птицы, овощей или воды, которые были заражены E coli O157: H7.

ОАК, периферический мазок, креатинин, ПВ и ЧТВ должны быть сделаны в рамках первоначальной оценки. Посев стула на агар сорбита-MacConkey для обнаружения E coli O157: H7 следует проводить на ранней стадии диарейной болезни.

Оценка вторичного и спорадического ГУС

Оценка пациентов, которые поступают без диареи, но с анемией, тромбоцитопенией и повышенным креатинином, должна включать ранний анализ мазков периферической крови. Анамнестические факторы, которые могут быть вызваны вторичным HUS, включают лечение циклоспорином, химиотерапией, хинином и трансплантацией костного мозга; текущая беременность или послеродовой статус; и семейная анамнез синдрома, подобного ГУС. При спорадическом ГУС, возбуждающий фактор неизвестен.

ПВ и ЧТВ полезны для исключения других причин тромбоцитопении, таких как диссеминированное внутрисосудистое свертывание.

Оценка семейного ГУС

Для пациентов, у которых есть анамнез, напоминающий семейный синдром, следует подозревать аномалии регулятивного пути комплемента. Оценка должна проводиться, как описано при спорадическом ГУС, но, кроме того, необходимо провести оценку белков, участвующих в регуляции комплемента. Для оценки часто требуются услуги лаборатории, специализирующейся на анализе системы комплемента. Некоторые эксперты предположили, что взрослые пациенты, у которых есть тромботическая микроангиопатия, но нет известной вторичной причины и есть нормальные уровни ADAMTS13, должны считаться пациентами с атипичным ГУС.

Факторы риска

  • Проглатывание загрязненной пищи или воды
    • Несмотря на то, что употребление недоваренного мяса получило наиболее широкое распространение, вспышки Escherichia coli-ассоциированных HUS были связаны с поеданием многих других веществ, таких как сыр, птица, овощи или вода, которые были заражены E coli O157 : H7.
  • Известная вспышка токсикогенных E coli
    • Также сообщалось о больших эпидемиях E coli O157: H7, большинство случаев являются спорадическими или встречаются в небольших кластерах.
  • Воздействие инфицированных лиц в учреждениях
    • Передача токсикогенной E coli от человека к человеку была описана в детских садах, домах престарелых и других учреждениях.
  • Генетическая предрасположенность
    • В семейных синдромах и некоторых спорадических случаях может быть аутосомно доминантным или рецессивным. Обнаружены аномалии в количестве и функции фактора Н, фактора I и мембранного кофактора, все из которых участвуют в регуляции комплемента.

Дифференциальная диагностика

ЗаболеваниеДифференциальные признаки/симптомыДифференциальные обследования
  • Тромботическая тромбоцитопеническая пурпура (ТТП)
  • Хотя анамнестически описываться как болезнь, которая имеет более высокий уровень неврологических симптомов и меньшую степень почечной недостаточности, чем ГУС, существует так много совпадений между ними, что некоторые эксперты рекомендуют рассматривать их как единое целое.
  • Первоначальное определение низких уровней фермента отщепления фон Виллебранда ADAMTS13 у многих пациентов с типичными для ТТП признаками, но не с типичными для ГУС, свидетельствует о наличии различных патофизиологических механизмов.
  • Уровни отщепляющего фермента фон Виллебранда ADAMTS13, дефицит которого связан с патогенезом ТТП, более стабильны при TTП, чем при ГУС
  • Злокачественная гипертензия
  • Может иметь патологические особенности тромботической микроангиопатии с аналогичными характеристиками, характерными для ГУС; поэтому требуется рассмотрение злокачественной гипертензии как дифференциального диагноза. Отличительной особенностью является значительно повышенное кровяное давление.
  • Количество тромбоцитов обычно является нормальным при злокачественной гипертензии.
  • Ранее существовавший диагноз или анамнез симптомов, указывающих на ревматологическое состояние, требуют рассмотрения васкулита в диагнозе.
  • Серологические тесты основного состояния могут быть положительными, но нет никаких тестов для дифференциации причины ГУС.
  • Определение различных причин тромбоцитопении, которые присутствуют в пери- и послеродовом периоде, может быть затруднительным. ГУС имеет тенденцию проявляться в послеродовом периоде, что отличает его от преэклампсии.
  • В периферическом мазке у пациентов с TTП / ГУС обычно больше шистоцитов, чем при преэклампсии.
  • ГУС имеет тенденцию проявляться в послеродовом периоде, что отличает его от HELLP (гемолиз, повышенный уровень ферментов печени и низкий уровень тромбоцитов).
  • В периферическом мазке у пациентов с TTП / ГУС обычно больше шистоцитов, чем при синдроме HELLP.

Лечение

Пошаговый подход к лечению Рекомендуется консультация со специалистами по нефрологии и гематологии по лечению ГУС, которая может стать сложной.

Лечение эпидемического ГУС

Подавляющее большинство пациентов с ГУС, около 90%, являются детьми с энтерогеморрагической инфекцией Escherichia coli. Дети с типичным представлением кровавой диареи, боли в животе, тошноты и рвоты должны быть госпитализированы. Это может ускорить оценку и поддержание внутрисосудистого объема и, таким образом, снизить риск осложнений и риск передачи.

Цели лечения поддерживающие: Поддерживайте объем внутрисосудистой жидкости: у детей, которые присутствуют с тромбоцитопенией и фрагментированными эритроцитами, с повышенным креатинином или без него, следует подозревать наличие E coli O157: H7 и предположительно лечить как таковое во время оценки. Тщательное внимание следует уделять балансу жидкости и мониторингу выхода мочи. Надлежащая гидратация важна для того, чтобы свести к минимуму вероятность поражения почек. Тщательное внимание необходимо уделять предотвращению сердечно-легочной перегрузки, особенно потому, что у этих пациентов существует риск развития олигурии.

Кровяное давление следует контролировать и лечить, если оно повышено. Гипертензия может быть вторичной по отношению к увеличению внутрисосудистого объема у пациентов, у которых развилась олигурия или анурия, или вторичная по отношению к активации ренинангиотензиновой системы, и ее следует контролировать, чтобы избежать обострения повреждения почек. Блокаторы кальциевых каналов являются предпочтительными агентами для лечения гипертонии в острой фазе. Ингибиторы ангиотензинпревращающего фермента обычно не рекомендуются в остром состоянии из-за проблем с уменьшенной почечной перфузией, но рекомендуются для пациентов с терминальной стадией почечной недостаточности после ГУС.

Избежание вмешательств, которые могут увеличить риск необратимого повреждения почек: Рекомендуется избегать использования антибиотиков, противодиарейных средств (антидиарейных), опиоидов или нестероидных противовоспалительных препаратов. Применение антибиотиков для энтерогеморрагических инфекций Escherichia coli не рекомендуется из-за возможного повышенного риска для ГУС. Было определено, что антиперистальтические средства увеличивают риск развития ГУС и осложнений со стороны ЦНС.

Переливания тромбоцитов были связаны с клиническим ухудшением и их следует избегать, если это возможно. Анемия распространена и может быстро развиваться, требуя переливания эритроцитов. Примерно 50% пациентов нуждаются в диализе в острой фазе. Пациенты, в которых развивается необратимая почечная недостаточность, рассматриваются для трансплантации почек. Было рекомендовано использование плазменного обмена для токсогенной E coli- ассоциированой диареи, связанной с кишечной палочкой у взрослых, на основе ее успешного использования во время вспышки.

Лечение спорадического и вторичного ГУС

Около 10% пациентов с клиническим ГУС не имеют диарейного продрома, и эта популяция состоит в основном из взрослых. В то время как у них больше вероятность наличия нормальных уровней ADAMTS13 и, следовательно, может быть группой, которая имеет иную патофизиологию чем у пациентов, у которых есть клиническая картина, более напоминающая тромботическую тромбоцитопеническую пурпуру (ТТП) (менее тяжелая почечная дисфункция), существует такая существенное совпадение между TTП и ГУС, которое многие эксперты рекомендуют рассматривать как один объект.

Плазменный обмен является центральной частью терапии. Нет убедительных доказательств того, что адъективная терапия кортикостероидами или гепарином эффективна. ГУС, связанный с химиотерапией или трансплантацией костного мозга, как правило, имеет плохой прогноз, и ответ на плазменный обмен не установлен. Диализ проводится у пациентов с почечной недостаточностью. Трансплантация почки может быть выполнена у пациентов с необратимой почечной недостаточностью, хотя частота рецидивов является высокой для пациентов с мутациями фактора комплемента H или I.

Пациенты с аномалиями мембранного кофактора белка имеют более низкий уровень рецидива заболевания.

Лечение пациентов со Streptococcus pneumoniae ассоциированным ГУС

Плазменный обмен противопоказан пациентам с Streptococcus pneumoniae-ассоциированным ГУС, потому что инфузия плазмы, содержащей природные антитела против антигена Thomsen-Friedenreich, может ухудшить агглютинацию. Пациентов со стрептококковой инфекцией следует лечить соответствующими антибиотиками в соответствии с местными протоколами и чувствительностью к антибиотикам.

Список источников

  • Loirat C, Fakhouri F, Ariceta G, et al. An international consensus approach to the management of atypical hemolytic uremic syndrome in children. Pediatr Nephrol. 2016;31:15-39.
  • Rathbone J, Kaltenthaler E, Richards A, et al. A systematic review of eculizumab for atypical haemolytic uraemic syndrome (aHUS). BMJ Open. 2013;3:e003573.
  • Cataland SR, Wu HM. How I treat: the clinical differentiation and initial treatment of adult patients with atypical hemolytic uremic syndrome. Blood. 2014;123:2478-2484
  • Kavanagh D, Richards A, Fremeaux-Bacchi V, et al. Screening for complement system abnormalities in patients with atypical hemolytic uremic syndrome. Clin J Am Soc Nephrol. 2007;2:591-596.
  • Michael M, Elliott EJ, Ridley GF, et al. Interventions for haemolytic uraemic syndrome and thrombotic thrombocytopenic purpura. Cochrane Database Syst Rev. 2009;(1):CD003595.
  • Banerjee S. Hemolytic uremic syndrome. Indian Pediatr. 2009;46:1075-1084
  • Loirat C, Fakhouri F, Ariceta G, et al. An international consensus approach to the management of atypical hemolytic uremic syndrome in children. Pediatr Nephrol. 2016;31:15-39
  • Legendre CM, Licht C, Muus P, et al. Terminal complement inhibitor eculizumab in atypical hemolyticuremic syndrome. N Engl J Med. 2013;368:2169-2181.
  • Rathbone J, Kaltenthaler E, Richards A, et al. A systematic review of eculizumab for atypical haemolytic uraemic syndrome (aHUS). BMJ Open. 2013;3:e003573.
  • BMJ

0 0 голос

Рейтинг статьи

Атипичный гус. Атипичный гемолитико-уремический синдром (аГУС). Клинические рекомендации. Причины и классификация

ГЕМОЛИТИКО-УРЕМИЧЕСКИЙ СИНДРОМ (ГУС) является одной из частых причин острой почечной недостаточности (ОПН) у детей.

ТРИАДА СИМПТОМОВ:

  • Гемолитическая анемия (снижение уровня гемоглобина и эритроцитов в крови, с наличием фрагментированных эритроцитов – шизоцитов)
  • Тромбоцитопения – снижение уровня тромбоцитов в крови
  • Острая почечная недостаточность

У большинства (90-95%) детей отмечается так называемый типичный или постдиарейный ГУС (Д+ГУС).

Другая форма ГУС, называемая атипичный (аГУС), встречается гораздо реже (5-10 % всех случаев) и является результатом аномалии (чаще генетической) белков, регулирующих процесс активации комплементов.

Д+ГУС ИЛИ ПОСТДИАРЕЙНЫЙ ГУС

Д+ГУС развивается вследствие кишечной инфекции вызванная Е coli (кишечная палочка) которая продуцируют токсин – шигатоксин (STEC).

тмечается в основном в возрасте до 3 лет и редко до 6 месяцев.

Симптомы

  • диарея (разжиженный стул, понос) в течение нескольких дней (у 90-95%). Иногда бывает кровь в стуле. ЕСЛИ ВЫ ЗАМЕТИЛИ КРОВЬ В СТУЛЕ, НЕЗАМЕДЛИТЕЛЬНО ОБРАТИТЕСЬ К ВРАЧУ.
  • рвота (у 30-60%) и боли в животе

Манифестация ГУС начинается в среднем через 6 (в среднем 2-14) дней. Бледность, общее недомогание, слабость, изменение поведения, небольшая желтушность, уменьшение количества мочи после (кровавой) диареи должны насторожить врача в отношении ГУС.

ЕСЛИ У ВАШЕГО РЕБЕНКА КИШЕЧНАЯ ИНФЕКЦИЯ И ЧЕРЕЗ НЕСКОЛЬКО ДНЕЙ ВЫ ЗАМЕТИЛИ ТЕМНУЮ МОЧУ (КРАСНУЮ) С УМЕНЬШЕНИЕМ ЕЕ КОЛИЧЕСТВА, ИЛИ ЗАМЕТИЛИ ПАСТОЗНЫЕ ВЕКИ ИЛИ ОТЕК ЛИЦА, БЛЕДНОСТЬ С ЖЕЛТУШНОСТЬЮ НЕ ЗАМЕДЛЕТЕЛЬНО ОБРАТИТЕСЬ К ВРАЧУ!

РАЗВЕРНУТАЯ КАРТИНА ГУС

  • гемолитическая анемия (снижение гемоглобина, шизоциты)
  • тромбоцитопения
  • лейкоцитоз

ОПН с повышением уровня сывороточного креатинина и азота мочевины. Приблизительно половина пациентов имеют тяжелую олигурию (снижение количества мочи) или анурию (полное отсутствие мочи), 50-60% нуждаются в остром диализе. При наличии хоть какого-нибудь количества мочи постоянно определяются микро- или макрогематурия (кровь в моче) и протеинурия (белок в моче).

ВНЕПОЧЕЧНЫЕ ОСЛОЖНЕНИЯ

  • поражение центральной нервной системы
  • поражение желудочно-кишечного тракта (воспаление толстого кишечника – колит и др.)
  • отек поджелудочной железы
  • поражение печени
  • сердечные осложнения

Для уточнения диагноза срочно должны быть проведены соответствующие лабораторные исследования и незамедлительно начать лечение.

ПРОГНОЗ

В большинстве случаев в течение менее чем 1-2х недель исчезают гемолитическая анемия и тромбоцитопения, нормализуется диурез. 10% детей в среднем в течение 4-х месяцев достигают терминальной ХПН. Смертность в основном в результате поражения ЦНС (центральной нервной системы).

СОВЕТЫ РОДИТЕЛЯМ

ПРЕДОТВРАЩЕНИЯ ИНФИЦИРОВАНИЯ STEC (кишечная палочка содержащий шигатоксин) и развития ГУС

  • рубленая говядина должна быть хорошо прожарена до приобретения на разрезе серого цвета
  • дети до 3 лет не должны употреблять непастеризованные продукты (молоко, сыр, фруктовые соки)
  • до приготовления пищи, особенно после манипуляций с рубленой говядиной, необходимо мыть руки
  • дети, которые прикасались к крупному рогатому скоту и другим животным, должны после этого умыться, а также перед едой.
  • для предотвращения контаминации мяса кишечным содержимым необходим контроль убоя скота. Важен надлежащий надзор и уход за водоснабжения
  • антибиотики? Многочисленные исследования показали, что антибиотикотерапия в период диареи увеличивает риск развит

- ГБУ "КОКБ" Курганская областная клиническая больница — Официальный сайт

20 тысяч пациентов

ежегодно доверяют нам заботу о своем здоровье и проходят лечение в стационаре

10 тысяч операций

ежегодно выполняется в КОКБ, многие из которых уникальны

600 пациентов в день

обращаются в областную консультативную поликлинику, прием
проводится по 25 специальностям

1251 сотрудников

сегодня работает в КОКБ, в том числе 188 врачей и 534 средних медицинских работников

6 докторов
медицинских наук

18 кандидатов медицинских наук, 8 заслуженных врачей РФ трудятся сегодня к КОКБ

72,9% врачей

имеют высшую и первую категорию

6 корпусов

больничный городок состоит из 6 корпусов, хозяйственных служб

19 специализированных
отделений

в состав больницы входят 19 отделений на 516 коек

4 сертифицированные
лаборатории

Все виды анализов с использованием современного оборудования

1865 электронных
листков нетрудоспособности

выдано за 2019 год

3 врача

ГБУ «КОКБ» в 2019 году удостоились награды «Лучший врач года»

24 врача

ГБУ «КОКБ» являются главными внештатными специалистами Департамента здравоохранения Курганской области

Тромботическая тромбоцитопеническая пурпура и гемолитико-уремический синдром — этиология, патогенез, лечение

Тромботическая тромбоцитопеническая пурпура (ТТП) — тяжелое, редко встречающееся заболевание, характеризующееся следующими основными синдромами: микроангиопатической гемолитической анемией, тромбоцитопенией, неврологическими нарушениями и лихорадкой [G.Neid, 1994]. При нем также наблюдается поражение почек и развитие легочной недостаточности.

Первое описание в литературе ТТП представлено в 1924 году E.Moschcowitz. В течение нескольких десятилетий обсуждался вопрос о включении ТТП в группу системных васкулитов, но изменения, выявляемые при гистологическом исследовании пораженных сегментов сосудов, не укладываются в общепринятые представления о васкулитах. В настоящее время это заболевание относят к группе васкулопатий, а некоторые авторы рассматривают его среди болезней крови.

Гемолитико-уремический синдром (ГУС) впервые был описан в 1955 году C.Gasser и соавторами. Его основными клиническими проявлениями являются гематологические нарушения, характерные для тромботической тромбоцитопенической пурпуры, в сочетании с поражением почек [G.Neid, 1994].

По своей сущности ТТП очень близка к гемолитико-уремическому синдрому, и для обозначение этой патологии часто используют термин ТТП/ГУС.

Клинические формы тромботической тромбоцитопенической пурпуры и гемолитико-уремического синдрома

Выделяют первичную (идиопатическую) и вторичную формы ТТП. Последняя осложняет течение вирусных и бактериальных инфекций, ревматических и опухолевых заболеваний, а также отмечается на фоне приема некоторых лекарственных веществ. Заболевание может начинаться в любом возрасте, но наиболее часто — в сорок—шестьдесят лет. Отмечается преобладание заболевших женщин над мужчинами (соотношение 2:1). Ежегодно регистрируется 0,1 нового случая ТТП на 100 тыс. населения.

В настоящее время принято выделять и две формы ГУС: с нарушением функции кишечника (диарея) и без таковой. При первой (эпидемической) форме, встречающейся в основном у детей в возрасте до 5 лет, началу заболевания предшествует кровавая диарея. Второй вариант наиболее часто развивается у взрослых (средний возраст 40 лет), преимущественно у женщин (соотношение с мужчинами 3:1).

Этиология

В качестве возможных этиологических факторов формы ГУС, ассоциированного с диареей, наибольшее значение придается 1-му серотипу Shigellia dysenteria и серотипу 0157:Н7 E.coli, которые продуцируют шигеллоподобные экзотоксины 1 и 2 [S.Ashkenazi,1993].

В норме в организме человека синтезируется достаточное количество антител, нейтрализующих эти токсины. Структурные единицы (В-части) токсина шигелл способны высокоаффинно связываться с мембранами эндотелиальных клетое (ЭК) почек и других сосудистых бассейнов. Этот процесс опосредован через дисахаридный компонент (глоботриозилцерамид — Gb3).

При поступлении токсинов в кровоток происходит их взаимодействие через Gb3 или другие рецепторы с эндотелиальными клетками капилляров клубочков почек. Отмечается набухание последних, активация и продукция ими фактора фон Виллебранда (ФВ) и других субстанций. Кроме того, наблюдается связывание В-единицы токсинов с рецепторами эритроцитов (Р1 антиген), имеющих гомологию с ними в конечной части молекулы.

В опытах in vitro показано, что токсин шигелл обладает прямым цитотоксическим действием на пролиферирующие ЭК. При этом липополисахариды (ЛПС), интерлейкины (ИЛ)-1 и факторы некроза опухоли (ФНО)-а увеличивают экспрессию на поверхности эндотелия Gb3 и тем самым потенцируют эффект экзотоксинов [N. Van de Kar et al.,1990]. Кроме того, вырабатываются антитела, направленные на поврежденные структуры эндотелия, а также имеет место активация нейтрофилов с высвобождением ими кислородных радикалов и протеолитических ферментов.

Причины другой формы ГУС до конца неясны. Описаны случаи его развития на фоне лечения митомицином, циклоспорин А (ЦсА), хинидином, при приеме гормональных контрацептивов, во время беременности или вирусных инфекций. В последнее время появились сообщения о начале гемолитико-уремического синдрома после инфекций желудочно-кишечного тракта [G.Neild,1994].

Как у детей, так и взрослых обнаружены семейные случаи заболевания. При этом у различных представителей одной семьи клинические проявления трактовались или как ГУС, или как ТТП. Полагают, что в патогенезе этих заболеваний важное значение имеют генетические дефекты, возможно связанные с дефицитом плазменного фактора, стимулирующего выработку простациклина ЭК, либо с их гиперреактивностью.

Наличие сходных клинических и гистологических проявлений при ГУС и тромботической тромбоцитопенической пурпуре часто делает затруднительным дифференциальную диагностику между этими двумя заболеваниями. Как ТТП, так и ГУС часто развиваются после приема лекарственных препаратов, во время беременности и при инфекции ВИЧ. Оба заболевания могут начинаться с внутрисосудистой агрегации тромбоцитов.

Полагают, что если имеет место генерализованная агрегация тромбоцитов и преимущественное поражение ЦНС, то заболевание расценивается как ТТП; если же агрегация тромбоцитов менее выражена и патологические изменения затрагивают только почки — то его относят к гемолитико-уремическому синдрому [J.Moake, 1994]. По мнению G.H.Neild (1994), термином ТТП следует именовать патологический процесс, имеющий черты ГУС, но в сочетании с лихорадкой, поражением кожи и ЦНС, развивающийся только у взрослых, особенно у женщин.

Морфологическая характеристика

Основным типом патологии при тромботической тромбоцитопенической пурпуре и ГУС является тромботическая микроангиопатия [P.Ruggenentti & G.Rernuzzi, 1996].

При ТТП практически во всех органах и системах наблюдаются сегментарные окклюзии артериол, капилляров и венул гиалиновыми тромбами. Депозиты гиалина выявляются и в субэндотелии. Они соединены с тромбом, расположенным в просвете сосуда. Не наблюдается воспалительно-клеточной инфильтрации стенок сосуда и периваскулярного пространства.

Тромботические массы содержат осколки тромбоцитов, PAS-положительные эндотелиальные фибриллы, IgG [R. Bukowski, 1982]. Кроме того, в их составе обнаруживается избыточное количество ФВ и незначительное фибриногена или фибрина [Y.Asada et а1.,1985]. Наибольшие изменения встречаются в головном мозге, сердце, селезенке. Окклюзии сосудов приводят к развитию преходящей ишемии органов, а временами и инфарктов.

Поражение сосудов при ГУС неоднородно и зависит от формы заболевания. При гемолитико-уремическом синдроме у детей, ассоциированном с диареей, не отмечается признаков активации, пролиферации или отслойки эндотелия, что, напротив, характерно Для этого заболевания у взрослых или для ТТП [Х.Моаке, 1994].

При ГУС, развившемся после поражения желудочно-кишечного тракта, наблюдаются внутрисосудистые тромбоцитарные тромбы с небольшим количеством фибрина, окклюзирующие капилляры и приносящие артериолы клубочков. При другой его форме тромбы выявляются только в артериолах и мелких артериях почек.

Гистологические данные, отсутствие нарушений свертывания крови, тромбоцитопения свидетельствуют о том, что патология эндотелия и агрегация тромбоцитов в микрососудах почек лежат в основе патогенеза ГУС. Полагают, что при этом заболевании активация свертывания крови и образование фибрина являются вторичными. Полная закупорка сосудов может приводить к некрозу клубочков и канальцев с развитием артериальной гипертензии и хронической почечной недостаточности.

Патогенез

Еще в конце 40-х годов существовала гипотеза о том, что при ТТП патологические изменения в основном затрагивают эндотелий и субэндотелиальное пространство [I.Gore & N. Friedrnan,1948; I.Feldman et al.,1966]. По мнению J.Moake (1994), развитие клинических проявлений тромботической тромбоцитопенической пурпуры — результат диссеминированной агрегации тромбоцитов в микрососудах ЦНС и других органов.

Установлено, что в плазме больных присутствует вещество, вызывающее спонтанную агрегацию тромбоцитов. Это белок — с молекулярной массой около 37—59 кд. Он оказался Сазависимой протеазой, имеющей в составе своего активного центра цистеин и расщепляющей мультимеры ФВ на фрагменты, обладающие высокой способностью связываться с тромбоцитами.

Кроме того, под воздействием этого белка из ФВ образуются необычно большие его формы [J.Moake, P.McPherson,1989]. Известно, что мономеры фактора фон Виллебранда связаны между собой дисульфидными мостиками в мультимеры, имеющие различную молекулярную массу (от нескольких сотен тысяч до миллиона kd).

Мультимеры ФВ синтезируются мегакариоцитами, эндотелием, сохраняются в а-гранулах тромбоцитов и тельцах Wiebel—Palade ЭК. Плазменный пул ФВ в основном вырабатывается эндотелиальные клетки. В норме наибольшее количество ФВ циркулирует в виде мультимеров, однако присутствуют и необычно большие его формы.

Последние более эффективно связываются с мембранными рецепторами тромбоцитов (GPIb-IX, GPIIb-IIIа). В плазме содержатся и вещества, которые расщепляют эти гигантские формы, однако они не действуют на фактор фон Виллебранда, секретируемый ЭК в субэндотелиальное пространство [J.Frangos et al.,1989].

Bo время обострения ТТП происходит интенсивная стимуляция ЭК, сопровождающаяся увеличением выработки ими в плазму крови избыточного количества больших форм ФВ. Последние, не подвергаясь расщеплению, взаимодействуют с рецепторами тромбоцитов, вызывая как их агрегацию, так и их прикрепление к субэндотелию.

Установлено, что мультимеры ФВ исчезают из кровотока при прогрессировании заболевания или при развитии тромбоцитопении. Они также не обнаруживаются и в ремиссию болезни. В межприступный период их наличие в кровотоке, как правило, свидетельствует о продолжающейся стимуляции ЭК, что является неблагоприятным фактором последующих обострений заболевания.

Возможно, что в основе рецидивирующей формы ТТП лежит наследственный дефект выработки мультиформ ФВ. Полагают, что вначале они связываются с GPIbTX-рецепторами неактивированных тромбоцитов и обеспечивают их адгезию к субэндотелию.

Затем в процессе активации этих клеток мультимеры фактора фон Виллебранда взаимодействуют и с другими рецепторами тромбоцитов, ответственными за их агрегацию (GPIIb-IIIa). Установлено, что экзотоксины шигелл способны стимулировать эндотелиальные клетки без их повреждения, вызывая увеличение продукции ими мультиформ ФВ.

При этом в микрососудах почек создаются условия, благоприятные для взаимодействия последних с тромбоцитами (сужение просвета сосудов набухшими ЭК, контакт с субэндотелием и мезангиальными клетками). Все это способствует агрегации тромбоцитов, их адгезии к субэндотелию и образованию тромбов в микрососудах [J.Moake, 1994]. Подобные механизмы могут лежать и в основе ГУС.

Среди других возможных механизмов патогенеза тромботической тромбоцитопенической пурпуры и гемолитико-уремического синдрома обсуждается также уменьшение синтеза ЭК как простациклина, так и вещества, стимулирующего его выработку. Кроме того, при этих заболеваниях обнаружено уменьшение концентрации свободного белка S, увеличение выработки ингибитора тканевого активатора плазминогена и локальные нарушения фибринолиза.

Полагают, что в основе развития микроангиопатической гемолитической анемии при ТТП и ГУС лежит несколько взаимосвязанных механизмов. Так, повреждение эритроцитов может иметь место при их прохождении через окклюзированные сосуды. С другой стороны, в этом процессе принимают участие ФВ и эндотелиальные клетки.

Установлено, что на мембранах молодых эритроцитов находятся рецепторы, подобные тромбоцитарным, с которыми также взаимодействуют мультиформы ФВ. Кроме того, на их мембранах располагаются рецепторы, связывающие тромбоспондин, секретирующийся а-гранулами тромбоцитов.

При этом на мембранах ЭК находятся подобные рецепторы (GPIb,GPIIb-IIa) для фактора фон Виллебранда, способные также контактировать с тромбоспондином [К. Sugihara et al.,1992; T.Wick et al.,1993]. Таким образом, ретрикулоциты и другие юные формы эритроцитов, прикрепляясь к ЭК через мультимеры ФВ или тромбоспондин, могут быстрее подвергаться разрушению, а также участвовать в тромбообразовании [J.Moake, 1994].

В недавних исследованиях было показано, что плазма больных ТТП и спорадической формой ГУС способна индуцировать апоптоз микрососудистого эндотелия, полученного из кожи, почек и мозга, а также экспрессию на их мембране Fas (С095)-молекулы, связанной с апоптозом [D.Mitra et al., 1997].

Сходные данные получены при изучении больных с идиопатической и ВИЧ-ассоциированной формами тромботической тромбоцитопенической пурпуры [J.Laurence et al., 1996]. Примечательно, что эндотелиальные клетки легочных и печеночных микрососудов устойчивы к данным изменениям. Эти результаты позволяют объяснить причины редкого поражения сосудов легких и печени при ТТП/ГУС. Имеются сведения о том, что токсины (вероцитотоксин-1), принимающие участие в патогенезе гемолитико-уремического синдрома, ассоциированного с диареей, также вызывают апоптоз микрососудистого эндотелия in vitro [J.Mahan et al.,1996].

Клинические проявления

Течение заболевания у большинства больных ТТП острое, но в 10% случаев оно может носить хронический характер. В дебюте болезни отмечаются лихорадка (98%), геморрагии (96%), резкая бледность кожных покровов (96%), желтуха (42%) и слабость (34%). Изменения со стороны опорно-двигательного аппарата встречаются редко (7%) и в большинстве случаев носят характер артралгии.

Ведущим синдромом в клинической картине заболевания является поражение головного мозга, которое встречается практически у всех больных (92%). Характерны головные боли, судороги, парестезии, нарушение речи и зрения, психозы и более тяжелые нарушения сознания, вплоть до комы.

Обычно их длительность не превышает двух-трех суток, но почти в половине случаев отмечаются их повторные эпизоды. Полагают, что в основе этих клинических проявлений лежит нарушение кровотока по сосудам, кровоснабжающим кору головного мозга. Окклюзии сосудов приводят к развитию диффузных инфарктов и геморрагии.

У части больных имеет место поражение глаз в виде отека сетчатки и кровоизлияний в нее.

Анемия при ТТП, как правило, тяжелая, с классическими микроангиопатическими изменениями, включая фрагментацию эритроцитов (шизоцитоз), сфероцитоз и ретикулоцитоз. Выраженность тромбоцитопении также значительна. Среднее количество тромбоцитов колеблется от 8 до 40х10 9/л. Отмечается также сокращение средней продолжительность жизни тромбоцитов.

Поражение почек встречается почти у 70% больных тромботической тромбоцитопенической пурпурой и наиболее часто проявляется умеренной протеинуриеи, микрогематурией, как правило, без значительного нарушения функции почек. Редко отмечается острая почечная недостаточность.

Множественный тромбоз сосудов микроциркуляторного русла часто приводит к диффузным изменениям в миокарде. У 10—25% больных в патологический процесс вовлекаются сосуды желудочно-кишечного тракта, что проявляется болями в животе, кишечными кровотечениями, иногда картиной острого живота. Увеличение печени и селезенки нехарактерно.

Клиническая картина ГУС во многом сходна с наблюдаемой при ТТП. У детей заболевание чаще, чем у взрослых, дебютирует с лихорадки и кишечных нарушений. Со стороны кожных покровов и слизистых наблюдаются изменения в виде геморрагии и синяков.

Тяжесть неврологической симптоматики при ГУС выражена меньше, чем при ТТП. В основном преобладают нарушения речи и умственных способностей, но могут встречаться и нарушения сознания, вплоть до комы. Поражение ЦНС при ГУС, наряду с патологическими изменениями в сосудах головного мозга (тромбоз, геморрагии), может быть связано с нарушением функции почек или с тяжелой артериальной гипертензией.

Для ТТП и спорадической формы гемолитико-уремического синдрома нехарактерно поражение сосудов легких и печени. Но в то же время тромбоз легочных микрососудов часто встречается у детей с ГУС, ассоциированным с диареей, а также при заболевании, вызванном приемом лекарственных препаратов.

Клинически ГУС отличается от тромботической тромбоцитопенической пурпуры только более частым поражением при нем почек с развитием острой или хронической почечной недостаточности, артериальной гипертензии и признаков внутрисосудистого гемолиза.

Лабораторные изменения

Лабораторные нарушения при ТТП/ГУС включают тромбоцитопению, Кумбс-отрицательную гемолитическую анемию, изменение формы эритроцитов (фрагментацию), а также ретикулоцитоз. В 60% случаев отмечается умеренный нейтрофильный лейкоцитоз.

Биохимические нарушения заключаются в умеренном повышении концентрации непрямого билирубина и лактатдегидрогеназы. Изменения со стороны свертывающей системы крови не выражены и носят вторичный характер.

Редко наблюдается появление в плазме крови продуктов деградации фибриногена, растворимых фибрин-мономерных комплексов. Отмечается уменьшение концентрации продуктов метаболизма простациклина и, напротив, повышение уровня тромбоксана А2. У 1—5% больных обнаруживаются ложно положительная реакции Вассермана (ЛПРВ), криофибриногенемия, антитела, реагирующие с фосфолипидами (аФЛ) или антитела к ВИЧ.

Лечение

Одним из основных методов лечения ТТП является переливание свежезамороженной плазмы. Оно оказывает положительный эффект на течение заболевания почти у 70% больных.

Полагают, что это связано с введением большого количества нормального фактора VIII и ФВ, а также коррекцией гематологических нарушений. Обычно в течение первых дней суточная доза составляет от 20 до 40 мл/кг массы тела.

Инфузии плазмы проводятся до восстановления нормального количества тромбоцитов, отсутствия признаков гемолиза эритроцитов, нормализации уровня лактатдегидрогеназы и восстановления функций ЦНС [W.Bell et al.,1991]. В большинстве случаев клинический эффект от такого лечения наступает через несколько дней (2—3) от ее начала. Иногда требуется более длительное введение плазмы (до одного месяца).

Плазмаферез по эффективности (70%) не уступает использованию плазмы. Лечение начинают с удаления в сутки 50—60 мл/кг плазмы. Общий объем эксфузий зависит от состояния больного.

Повторные процедуры плазмафереза, особенно в сочетании с введением свежезамороженной плазмы, применяются в тяжелых случаях заболевания. Особенно они показаны при развитии у больных острой почечной недостаточности [G.Rjck et al.,1991]. Эффективность такой терапии при ТТП доходит до 80%.

На ранней стадии заболевания положительный эффект могут оказать повторные внутривенные инфузии простациклина (в дозе 2—5 нг/кг/сутки), которые назначаются вместе с плазмаферезом или с введением свежезамороженной плазмы. Изолированное применение простациклина менее предпочтительно. Следует отметить, что у детей простациклин может усилить диарею, что отрицательно сказывается на последующем течении заболевания.

При ТТП/ГУС монотерапия дезагрегантами неэффективна почти у 60%) больных. Применение этих препаратов, как и простациклина, наиболее оправдано в начальной стадии заболевания, в сочетании с перечисленными выше методами лечения. На более поздних этапах заболевания их эффективность сомнительна.

В некоторых случаях ведение больных тромботической тромбоцитопенической пурпурой сочетают с применением глюкокортикоидов (ГК) (преднизолон 1 мг/кг/сутки). Иногда проводят пульс-терапию. Однако изолированное их назначение неэффективно почти в 90%) случаев. Редко в схему ведения больных с ТТП/ГУС включают цитостатики (азатиоприн 100—150 мг/сутки), как правило, вместе с преднизолоном и повторными курсами плазмафереза.

При ТТП не оправдано проведение спленэктомии или гемодиализа.

Для предотвращения ранних эпизодов обострения в течение первых шести месяцев от момента начала заболевания показан прием дезагрегантов (аспирин, дипиридамол).

Терапия гемолитико-уремического синдрома мало чем отличается от ведения больных с ТТП. Основным методом его лечения как у детей, так и у взрослых является применение плазмафереза в сочетании с заместительной терапией компонентами крови (свежезамороженная плазма, эритроцитарная масса). У взрослых чаще, чем у детей, возникает потребность в повторных процедурах плазмафереза или даже в гемодиализе.

ГК, прямые антикоагулянты (гепарин), дезагреганты обычно неэффективны при ГУС у детей. Напротив, у взрослых имеются сообщения об эффективности комбинированной терапии дезагрегантами. На ранней стадии заболевания положительное воздействие оказывают повторные внутривенные инфузии простациклина (в дозе 2—5 нг/кг/сутки). В эту стадию также показано применение дезагрегантов и антикоагулянтов, эффективность которых сомнительна в более позднем периоде.

В случаях стойкого нарушения функции почек решается вопрос о программном гемодиализе или пересадке почек.

Прогноз

Без лечения прогноз при тромботической тромбоцитопенической пурпуре крайне неблагоприятный: около 80% больных погибает уже в течение первых трех месяцев от начала заболевания. Однако применение плазмафереза и переливание свежезамороженной донорской плазмы позволяют добиться выздоровления в 80—90% случаев.

У детей с гемолитико-уремическим синдромом прогноз благоприятен в 90% случаев. У взрослых, несмотря на проведение адекватной терапии, в 40% случаев наблюдаются смертельные исходы.

Насонов Е.Л., Баранов А.А., Шилкина Н.П.

Опубликовал Константин Моканов

Петлевая изотермическая амплификация для обнаружения цирковируса гусей Научное исследование по теме «Ветеринария»

ВИРОЛОГИЧЕСКИЙ ЖУРНАЛ

Петлевая изотермическая амплификация для обнаружения цирковируса гусей

Wozniakowski et al.

Wozniakowski et al. Журнал вирусологии 2012, 9: 110 http://www.virologyj.com/content/9/1/110

Bio Med Central

МЕТОДОЛОГИЯ Открытый доступ

Петлевая изотермическая амплификация для обнаружения цирковируса гусей

Гжегож Возняковски *, Войцех Коздрун и Эльжбета Саморек-Саламонович

Аннотация

Предпосылки: Цирковирус гусей (GCV) представляет собой иммуносупрессивную проблему при производстве гусей.Клинические симптомы инфекции включают задержку роста или нарушение оперения, но инфекционный процесс может оставаться бессимптомным, что делает инфицированных птиц более восприимчивыми к вторичным вирусным, бактериальным и грибковым инфекциям. Диагноз GCV-инфекции ставится с помощью гистопатологического исследования, дот-блот-гибридизации, полимеразной цепной реакции (ПЦР) и ПЦР в реальном времени. Однако эти методы требуют применения термоциклеров и квалифицированного персонала, что может быть дорогостоящим для некоторых диагностических единиц.Целью этого исследования было разработать метод петлевой изотермической амплификации (LAMP) в качестве простого метода обнаружения GCV.

Результаты: Представленное исследование показало, что LAMP является быстрым инструментом обнаружения ДНК цирковируса гусей (GCV) уже через 30 минут. В методе использовались три набора праймеров: два внешних праймера (F3 и B3), два внутренних праймера (FIP и BIP) и два праймера петли (FL и BL) для ускорения реакции. Оптимальная температура реакции и время составляли 61 ° C в течение 30 мин соответственно.Результаты анализировали с использованием растворов красителя SYBR Green и GelRed ™. Были исследованы тридцать восемь изолятов GCV, собранных из стай гусей в Польше. Для сравнения была проведена полимеразная цепная реакция в реальном времени с праймерами F3 и B3 и красителем SYBR Green. Полученные результаты показали, что GCV-LAMP является чувствительным, быстрым и специфическим анализом и альтернативой методам на основе ПЦР.

Выводы: Разработанная методика благодаря своей простоте может быть использована любой ветеринарной лабораторией или даже передвижными диагностическими установками для рутинного выявления GCV.

Ключевые слова: цирковирус гуся, петлевая изотермическая амплификация, SYBR Green, раствор красителя GelRedTM

Фон

Цирковирусы представляют собой группу небольших вирусов без оболочки диаметром около 20 нм с икосаэдрической симметрией [1]. Несмотря на то, что их история недолговечна, они представляют собой серьезную иммунодепрессивную проблему при заражении свиней, домашней птицы, водоплавающих и диких птиц [1-5]. Семейство Circoviridae состоит из двух родов: Gyrovirus, который представлен вирусом куриной анемии (CAV), одной из наиболее экономически серьезных, но также хорошо изученных проблем в птицеводстве, и род Circovirus, представленный вирусом болезни клюва и пера Пистакина (PBFDV), свиней цирковирусы типов 1 и 2 (PCV1 и PCV2), которые вызывают мультисистемный синдром истощения после отъема (PMWS), цирковирус голубей (PiCV), обнаруженный впервые в 1993 году, цирковирус колумбоидов (CoCV) также

* Переписка: [email protected] Отделение вирусных болезней птицы, Национальный институт ветеринарных исследований, Partyzantow 57 Avenue, 24-100 Putawy, Poland

Bio Med Central

, известный как цирковирус канареек (CaCV), цирковирус утки (DuCV), цирковирус лебедя-шипа (SwCV) и цирковирус гуся (GoCV) [5–12].

Цирковирус гусей был впервые описан в 1998 г. [7] в коммерческой стае гусей, показав коротышку и высокую смертность [13].Известно, что инфицирование GCV может протекать бессимптомно, что способствует вторичному инфицированию другими патогенами водоплавающих птиц, такими как геморрагический полиомавирус гуся (GHPV), парвовирус гуся (GPV) или бактериальными и грибковыми патогенами, такими как Riemerella anatipestifer и Aspergillus fumi-gatus [1]. У гусей, пораженных GCV, может наблюдаться задержка роста или нарушения оперения. Наиболее частые гистопатологические изменения наблюдаются в виде истощения Т-лимфоцитов и гистоцистиса в лимфоидных органах, включая тимус, селезенку и сумку Фабрициуса (BF) [14].Диагностика GCV может помочь изолировать пораженных птиц от остальной части стада, тем самым минимизируя огромные потери из-за иммуносупрессивного влияния GCV.

© 2012 Возняковский и др .; лицензиат BioMed Central Ltd. Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе, при условии правильного цитирования оригинальной работы.

Таблица 1 Последовательности праймеров LAMP, использованных в исследовании

Последовательность праймера длиной 5 '- 3', локализация в геноме GCV

F3 CTGCGGTGTCTTCTGCTT 18 1080-1097

B3 AGTGGAACGTAGACCCCTAC 20 1294-1313

BIP (Blc + B2) TGTTGGATGGTTGGTTTCGGGATTTTGAAAACGTGGTCACCTCACA 46 1214-1235, 1257-1276

FIP (F1c + F2) ACACCCCAGGAGGAAGACAACI IUI IAGIGACAIGCCCAIICCGI 46 1157-1178, 1102-1121

LF ATTCAAGACAACGTAGTATTCT 22 1122-1143

фунтов CAAATACTCTTTTGTGGTATC 2l 1236-1256

F3 - прямой внешний праймер, B3 - прямой задний праймер, FIP - прямой внутренний праймер (F1c + F2), BIP -LB - праймер обратной петли, TTTT - тиминовый линкер.- праймер обратный внутренний (B1c + B2), LF - праймер прямой петли,

До сих пор в представленных отчетах описывалось выделение GoCV в культурах клеток, что является трудоемким и требует SPF гусиных эмбрионов, гистологии и электронной микроскопии, что, с другой стороны, требует операции опытным патологом [14]. Эпоха полимеразной цепной реакции (ПЦР) амплификации нескольких генов и клонирования всей ДНК вирусных геномов способствовала разработке новых и чувствительных методов, таких как вложенная ПЦР и ПЦР в реальном времени, которые позволили надежно и быстро диагностировать, а также секвенировать цирковирусные геномы. [13,15-19].Другие разработанные надежные методы диагностики включают дот-блот-гибридизацию (DBH), которая, как было установлено, отражает стадию и тяжесть инфекции GCV [13]. Однако для применения этих методов требуются хорошо оборудованные лаборатории и опытный персонал.

Из-за этих ограничений в течение последних трех лет увеличилось развитие быстрых и надежных петель-

Наблюдался метод опосредованной изотермической амплификации

(LAMP).

LAMP основан на петле-амплификации определенного участка гена полимеразами Bst или Bsm с активностью замещения цепи ДНК.Оба фермента происходят из термофильных бактерий и катализируют 5 '! 3 "синтез цепи ДНК, но отсутствует 5"! 3 'экзонуклеазная активность. Полимераза Bst выделяется из Bacillus stearothermophilus, тогда как Bsm происходит из Bacillus smithii [20,21]. Идея LAMP была впервые описана Notomi et al. [20], которые применили этот метод для обнаружения вируса гепатита В. Метод чувствителен, по крайней мере, как ПЦР, и быстрый, что позволяет детектировать различные патогены менее чем за 45 минут.Короче говоря, метод основан на смещении цепи ДНК и следующих этапах автоциклирования, катализируемых полимеразой Bst или Bsm в

.

Рисунок 1. Структура генома GCV и локализация сконструированных праймеров LAMP в последовательности GCV (номер доступа в GenBank NC_003054). Описание: Vgpl - вирусный белок 1, Vgp2 - вирусный белок 2 (rep - белок репликации), Vgp3 - вирусный белок 3, Vgp4 - вирусный белок 4 (капсидный белок), числа указывают положение нуклеотида в последовательности, F3 - прямой внешний праймер, F2 - первый сайт присоединения праймера FIP, LFc - сайт присоединения праймера LF, Fl - второй сайт присоединения праймера FIP, Blc - первый сайт присоединения праймера BIP, LB - праймер обратной петли, B2c - второй сайт присоединения праймера BIP, B3c - сайт прикрепления праймера B3, B3 - обратный внешний праймер, FIP - прямой внутренний праймер, BIP - обратный внутренний праймер, LF - прямой праймер петли.

Рис. 2 Температурный градиент ЛАМПЫ. Температуры реакционных смесей указаны над каждой пробиркой. (A) Зеленая флуоресценция после добавления SYBR Green к каждой реакционной смеси в УФ-свете, (B) Оранжевая флуоресценция после добавления окрашивающего раствора GelRed ™ в УФ-свете, (C) Электрофорез продуктов LAMP в 2% агарозном геле, окрашенном GelRed ™ Окрашивающий краситель ДНК.

Рисунок 3 ЛАМПА. Инкубация реакционных смесей в течение разного времени в оптимальных условиях реакции.(A) Оранжевая флуоресценция после добавления окрашивающего раствора GelRed ™ в УФ-свете, (B) Электрофорез продуктов LAMP в 2% агарозном геле, окрашенном окрашивающим раствором ДНК GelRed ™.

температура водяной бани устанавливается в пределах от 60 ° C до 68 ° C [20-22]. LAMP использует два или три набора праймеров, комплементарных шести или восьми различным областям в выбранном гене. В реакции используются прямой внутренний и обратный праймеры (FIP и BIP), внешний прямой и обратный праймеры (F3 и B3), а также праймеры прямой и обратной петли (FL и BL), которые обеспечивают более быстрое образование петлевых и шпилечных структур, позволяющих быстрее обнаруживать специфическая ДНК.Конечные продукты, как известно, представляют собой структуры, похожие на цветную капусту, с множественными выступами и петлями, которые можно наблюдать во время разделения продуктов LAMP в агарозном геле. Прямым доказательством устойчивости LAMP является его применение для обнаружения многих важных вирусных патогенов домашней птицы и водоплавающих птиц, включая вирус Западного Нила (WNV) [23], вирус болезни Марека (MDV) [22], парвовирус гуся (GPV) [24]. , Парвовирус московской утки (MDPV) [25] и цирковирусы, включающие цирковирус свиней [26] и вирус анемии цыплят (CAV) [27].

Целью данного исследования была разработка и применение LAMP для быстрого обнаружения 38 полевых изолятов GCV от гусей в Польше. Это первый отчет об обнаружении GCV с помощью новой техники LAMP.

Результаты

Дизайн праймера Разработанные три пары праймеров были расположены в гене Vgp4, кодирующем капсидный белок GCV (номер доступа в GenBank NC_003054). Геном GCV кодирует четыре вирусных белка (Vgp1-Vgp4) в пяти открытых рамках считывания (ORF).Структура генома GCV, последовательности праймеров и их локализация в геноме GCV приведены в таблице 1 и на рисунке 1.

Рис. 4 Оптимизация концентрации полимеразы Bsm.

(A) Зеленый цвет LAMP-положительных образцов, оранжевый цвет отрицательного контроля, (B) Зеленая флуоресценция после добавления SYBR Green к каждой реакционной смеси в УФ-свете, (C) Электрофорез продуктов LAMP в 2% агарозном геле, окрашенном GelRed ™ 1 раствор для окрашивания ДНК.Отрицательный - отрицательный контроль - реакционная смесь без ДНК-матрицы, 1 - полимераза Bsm, 16 единиц, 2 - полимераза Bsm, 8 единиц, 3 - полимераза Bsm, 4 единицы, 4 - полимераза Bsm, 2 единицы.

Оптимизация LAMP Оптимальная изотермическая температура была установлена ​​как 61 ° C, но диапазон от 56 ° C до 65 ° C не повлиял на результаты LAMP (рис. 2A, B, C).

Температура выше 68 ° C приводила к ингибированию реакции. Оптимальное время LAMP было определено равным 30 мин, однако реакция прошла во всем диапазоне исследованного промежутка времени до 90 мин (рис. 3A, B).Оптимальная концентрация праймера была установлена ​​на уровне 0,4 мМ каждого внутреннего праймера FIP и BIP, 0,1 мМ каждого внешнего праймера F3 и B3, 0,2 каждого праймера LF и LR. Однако реакция была гибкой и позволяла амплифицировать ДНК GCV во всех исследованных концентрациях праймера. Концентрация полимеразы Bsm была установлена ​​на уровне 8 единиц (U). Однако амплификация была возможна даже с использованием 2U полимеразы Bsm (рис. 4A, B). Оба использованных красителя - SYBR Green, а также GelRed ™ в концентрации 1:10 от исходного раствора были полезны для визуального определения присутствия ДНК GCV.Однако более надежные результаты для обнаружения продукта LAMP невооруженным глазом были получены с использованием SYBR Green, который давал чистый оранжевый цвет в отрицательных образцах и светло-зеленый в положительных. В случае красителя GelRedTM положительные образцы становились розовыми, а отрицательные - красными (дополнительный файл 1). В ультрафиолетовом свете сильный оранжевый сигнал был произведен образцами LAMP, окрашенными GelRed TM, но также была очевидна зеленая флуоресценция, даваемая SYBR Green (рис. 5A, B, C).

Чувствительность и специфичность LAMP в реальном времени

ПЦР. Предел обнаружения LAMP составил 100 пг ДНК из штамма P_1_03 (рис. 6А, В).В сравнении с ПЦР в реальном времени было обнаружено такое же количество ДНК эталонного штамма (рис. 6С). Никакого положительного сигнала не наблюдалось в образцах ДНК, экстрагированных из контрольных образцов GHPV, GPV, MDPV или FadV-1 (рис. 7A, B, C). После электрофореза в геле полосы не были показаны в отрицательных контролях, что указывает на то, что LAMP способствует быстрому и специфическому обнаружению GCV.

Рис. 5 Обнаружение продукта LAMP в (A) видимом свете, (B) флуоресценции в УФ-свете после добавления SYBR Green, (C) флуоресценции после добавления GelRed ™.Neg - отрицательный контроль - реакционная смесь без ДНК-матрицы, Pos - ДНК штамма P_1_03.

Анализ проб в полевых условиях с помощью LAMP и ПЦР в реальном времени

Всего было протестировано 38 различных полевых проб, собранных у гусей с различными клиническими симптомами (рис. 8A, B). Почти все образцы (97,3%), кроме одного (№12), были положительными на LAMP. В двух образцах № 4 и № 20 наблюдаемая лестничная картина после гелевого электрофореза была слабой по сравнению с их флуоресценцией.Однако результаты, полученные с помощью ПЦР в реальном времени, подтвердили данные, полученные с помощью анализа LAMP (таблица 2). Наблюдаемые значения CT этих двух образцов достигли 38,9 и 38,1 соответственно. Положительные значения КТ были обнаружены у гусей с клиническими симптомами инфекции GCV. Образец 12 был отрицательным. Проведенный анализ температуры плавления продуктов ПЦР показал такую ​​же или

График Q-усиления

100 нг 10 нг лнг 100 пг 10 пг

OOT.....................

a j i t tntiuitwiisMataavJia * «]«

Рисунок 6 Чувствительность LAMP (A), (B) и ПЦР в реальном времени для обнаружения GCV. Панель (A) показывает зеленую флуоресценцию после добавления SYBR Green к каждой реакционной смеси в УФ-свете, панель (B) - электрофорез продуктов LAMP в 2% агарозном геле, окрашенном раствором для окрашивания ДНК GelRed ™, а панель (C) - график чувствительности ПЦР в реальном времени .

очень близкая температура (79,9-80.8 ° C) для всех полученных продуктов (таблица 2; рисунок 9). LAMP позволил определить GCV на водяной бане в течение 30 мин без термоциклера. Абсолютной необходимости в разделении реакционных смесей на геле не было, поскольку наблюдаемая флуоресценция была специфичной, а гель-электрофорез выполняли только для обеспечения надежности разработанного анализа.

Обсуждение

Цирковирусы представляют серьезную угрозу для разведения всех экономически важных животных, включая свиней, домашних птиц и водоплавающих птиц.Цирковирус гусей (GCV) представляет собой непрерывный и до сих пор не очень хорошо изученный агент, вызывающий иммуносупрессию у пораженных водоплавающих птиц [1,9,26]. Первое заключение клинической формы

Рис. 7 Специфичность LAMP (A), (B) и ПЦР в реальном времени для обнаружения GCV. Панель (A) показывает зеленую флуоресценцию после добавления SYBR Green к каждой реакционной смеси в УФ-свете, панель (B) - электрофорез продуктов LAMP в 2% агарозном геле, окрашенном раствором для окрашивания ДНК GelRed ™, а панель (C) - график специфичности ПЦР в реальном времени .А - эталонная ДНК штамма цирковируса гусей P_1_03, Б - ДНК штамма геморрагического полиомавируса гуся (GHPV) 2003, В - штамм парвовируса московской утки FM, D - штамм парвовируса гуся B38, E - штамм фоуладеновируса типа 1 CELO.

A B M NegPos 12 3 J S 6 1 S 9 It U>! li 11 IS M

Рисунок 8 ЛАМПА. Анализ 38 полевых проб от гусей с клиническими симптомами. Панель (A) показывает зеленую флуоресценцию после добавления SYBR Green к каждой реакционной смеси в УФ-свете, панель (B) - электрофорез продуктов LAMP в 2% агарозном геле, окрашенном раствором для окрашивания ДНК GelRed ™.

возникновение болезни с высокой смертностью и задержкой роста было описано Soike et al. [7]. Роль его иммунномодулирующей активности была также представлена ​​в контексте коинфекции гусей вирусом Западного Нила в стае венгерских гусей [28]. Экспериментальный подход к пониманию пути заражения и патологии заражения цирковирусами недавно был изучен Guo et al. [14], которые подтвердили важную роль этих вирусов в клинической форме заболевания, проявляющейся в тяжелых поражениях оперения.Однако диагноз, поставленный только на основании самих клинических симптомов, также должен быть подтвержден другими методами, включая гистологические анализы, электронную микроскопию, серологические анализы, гибридизацию in situ [28] или различные варианты полимеразной цепной реакции (ПЦР) [19]. В настоящее время ПЦР остается важнейшим инструментом выявления GCV и других цирковирусов птиц. Недавно ПЦР в реальном времени на основе SYBR Green I была применена для простого обнаружения цирковируса уток (DuCV) в ДНК, выделенной из различных тканей уток [15].Метод также позволил количественно определить DuCV в исследуемых образцах, что также способствует лучшему пониманию передачи DuCV и стадии инфекции. Несмотря на многие преимущества ПЦР и ПЦР в реальном времени, эти методы также демонстрируют ограничения, потому что они требуют термоциклеров для ПЦР и даже более сложных систем ПЦР в реальном времени, которые могут быть недоступны для небольших клинических отделений или мобильных лабораторий. В представленной статье описывается петлевой изотермический

(LAMP), который позволяет простое, чувствительное и специфическое обнаружение ДНК цирковируса гуся невооруженным глазом или в УФ-свете уже через 30 минут с использованием только водяной бани или термостата с сухим блоком.LAMP катализируется полимеразой Bst или Bsm и двумя или тремя наборами праймеров, комплементарных восьми фрагментам в выбранном гене. Ранее было показано, что этот метод представляет собой хорошую альтернативу ПЦР для обнаружения цирковирусов, включая цирковирус свиней типа 2 [5] и вирус анемии цыплят (CAV) [26]. Представленный GCV-LAMP был разработан для облегчения обнаружения вируса за 30 мин. Для сравнения, ранее описанные методы LAMP позволили обнаружить цирковирусы примерно за 60-90 минут [5,22-24,26].GCV-LAMP был специфичен только для GCV, и не было показано перекрестной реактивной амплификации с другими вирусами водоплавающих птиц. Возможная перекрестная реакция с ДНК цирковируса голубей (PiCV) также была исключена. Сконструированные праймеры были комплементарны последовательности гена Vgp4, кодирующей белок капсида, что делало их специфичными только для GCV. Используя праймеры F3 и B3 в ПЦР в реальном времени на основе SYBR-Green, можно было подтвердить результаты, полученные с помощью нового анализа. Однако ПЦР в реальном времени заняла более полутора часов и потребовала сложной аппаратуры.Кроме того, мы также успешно протестировали альтернативу широко используемому красителю SYBR-Green, который представляет собой краситель GelRed TM, который дает сильную флуоресценцию в УФ-свете, но не подходит для визуального обнаружения GCV невооруженным глазом. Завершая это исследование, разработанная методика GCV-LAMP позволила обеспечить надежное и простое обнаружение

Таблица 2 Пороговые значения цикла и температуры плавления продуктов ПЦР в реальном времени GCV

Пороговое значение цикла пробы Температура плавления ° C

Отр. 40.0–

Позиция 11,4 80,2

1 31,7 80,0

2 36,7 79,9

3 31,1 80,0

4 38,9 80,1

5 29,3 79,9

6 31,7 80,0

7 35,8 80,2

8 28,6 79,9

9 37,9 80,2

10 36,8 80,0

11 35,9 80,0

12 40.0–

13 32,0 80,0

14 36,1 80,0

15 34,6 80,2

16 30,9 80,2

17 34,6 80,4

18 32,0 80,6

19 21,6 80,2

20 38,1 80,3

21 30,7 80,4

22 36,4 80,2

23 19,3 80,4

24 34.2 80,4

25 35,9 80,4

26 35,6 80,4

27 34,2 80,2

28 31,2 80,2

29 20,4 80,2

30 27,4 79,9

31 26,7 80,4

32 27,1 80,4

33 29,2 80,6

34 37,0 80,6

35 26,1 80,6

36 33.7 80,8

37 36,3 80,4

38 30,6 80,8

Значения порога цикла (CT) и температуры плавления в ° C приведены в таблице.

цирковируса гусей при инфекциях гусей. Анализ может использоваться неопытным лабораторным персоналом, используя простую водяную баню или УФ-лампу.

Методы

ДНК эталонного и контрольного вирусов Эталонная ДНК штамма цирковируса гусей P_1_03 (таблица 3), использованная в этом исследовании, была любезным подарком от доктора Вилмоша Паля (CEVA-Phylaxia, Ceva Sante Animale, Будапешт, Венгрия).Штамм использовали в качестве положительного контроля для разработанного анализа SYBR Green с ПЦР в реальном времени и петлевой амплификации. Отрицательными контролями, использованными для тестирования специфичности ПЦР в реальном времени и LAMP, были: ДНК штамма геморрагического полиомавируса гуся (GHPV) 2003, штамм FM парвовируса московской утки (Vilmos Palya, CEVA-Phylaxia, Ceva Sante Animale, Будапешт, Венгрия), парвовирус гуся. штамм B38 и штамм CELO аденовируса птиц типа 1 (FadV-1) из коллекции Отделения вирусных болезней птицы Национального исследовательского института ветеринарии, Пулавы, Польша.

Полевые изоляты GCV Тридцать восемь полевых изолятов GCV были собраны в течение 2003-2010 гг. Из срезов ткани печени польских стай серых гусей (Anser anser), демонстрирующих различные клинические симптомы вирусной инфекции. Гусей отправили в Отделение вирусных болезней птицы Национального исследовательского ветеринарного института, Пулавы, Польша, для диагностики болезни. Срезы печени исследуемых птиц по 20 мг гомогенизировали в 1 мл полисалинфосфатного буфера (PBS) с 1% добавкой антибиотиков (Antibiotic-antimitotic, Gibco) и подвергали экстракции ДНК.L буфера AE (10 мМ Tris Cl; 0,5 мМ EDTA, pH 9,0), поставляемого с набором. Затем ДНК замораживали и хранили при -70 ° C для дальнейшего исследования.

Кривая плавления

ft i;

5? с- 1

n ■ A

e; o 70 .o 75.0 so o ss.o oo.o oj.o

Tm 80,82 Температура (€)

Рис. 9 Анализ температуры плавления продуктов ПЦР в реальном времени GCV.Значение производной репортера отложено по оси Y, а температура - по оси X.

Таблица 3 Референсные номера и 8 полевых штаммов GCV, использованных в данном исследовании

Штамм Регистрационный номер Источник

P_1_03 JQ269340 CEVA-Phylaxia, Ceva Sante Animale, Будапешт, Венгрия

P_2_03 JQ269341 Полевой изолятор, гуси

P_3_03 JQ269342 Полевой изолятор, гуси

P_6_05 JQ269343 Полевой изолятор, гуси

P_10_05 JQ269344 Полевой изолятор, гуси

P_11_05 JQ269345 Полевой изолятор, гуси

P_13_07 JQ269346 Полевой изолятор, гуси

P_20_08 JQ269347 Полевой изолятор, гуси

P_50_08 JQ269348 Полевой изолятор, гуси

Оптимизация петлевой амплификации (LAMP)

праймеров ДНК GCV для GCV-LAMP были сконструированы в соответствии с последовательностью полной последовательности цирковируса гусей (номер доступа в GenBank NC_003054) с использованием Primer Explorer версии 4 (NetLaboratory, Tokyo, Japan).L содержит: 1x буфер Bsm Pol (20 мМ Tris-HCl (pH 8,8 при 25 ° C), 10 мМ KCl, 10 мМ (Nh5) 2SO4, 5 мМ MgSO4,

0,1% Tween 20) (Thermo Scientific-Fermentas, Вильнюс, Литва), 0,8 M бетаина (Sigma-Aldrich, Сент-Луис, Миссури, США), 1,2 мМ каждого дНТФ (EurX), 0,4-1,2 мМ каждого внутреннего праймеры FIP и BIP, 0,1-0,4 мМ каждый из внешних праймеров F3 и B3, 0,20,6 мМ каждого праймера LF и LR, ДНК-полимераза Bsm 2-8U (Thermo Scientific-Fermentas, Вильнюс, Литва), 1 мкл ДНК темплат (~ 25 нг) и деионизированная вода.Мкл окрашивающего красителя GelRed ™ (Biotum, Дели, Индия). Конкретные лестничные структуры продуктов LAMP были визуализированы и сфотографированы в УФ-свете в системе GenoSmart (VWR, Randor, Пенсильвания, США).

ПЦР в реальном времени ПЦР в реальном времени выполняли на ABI 7500 (Applied Biosystems, Фостер-Сити, Калифорния, США) с операционным программным обеспечением версии 2.0.1. Реакции проводили в оптических пробирках OptiAmp® с крышками объемом 0,2 мл (Applied Biosystems, Фостер-Сити, Калифорния, США) с использованием набора Quantitect SYBR Green PCR Kit (Qiagen, Hilden, Германия) с нанесением внешних праймеров F3 и B3, предназначенных для ФОНАРЬ.L) использовались в качестве шаблонов для каждой реакции. Тест на специфичность проводили с использованием эталонной ДНК штамма цирковируса гусей P_1_03 (CEVA-Phylaxia, Ceva Sante Animale, Будапешт, Венгрия) и набора отрицательных контролей: ДНК штамма геморрагического полиомавируса гуся (GHPV) 2003, штамма парвовируса московской утки FM (Vilmos Palya , CEVA-Phylaxia, Ceva Sante Animale, Будапешт, Венгрия),

штамм парвовируса гуся B38 и штамм аденовируса птицы типа 1 CELO из коллекции Департамента вирусных болезней птицы Национального исследовательского ветеринарного института, Пулавы, Польша.

Дополнительный файл

Дополнительный файл 1: Рисунок 11. GCV-LAMP. Образцы после окрашивания LAMP раствором GelRedTM 1:10. Neg - отрицательный контроль - реакционная смесь без ДНК-матрицы, Pos - ДНК штамма P_1_03.

Конкурирующие интересы

Авторы заявляют об отсутствии конкурирующих интересов. Вклад авторов

Большинство экспериментов было проведено GW, который разработал и оптимизировал LAMP и ПЦР в реальном времени.WK предоставила эталонные вирусы и полевые изоляты GCV. ESS помогала в экспериментальном дизайне исследования. ESS и WK участвовали в координации исследования. GW написал эту рукопись и подготовил рисунки для публикации. Окончательный вариант рукописи был прочитан и одобрен всеми авторами.

Получено: 30 января 2012 г. Принято: 18 мая 2012 г. Опубликовано: 13 июня 2012 г.

Список литературы

1. Тодд Д. Цирковирусные заболевания птиц: уроки по изучению PMWS.Vet Microbiol 2004, 98: 169-174.

2. Райдал С.Р., Риддок П.А.: Болезнь пера у сенегальских голубей (Streptopelia senegalensis) морфологически сходна с болезнью клюва и пера пситтацина. Авиан Патол 1997, 26: 829-836.

3. Тодд Д., Уэстон Дж. Х., Сойк Д., Смит Дж. А. Определение последовательности генома и анализ новых цирковирусов гуся и голубя. Virology 2001, 286: 354-362.

4. Стюарт М.Э., Перри Р., Райдал С.Р .: Идентификация нового цирковируса у австралийских воронов (Corvus coronoides) с болезнью перьев.Авиан Патол 2006, 35: 86-92.

5. Zhao K, Han F, Zou Y, Zhu L, Li C, Xu Y, Zhang C, Tan F, Wang J, Tao S, He X, Zhou Z, Tang X: быстрое обнаружение цирковируса свиней типа 2 с использованием ПЦР в реальном времени на основе TaqMan. Virol J 2010, 7: 374.

6. Hailemariam H, Omar A, Hair-Bejo M, Giap T: Обнаружение и характеристика вируса анемии цыплят у коммерческих племенных цыплят-бройлеров. Virol J 2008, 5: 128.

7. Сойке Д., Колер Б., Альбрехт К. Цирковирусоподобная инфекция у гусей, связанная с синдромом рантинга.Авиан Патол 1999, 28: 199-202.

8. Халами М.Ю., Нипер Х., Мюллер Х., Джон Р.: Обнаружение нового цирковируса у лебедей-шиповников (Cygnus olor) с помощью вложенной ПЦР широкого спектра. Вирус

Res 2008, 132: 208-212.

9. Банда А., Галлоуэй-Хаскинс Р.И., Сандху Т.С., Шат К.А.: Генетический анализ цирковируса уток, обнаруженный у коммерческих уток Пекина в Нью-Йорке. Птичий Дис 2007, 51: 90-95.

10. Дюшатель Дж. П., Тодд Д., Виллеман С., Лоссон Б. Количественная оценка цирковируса голубей в сыворотке, крови, семенной жидкости и различных тканях естественно инфицированных голубей с использованием полимеразной цепной реакции в реальном времени.Авиан Патол 2009, 38: 143-148.

11. Чжан X, Цзян С., Ву Дж, Чжао Q, Сунь Y, Конг Y, Ли X, Яо М., Чай Т.: расследование цирковируса уток и коинфекции у уток Черри-Вэлли в провинции Шаньдун, Китай. Vet Microbiol 2009, 133: 252-256.

12. Rahaus M, Dwsloges N, Probst S, Loebbert B., Lantermann W., Wolff MH: Обнаружение ДНК вируса болезни клюва и пера в зародышевых яйцах птиц семейства пситтацинов. Vet Med-Czech 2008, 53: 53-58.

13.Болл Н.В., Смит Дж. А., Вестон Дж. Х., Боргманс Б. Дж., Паля В., Главитс Р., Иваникс Э, Дэн А., Тодд Д.: Диагностика цирковирусной инфекции гусей в образцах венгерских гусей с использованием тестов полимеразной цепной реакции и дот-блот-гибридизации. Авиан Патол 2004, 33: 51-58.

14. Го Дж, Тиан Дж, Тан X, Ю Х, Дин С., Сун Х, Ю Х: Патологические наблюдения экспериментальной инфекции гусей цирковирусом гусей. Птичий патол

2011, 40: 55-61.

15.Ван Ц., Хуанг И, Ченг Л., Фу Г, Ши Ш., Чен Х, Пэн Ц, Лин Ф, Лин Дж .: Разработка быстрой количественной ПЦР на основе SYBR Green I для обнаружения цирковируса уток. Virol J 2011, 8: 465.

16. Манкерц А., Хаттерманн К., Элерс Б., Сойке Д. Клонирование и секвенирование цирковируса колумбид (CoCV), нового цирковируса голубей. Arch Virol 2000, 145: 2469-2479.

17. Eisenberg SW, van Asten AJ, van Ederen AM, Dorrestein GM: Обнаружение цирковируса с помощью полимеразной цепной реакции у страуса (Struthio camelus) на ферме в Нидерландах.Vet Microbiol 2003, 95: 27-38.

18. Fringuelli E, Scott AN, Beckett A, McKillen J, Smyth JA, Palya V, Glavits R, Ivanics E, Mankertz A, Franciosini MP, Todd D: Диагностика цирковирусных инфекций уток с помощью обычной полимеразной цепной реакции и полимеразной цепной реакции в реальном времени тесты. Авиан Патол 2005, 34: 495-500.

19. Chen C, Wang P, Lee M, Shien J, Shien H, Ou S, Chen C, Chang P: Разработка процедуры полимеразной цепной реакции для обнаружения и дифференциации цирковирусов уток и гусей.Птичий Дис 2006,50: 92-95.

20. Нотоми Т., Окаяма Х., Масубучи Х., Йонекава Т., Ватанабе К., Амино N, Хаза Т: изотермическая амплификация ДНК, опосредованная петлей. Nucleic Acids Res 2000, 28:63.

21. Нагамин К., Ватанабе К., Оцука К., Хасе Т, Нотоми Т: опосредованная петлей реакция изотермической амплификации с использованием неденатурированной матрицы. Clin Chem 2001, 47: 1742-1743.

22. Возняковский Г., Саморек-Саламонович Э., Коздрун В.: Быстрое обнаружение вируса болезни Марека в перьевых фолликулах с помощью петлевой амплификации.Птичий Дис 2011, 55: 462-467.

23. Parida M, Posadas G, Inoue S, Hasebe F, Morita K: изотермическая амплификация, опосредованная петлей обратной транскрипции в реальном времени, для быстрого обнаружения вируса Западного Нила. J Clin Microbiol 2004, 42: 257-263.

24. Yang JL, Rui Y, Cheng AC, Wang MS, Fu LZ, Yang SQ, Zhang SH, Yang L, Xu ZY: простой и быстрый метод обнаружения парвовируса гуся в полевых условиях с помощью петлевой изотермической амплификации. Вирол Дж 2010, 7:14.

25. Ji J, Xie QM, Chen CY, Bai SW, Zou LS, Zuo KJ, Cao YC, Xue CY, Ma JY, Bi YZ: Молекулярное обнаружение парвовируса мускусной утки с помощью петлевой изотермической амплификации. Poult Sci 2010, 89: 477-483.

26. Chena CM, Cui SJ: Обнаружение парвовируса свиней с помощью петлевой изотермической амплификации. Дж. Вирол Методы 2009, 155: 122-125.

27. Huang CH, Lai GH, Lee MS, Lin WH, Lien YY, Hsueh SC, Kao JY, Chang W.T., Lu TC, Lin WN, Chen HJ, Lee MS: Разработка и оценка петлевой изотермической амплификации для быстрой обнаружение вируса анемии цыплят.J Appl Microbiol 2010, 108: 917-924.

28. Смит Дж., Сойк Д., Моффет Д., Уэстон Дж. Х., Тодд Д.: Гуси, инфицированные цирковирусом, изучены с помощью гибридизации in situ. Авиан Патол 2005, 34: 227-232.

DOI: 10.1186 / 1743-422X-9-110

Цитируйте эту статью как: Возняковский и др.: Петлевая изотермическая амплификация для обнаружения цирковируса гусей. Журнал вирусологии 2012

9: 110.

Отправьте вашу следующую рукопись в BioMed Central и воспользуйтесь всеми преимуществами:

• Удобная онлайн-подача

• Тщательная экспертная оценка

• Отсутствие ограниченного пространства или платы за цветные рисунки

• Немедленная публикация о приемке

• Включение в PubMed, CAS, Scopus и Google Scholar

• Исследование, свободно доступное для распространения

Отправьте рукопись на Tpntral

www.biomedcentral.com/submit> _ciiuai

Типы, способы передачи и советы по профилактике

Грипп или грипп - это вирусная инфекция, поражающая легкие, нос и горло. Это заразное респираторное заболевание с симптомами от легких до тяжелых.

Грипп и простуда имеют схожие симптомы. Различить эти два заболевания бывает сложно. В большинстве случаев симптомы гриппа более тяжелые и длятся дольше, чем простуда.

Любой человек может заболеть гриппом, но у некоторых людей риск заражения выше.Сюда входят дети в возрасте до 5 лет и взрослые в возрасте 65 лет и старше.

Риск гриппа также увеличивается, если у вас ослабленная иммунная система или хроническое заболевание, например:

Вначале грипп может имитировать простуду. Ранние симптомы могут включать:

  • боль в горле
  • чихание
  • насморк

Симптомы часто ухудшаются по мере прогрессирования вируса и могут включать:

  • лихорадку
  • больные мышцы
  • потливость
  • тело озноб
  • сухой кашель
  • заложенность носа
  • усталость
  • слабость

Грипп обычно не требует посещения врача.Симптомы часто улучшаются при домашнем лечении примерно через неделю. Вы можете облегчить симптомы с помощью лекарств от простуды и гриппа, отпускаемых без рецепта. Также важно много отдыхать и пить много жидкости.

Однако у некоторых людей грипп может вызвать осложнения. Если вы или ваш ребенок относитесь к одной из этих групп высокого риска, обратитесь за медицинской помощью, как только вы заподозрите грипп.

Группы высокого риска включают тех, кто:

  • младше 2 лет
  • 65 лет и старше
  • беременных или недавно родивших
  • 18 лет или младше и принимающих аспирин или салицилатсодержащие препараты
  • американских индейцев или уроженец Аляски
  • страдает хроническим заболеванием, например диабетом, астмой, сердечным заболеванием или ВИЧ.
  • проживает в доме престарелых или учреждении по уходу

Ваш врач может назначить противовирусные препараты.Противовирусные препараты, принимаемые в течение первых 48 часов после появления симптомов, могут уменьшить продолжительность и тяжесть гриппа.

Большинство людей выздоравливают от гриппа без осложнений. Но иногда может развиться вторичная инфекция, например:

Если симптомы исчезнут, а через несколько дней вернутся, возможно, у вас вторичная инфекция. Обратитесь к врачу, если подозреваете вторичную инфекцию.

Если не лечить, пневмония может быть опасной для жизни.

Чтобы защитить себя от гриппа, лучше всего понять, как распространяется вирус.Грипп очень заразен. Он может быстро распространяться в домах, школах, офисах и среди групп друзей.

По данным Центров по контролю и профилактике заболеваний (CDC), можно передать грипп кому-либо за 1 день до появления симптомов и в течение 5-7 дней после того, как вы заболели.

После контакта с вирусом симптомы заболевания проявляются в течение 1–4 дней. Вы даже можете передать вирус кому-нибудь, прежде чем поймете, что заболели.

Грипп в основном передается от человека к человеку. Если больной гриппом чихает, кашляет или разговаривает, капли от него переносятся по воздуху. Если эти капли попадут вам в нос или рот, вы тоже можете заболеть.

Вы также можете заразиться гриппом от рукопожатий, объятий и прикосновения к поверхностям или предметам, зараженным вирусом. Вот почему вам не следует делиться посудой или стаканами с кем-либо, особенно с тем, кто может быть болен.

Существует три различных типа вирусов гриппа, поражающих людей: тип A, тип B и тип C.(Есть четвертый, тип D, который не влияет на людей.)

Животные и люди могут заразиться гриппом типа A, потому что вирус гриппа может передаваться от животных к человеку. Этот вирус постоянно меняется и может вызывать ежегодные эпидемии гриппа.

Грипп типа B также может вызывать сезонные вспышки в зимние месяцы. Однако этот тип обычно менее тяжел, чем тип А, и вызывает более легкие симптомы. Иногда тип B может вызывать серьезные осложнения. Тип B может передаваться только от человека к человеку.

Различные штаммы вызывают грипп типа A и B.

Грипп типа C поражает людей и некоторых животных. Это вызывает легкие симптомы и мало осложнений.

Очень важно защитить себя и свою семью от вируса, поскольку это может вызвать осложнения.

Поскольку вирус гриппа может передаваться от человека к человеку, не забывайте часто мыть руки с мылом или используйте дезинфицирующее средство для рук на спиртовой основе. Также не прикасайтесь к носу и рту немытыми руками.

Вирус гриппа может жить на твердых поверхностях и предметах до 48 часов. Используйте дезинфицирующие салфетки или спрей для поверхностей, к которым часто прикасаются, дома или на работе, чтобы обезопасить себя.

Если вы ухаживаете за больным гриппом, наденьте маску, чтобы защитить себя. Вы можете помочь остановить распространение гриппа, прикрыв рот своим кашлем и чиханием. Лучше кашлять или чихать в локоть, а не в руки.

Кроме того, рассмотрите возможность ежегодной вакцинации от гриппа.Вакцина рекомендована всем в возрасте старше 6 месяцев. Он защищает от распространенных штаммов вируса гриппа.

По данным CDC, хотя вакцина не на 100 процентов эффективна, она может снизить риск заболевания гриппом на 40–60 процентов.

Вакцина против гриппа вводится путем инъекции в руку. Существует также вариант вакцины против гриппа в виде назального спрея для небеременных людей в возрасте от 2 до 49 лет.

Вирус гриппа меняется из года в год. Ежегодно вакцины обеспечивают защиту от наиболее распространенных штаммов гриппа.Вакцина против гриппа стимулирует иммунную систему к выработке антител для борьбы с инфекцией.

Чтобы создать эффективную вакцину, Всемирная организация здравоохранения определяет, какие штаммы вируса гриппа включить в вакцину на следующий год. Вакцина содержит неактивную или ослабленную форму вируса гриппа.

Вирус смешан с другими ингредиентами, такими как консерванты и стабилизаторы. После вакцинации от гриппа ваш организм начинает вырабатывать антитела.Это помогает бороться с любым воздействием вируса.

После прививки от гриппа у вас могут появиться симптомы гриппа, такие как субфебрильная температура, головная боль или боли в мышцах.

Однако прививка от гриппа не вызывает гриппа. Эти симптомы обычно проходят в течение 24-48 часов. Наиболее частым осложнением вакцины против гриппа является болезненность в месте инъекции.

Что вы можете сделать с гриппом:

  • Сделайте прививку от гриппа. Это поможет защитить вас от опасных для жизни осложнений, таких как пневмония.
  • После вакцинации ваше тело вырабатывает антитела к гриппу в течение 2 недель. Чем раньше вы сделаете прививку от гриппа, тем лучше.
  • Если у вас аллергия на яйца, вы все равно можете пройти вакцинацию. Для людей с тяжелой аллергией на яйца CDC рекомендует вакцинацию в медицинских учреждениях, которые могут лечить аллергические реакции. Некоторые формы вакцины могут содержать следовые количества яичного белка, но аллергическая реакция маловероятна.
  • Часто мойте руки.
  • Кашель и чихание в локоть.
  • Протрите поверхности, к которым часто прикасаются, дома и в офисе.

Грибковые инфекции: типы, симптомы и лечение

Мы включаем продукты, которые, по нашему мнению, полезны для наших читателей. Если вы покупаете по ссылкам на этой странице, мы можем получить небольшую комиссию. Вот наш процесс.

Что такое грибковая инфекция?

Грибковые инфекции могут поразить кого угодно, и они могут появиться на нескольких частях тела. Спортсменка со спортивной стопой, ребенок с молочницей и женщина с вагинальной дрожжевой инфекцией - вот лишь несколько примеров.

Грибы - это микроорганизмы, в стенках клеток которых содержится вещество, называемое хитином. Некоторые грибы, как и многие виды грибов, съедобны. Другие виды грибов, такие как aspergillus , могут быть чрезвычайно опасными и приводить к опасным для жизни заболеваниям.

Различные типы грибов могут вызывать грибковые инфекции. В некоторых случаях грибки, которые обычно не встречаются на вашем теле или внутри него, могут колонизировать его и вызвать инфекцию. В других случаях грибки, которые обычно присутствуют на вашем теле или внутри него, могут бесконтрольно размножаться и вызывать инфекцию.

Грибковые инфекции могут быть заразными. Они могут передаваться от одного человека к другому. В некоторых случаях вы также можете заразиться болезнетворными грибами от инфицированных животных или загрязненной почвы или поверхностей.

Если у вас появятся признаки или симптомы грибковой инфекции, запишитесь на прием к врачу.

Грибковая инфекция также известна как микоз. Хотя большинство грибов безвредны для человека, некоторые из них способны вызывать заболевания при определенных условиях.

Грибы размножаются, выделяя споры, которые могут быть захвачены при прямом контакте или даже при вдыхании.Вот почему грибковые инфекции чаще всего поражают вашу кожу, ногти или легкие. Грибки также могут проникать через кожу, поражать органы и вызывать системную инфекцию всего организма.

Некоторые распространенные типы грибковой инфекции включают:

  • микоз
  • зуд спортсмена
  • стригущий лишай
  • грибковая инфекция
  • онихомикоз или грибковая инфекция ногтя

Некоторые типы грибов обычно не вызывают инфекции у людей, но может вызывать болезни у людей с ослабленной иммунной системой.Это так называемые оппортунистические инфекции.

Стопа атлета также известна как микоз стопы. Это разновидность грибковой инфекции, которая может поражать кожу ног, а также руки и ногти. Инфекция вызывается дерматофитами - группой грибов, которые могут размножаться в теплых и влажных областях между пальцами ног.

Это особенно распространено среди спортсменов и может передаваться от одного человека к другому. Вы также можете подхватить его на загрязненных поверхностях, например, в общественном душе или на полу раздевалки.

Симптомы

Стопа атлета может вызывать зуд, покалывание или ощущение жжения между пальцами ног или на других частях стопы. Кожа также может трескаться, шелушиться или образовываться волдыря.

Диагноз

Врач может распознать стопу спортсмена по симптомам на вашей коже. Если врач не уверен, можно соскрести небольшой участок кожи и проверить его на грибок.

Лечение

Существует несколько противогрибковых препаратов местного действия, отпускаемых без рецепта (OTC), которые можно использовать для лечения стопы спортсмена.Если они не принесут облегчения, ваш врач может назначить более сильное лекарство. Получите необходимую информацию, чтобы остановить спортсмена.

Магазин противогрибковых продуктов на Amazon.

Джок зуд также известен как опоясывающий лишай. Это грибковая инфекция, которая может поражать кожу в области паха, а также внутреннюю поверхность бедер и ягодиц. Как и стопа спортсмена, она вызывается дерматофитами - группой грибов, которые размножаются в теплых и влажных областях.

Этот тип инфекции чаще всего поражает мужчин и мальчиков, но также может развиться у женщин и девочек.

Симптомы

Распространенные симптомы зуда у спортсмена включают:

  • покраснение
  • зуд
  • чувство жжения
  • изменение цвета кожи
  • шелушение или растрескивание кожи
  • сыпь, которая усиливается при физических упражнениях
      66
  • Часто врач может распознать зуд спортсмена, посмотрев на пораженную кожу. Чтобы исключить другие заболевания, такие как псориаз, они могут соскоблить клетки кожи и исследовать их.

    Лечение

    Зуд спортсмена можно вылечить дома, поддерживая чистоту и сухость и применяя противогрибковый крем, порошок или спрей, отпускаемый без рецепта.

    Если ваши симптомы не улучшатся после двух недель домашнего ухода, обратитесь к врачу. Они могут прописать более сильные противогрибковые препараты. Узнайте, как распознать, лечить и предотвратить зуд спортсменов.

    Стригущий лишай - это грибковая инфекция, которая может поражать кожу и кожу головы. Подобно зуду стопы и спортсмена, он вызывается дерматофитами.Стригущий лишай также является частью группы грибов, которые растут на коже, особенно во влажных и влажных частях тела.

    Симптомы

    Обычно начинается с появления красноватой, зудящей, чешуйчатой ​​сыпи. Со временем пятна стригущего лишая могут распространяться и образовывать красные кольца.

    Другие признаки включают:

    • пятен, на которых появляются волдыри и начинают сочиться
    • залысин на коже головы
    • пятен, которые выглядят как кольца с более красным внешним краем
    • толстые, обесцвеченные или потрескавшиеся ногти (если инфекция есть в ногтях)

    Диагноз

    Простой кожный осмотр может найти стригущий лишай.Грибок светится черным светом, поэтому врач может определить, есть ли он у вас, посветив черным светом на пораженный участок. Небольшой образец пораженной кожи также можно соскоблить и отправить в лабораторию для тестирования.

    Лечение

    Как и зуд спортсмена, стригущий лишай часто можно успешно лечить с помощью безрецептурных противогрибковых кремов, спреев, гелей или мазей.

    Вам может понадобиться рецепт, если ваш случай более тяжелый или инфекция находится на ногтях или коже черепа.Получите лучшее понимание стригущего лишая, включая способы его предотвращения и лечения.

    Candida albicans - это тип грибка, который может инфицировать вашу кожу, рот, желудочно-кишечный тракт, мочевыводящие пути или половые органы.

    Наличие небольшого количества Candida albicans на коже и в вашем теле - это нормально. Но когда эти грибки слишком много размножаются, они могут вызвать инфекцию, известную как дрожжевая инфекция.

    Симптомы

    Если у вас грибковая инфекция в горле или во рту, это называется оральным молочницей.Молочница вызывает образование белых пятен во рту и горле. Этот тип инфекции часто развивается у людей, которые проходят длительную антибактериальную терапию.

    Среди женщин относительно часто встречаются вагинальные дрожжевые инфекции. Они могут вызвать:

    • боль
    • зуд
    • комковатые выделения
    • опухоль
    • покраснение

    Диагноз

    Чтобы проверить наличие молочницы во рту, ваш врач может использовать мазок из горла, чтобы потереть пораженные участки. Мазки из горла похожи на ватную палочку.Ваш врач может отправить мазок в лабораторию, где техники будут культивировать его, чтобы узнать, какие типы грибов или других микробов присутствуют.

    Ваш врач проведет гинекологический осмотр для диагностики вагинальной дрожжевой инфекции. Если они не уверены, что ваши симптомы вызваны дрожжевой инфекцией, они могут взять мазок из этой области и заказать лабораторный анализ.

    Лечение

    Варианты лечения будут зависеть от типа инфекции, вызванной дрожжевым грибком, а также от того, регулярно ли вы заражаетесь дрожжевым грибком.

    Молочницу можно лечить пероральными противогрибковыми препаратами. Они могут быть в форме пастилок, пилюль или жидкости для полоскания рта. Узнайте больше о оральной молочнице.

    Если вы достаточно рано заразились вагинальной дрожжевой инфекцией, вы можете вылечить ее с помощью безрецептурных препаратов. В противном случае ваш врач может назначить противогрибковые препараты в виде крема, таблеток или вагинальных суппозиториев.

    Ваш врач может также порекомендовать пробиотики, такие как Lactobacillus acidophilus . Добавки с пробиотиками содержат полезные бактерии, которые могут помочь восстановить микробный баланс вашего тела.Узнайте больше о симптомах вагинальной дрожжевой инфекции и о том, почему так важно раннее лечение.

    Онихомикоз - это распространенный тип грибковой инфекции, поражающей ногти на ногах, ногтях и ногтях ног. Он также известен как tinea unguium.

    Симптомы

    Грибок ногтей на ногах обычно начинается с небольшого светлого пятна на ногте. По мере того, как он распространяется глубже, он меняет форму и цвет ваших ногтей. Со временем из-за этого ноготь может стать более толстым и ломким.

    Общие признаки включают:

    • шелушение под ногтем
    • белые или желтые полосы под ногтем
    • шелушение или расслаивание ногтя
    • толстый или хрупкий ноготь
    • отрыв ногтевого ложа

    Диагноз

    По выяснить, есть ли у вас грибок ногтей на ногах, ваш врач, скорее всего, соскоблит кусочки пораженного ногтя. Они изучат эти соскобы под микроскопом.

    Это поможет им отличить грибковую инфекцию от других состояний, вызывающих аналогичные симптомы.

    Лечение

    На лечение инфекций ногтей могут уйти недели, а на лечение инфекций ногтей на ногах - месяцы.

    Безрецептурные препараты обычно неэффективны. Ваш врач может прописать лак для ногтей, который наносится щеткой, как лак для ногтей, или антибиотик, который вы принимаете внутрь.

    Поскольку этот тип инфекции сложно вылечить, важно избегать ее распространения. Узнайте, как защитить себя от грибковых поражений ногтей и ногтевого ложа.

    Есть несколько вещей, которые могут увеличить риск развития грибковой инфекции.К ним относятся факторы окружающей среды, а также то, что происходит в вашем теле, когда вы подвергаетесь воздействию грибка.

    Влажность и влажность

    Сильное потоотделение или работа в теплой влажной среде могут повысить риск грибковой инфекции. Для роста грибам нужна теплая и влажная среда.

    Хождение босиком во влажных местах, таких как тренажерные залы, раздевалки и душевые, также может увеличить риск. Эти общественные места часто богаты спорами грибов.

    Плохое кровообращение

    Любое заболевание, вызывающее нарушение кровообращения, может повысить риск заражения.Плохое кровообращение препятствует вашему иммунному ответу и снижает способность вашего организма бороться с инфекцией. Изучите этот список причин плохого кровообращения.

    Менопаузальный статус

    Если вы женщина в постменопаузе, гормональные изменения могут снизить кислотность влагалища. Это может сделать вас более уязвимым для вагинальных дрожжевых инфекций. Узнайте, как распознать симптомы менопаузы.

    Подавленная иммунная система

    Если ваша иммунная система не работает должным образом, она может сделать вас уязвимыми для грибковых инфекций.

    Многие вещи потенциально могут ослабить вашу иммунную систему. Например, недостаток питательных веществ, иммунодефицитные расстройства, курение и даже стресс могут нарушить вашу иммунную функцию. Узнайте больше о нарушениях иммунодефицита.

    Повреждение ногтя и кожи или инфекция

    Даже небольшое повреждение ногтя, кожи или инфекция может привести к проникновению грибков под кожу и поражению более глубоких тканей. Вот почему так важно промывать раны и закрывать их стерильной повязкой или повязкой. Узнайте, как лечить небольшие раны и предотвращать инфекции.

    Некоторые лекарства

    Некоторые виды лекарств могут снизить способность вашего организма сопротивляться грибковым инфекциям. Например, антибиотики уничтожают полезные бактерии вместе с вредными. Это может позволить грибам расти без конкуренции.

    Длительный прием кортикостероидов также может увеличить риск грибковой инфекции. Лечение рака, включая химиотерапию и лучевую терапию, также может подвергнуть вас повышенному риску.

    Если ваша иммунная система ослаблена, спросите своего врача, какие шаги вы можете предпринять, чтобы снизить риск грибковых инфекций.

    Хорошая гигиена также важна для предотвращения грибковых инфекций.

    Старайтесь:

    • Следите за тем, чтобы ваша кожа была чистой и сухой, особенно складки кожи
    • Часто мойте руки, особенно после прикосновения к животным или другим людям
    • избегайте использования чужих полотенец и других средств личной гигиены
    • носить обувь в раздевалках, общественных душевых и бассейнах
    • протирать тренажерный зал до и после его использования

    Грибковые инфекции могут быть неудобными или даже болезненными.В некоторых случаях для их эффективного лечения могут потребоваться недели или месяцы. Если вы подозреваете, что у вас грибковая инфекция, обратитесь к врачу. Они могут диагностировать тип инфекции и порекомендовать соответствующие противогрибковые препараты.

    В некоторых случаях ваш врач может также порекомендовать изменение вашего рациона или других повседневных привычек, чтобы помочь вылечить или предотвратить будущие грибковые инфекции.

    гусь парвовирус инфекция п demek гусь парвовирус инфекция türkçesi п demek İngilizce гусь парвовирус инфекция anlamı

    Бу sayfada İngilizce гусь парвовирус инфекция türkçesi nedir гусь парвовирус инфекция п demek гусь парвовирус инфекция Ile ilgili cümleler türkçe çevirisi ÉS anlamlısı синонимом гусь парвовирус инфекция hakkında bilgiler ingilizcesi Парвовирусная инфекция гуся anlamı tanımı türkçe sözlük anlamı veya kelime anlamlarını bulabilirsiniz.

    Парвовирусная инфекция гусей türkçesi Парвовирусная инфекция гусей nedir

    • Genç kazlarda в Московской обл ördeklerinde, ishal, zayıflık, konjunktivitis, fibrinli стоматит, miyokarditis, гепатит, karaciğerde YaG dejenerasyonuyla birlikte KALP kasında çekirdek ICI inklüzyonların görülmesiyle belirgin, Dört haftalıktan büyüklerde Klinik belirti vermeyen вирусной hastalık, asitesli hepatonefritis, enfeksiyöz miyokarditis, derzy hastalığı , kaz gribi, kaz hepatitisi, kaz vebası.
    • Veterinerlik alanında kullanılır.
    • Kaz parvovirüs enfeksiyonu.

    Парвовирусная инфекция гуся ingilizcede ne demek, Парвовирусная инфекция гуся nerede nasıl kullanılır?

    Гусь : Пармакламак. Kaz kafalı. Пандик атмак. Motoru yakıtla beslemek. Пармак атмак. Манкафа. Ахмак. Каз. Aptal.

    Инфекция : Бозулма. Булашма. Hastalık etkeni mikroorganizmanın vücuda girişi ve yayılışı, patojen mikroorganizmaların neden olduğu bulaşıcı veya bulaşıcı olmayan hastalık, Инфексион.Энфексион. İnfeksiyon. Bakteri, virüs, mantar ya da protozoonların bir organizationmaya girmesi. enfeksiyon yapan organizationmaların бир hücre ya da canlıda meydana getirdiği durum. Mikrop kapma. Сирайет. Bulaştırma. İltihap.

    Ингилизче Парвовирусная инфекция гуся Türkçe anlamı, Парвовирусная инфекция гуся eş anlamlısı

    Sözcükler, direkt olarak Парвовирусная инфекция гуся ile ilgili eş anlamlı kelimeler olmayabilir. Kelime anlamı benzer olan sözcükler olabilirler.

    Гепатит гусей : Kaz hepatitisi.

    Синдром A c : Arnold-chiari yapılış bozukluğu. A-c sendromu.

    Пальпация живота : Пальпация живота. Avuç içi, parmak veya yumrukla çok hafif basınç uygulayarak karın bölgesindeki değişikliklerin niteliini anlamak için yapılan muayene, пальпасьон живота. Карин bölgesinin elle muayenesi.

    Группа : izgili kas teli ışık mikroskobunda incelendiğinde görülen, kalın flamentlerle aralarına giren ince flamentlerin uçlarını içeren ve ışığı iki kantoyantizkıı, bA bandı.

    Амплитуда мод : Ультразвуковое исследование gönderilen ses dalgasının yayılımı doğrultusunda, farklı yüzeylerden yansıyan ses dalgalarının, yansımanın şiddetine göremesiliör çizgis. özellikle gözde biyometrik ölçümlerde kullanılır. A-mod görüntü.

    Инфекционный миокардит : Enfeksiyöz miyokarditis.

    Болезнь Дерзиса : Derzyhastalığı.

    Деформация AC : Arnold-chiari yapılış bozukluğu.A-c kusuru.

    Некроз абдоминального жира : Karın içi ya nekrozu. Karın Yağı nekrozu.

    Бойня : Мезбаха. Hayvanların etleri için kesildikleri yerler, hlk. экди. Кесимеви. Салхан.

    Синонимы парвовирусной инфекции гуся : вздутие живота, глина, асцитический гепатонефрит, гусиная чума, абаксиальный, крохордон, абдоминальная овариэктомия, абдоминальная боль, абамектин, брюшная полость, днк.

    Инфекции мочевыводящих путей - AMBOSS

    Последнее обновление: 29 октября 2020 г.

    Резюме

    Инфекции мочевыводящих путей (ИМП) - это инфекции мочевыводящей системы (мочевого пузыря, уретры, почек), которые обычно вызываются бактериями, особенно E.coli. Женщины подвержены высокому риску заражения ИМП из-за более короткой уретры и близости анальной и генитальной областей. Другие факторы риска включают половой акт, постоянные мочевые катетеры, беременность и аномалии мочевыводящих путей. Клинические данные зависят от того, какая часть мочевыводящих путей поражена. ИМП нижних отделов мочеиспускания проявляются дизурией, надлобковой болью, позывами к мочеиспусканию и учащением мочеиспускания, тогда как ИМП верхних отделов дополнительно проявляются лихорадкой и болью в боку. Диагноз обычно ставится на основании клинических данных и может быть подтвержден обнаружением пиурии, бактериурии и положительных результатов анализа мочи на лейкоцитарную эстеразу и нитриты.Пациентам с осложненным циститом может потребоваться дальнейшая оценка с помощью посева мочи и / или визуализации. Лечение также зависит от того, какая часть мочевыводящих путей поражена. Эмпирическая антибактериальная терапия первой линии при неосложненных ИМП включает амбулаторную терапию пероральным триметоприм-сульфаметоксазолом, нитрофурантоином или фосфомицином на срок до 7 дней. При осложненных ИМП антибактериальную терапию следует продлить на 7–14 дней. Беременных женщин с циститом следует обследовать и лечить при положительном результате бессимптомной бактериурии.

    Этиология

    Патогены

    Бактерии

    Вирусы

    Другие патогены

    Предрасполагающие факторы

    Факторы, зависимые от хозяина

    • Структурные или функциональные аномалии мочевыводящих путей [4]
      • Предотвратить опорожнение мочевого пузыря и / или привести к застою мочи
      • Примеры включают:
    • Секс
      • Женщины: женщины имеют анатомическую предрасположенность, поскольку их уретра короче, а анальная и генитальная области находятся в непосредственной близости → бактерии распространяются из анальной области → колонизация влагалища → восходящие ИМП [5]
      • Мужчины: более высокий риск у необрезанных младенцев мужского пола [6]
    • Беременность: гормональные изменения во время беременности → застой мочи и пузырно-мочеточниковый рефлюкс → повышенный риск ИМП
    • Постменопауза: ↓ эстроген → ↓ вагинальные лактобациллы → ↑ вагинальный pH → ↑ колонизация E.coli [5]
    • Хронический запор: частая причина ИМП у детей
    • Предыдущие условия

    Прочие факторы

    • Половой акт
      • Цистит медового месяца; : тип нижних инфекций мочевых путей, возникающий у женщин после первого полового акта или после длительного периода воздержания.
      • Использование диафрагмы и спермицидов
    • Катетер-ассоциированная инфекция мочевыводящих путей (CAUTI)

    SEEK PP = S - S.saprophyticus, E - E. coli, E - Enterococcus, K - Klebsiella, P - Proteus, P - Pseudomonas - это бактерии, обычно связанные с ИМП.

    Классификация

    В соответствии с анатомическим расположением [7] [8]

    В соответствии с предрасполагающими факторами [9] [10] [11]

    • Неосложненная ИМВП: ИМП в пременопаузы , небеременные женщины без состояний, предрасполагающих к инфекции или неудачи терапии
    • Осложненные ИМП: ИМП у мужчин, беременных или женщин в постменопаузе, детей и лиц с факторами, предрасполагающими их к инфекции или неудаче терапии.К таким факторам относятся:
      • Наличие каких-либо значительных функциональных или анатомических аномалий (например, аденомы простаты, непроходимости, стриктуры)
      • ИМП, распространяющиеся за пределы мочевого пузыря (например, сепсис, простатит)
      • История урологических патологий (например, нейрогенный мочевой пузырь, кисты почек, камни)
      • История нарушения функции почек или трансплантации почки
      • Сахарный диабет или другие нарушения обмена веществ
      • Нарушение иммунитета (например, у реципиентов трансплантата, ВИЧ / СПИД)
      • Недавняя история инструментовки (например,ж., цистоскопия) или установка медицинских устройств (например, мочевого катетера, нефростомических трубок, стентов)
      • Инфекция устойчивым уропатогеном или недавнее использование антибиотиков
      • История ИМП в детстве или по крайней мере один эпизод пиелонефрита за последний год

    По источнику заражения

    • Внебольничные: ИМП, приобретенные вне больницы, проявляются в течение 48 часов после поступления в больницу. [12]
    • Связанные со здоровьем (нозокомиальные) ИМП
    • Рецидивирующие ИМП: ≥ 3 инфекций в течение одного года или ≥ 2 инфекций в течение 6 месяцев

    Клинические признаки

    Поскольку лихорадка обычно отсутствует в нижних отделах ИМП, наличие лихорадки и боли в боках воспринимается как признак более серьезной инфекции, т.е.г., пиелонефрит.

    Диагностика

    Подход

    Лабораторные исследования [14] [17]

    Анализ мочи

    • Обзор
      • Лучший начальный тест
      • Лица с предрасполагающими факторами имеют повышенный риск инфекции или неудачи терапии (см. «Осложненные ИМП» в «Классификации»).
    • Метод сбора анализа мочи
      • Промежуточный образец чистого улова: необходим для предотвращения заражения влагалищной или кожной флорой
      • Прямая катетеризация мочевого пузыря или надлобковая аспирация: выполняется, если невозможно получить чистый улов без контаминации (например,g., у детей, не приученных к туалету)
      • Катетеризация уретры противопоказана из-за повышенного риска бактериемии.
    • Диагностические критерии ИМП
    • Результаты, указывающие на ИМП [18]
    • Другие результаты

    Посев мочи

    • Диагностические критерии ИМП
      • Значительная бактериурия: ≥ 10 5 КОЕ / мл; подтверждает диагноз
      • Наличие каких-либо микроорганизмов в образце мочи, полученном при надлобковой аспирации мочевого пузыря, подтверждает диагноз.
    • Показания
    • Типичные результаты колоний
    • Другие патогены

    Диагностическая визуализация

    Дифференциальный диагноз

    • Описание: хронический неинфекционный цистит неизвестной этиологии, связанный с повторяющейся надлобковой болью.
    • Эпидемиология [20]
      • Необычное состояние (0,6–2% женщин в США) [19]
      • Пол: ♀> ♂
      • Максимальный возраст: ≥ 40 лет
      • Связано с историей предыдущих ИМП и / или диагнозом других болевых синдромов (например,g., фибромиалгия, синдром раздраженного кишечника)
      • Лица, у которых диагностировано это состояние, с большей вероятностью страдают депрессией и тревожными расстройствами. [21] [22] [23]
    • Клинические особенности
      • Симптомы появляются постепенно и длятся ≥ 6 недель (требуется для постановки диагноза).
      • Боль облегчается при мочеиспускании и усиливается при наполнении мочевого пузыря (наиболее частая особенность)
      • Надлобковая боль, давление или дискомфорт [24]
      • Повышенные позывы к мочеиспусканию и учащенное мочеиспускание
      • Другие обостряющие факторы: половой акт, упражнения, употребление алкоголя и длительное сидение
    • Диагноз: Интерстициальный цистит, как правило, является клиническим диагнозом.
    • Лечение
      • Модификация поведения (первая линия): показана для всех диагностированных лиц [25]
        • Избегание триггеров (например, стресс, алкоголь, кофе)
        • Управление потреблением жидкости на основе симптомов
        • Тренировка мочевого пузыря
        • Практика управления стрессом
      • Мультимодальное обезболивание
      • Инвазивные процедуры: используется в крайнем случае

    Бессимптомная бактериурия [26] [27]

      Описание
      • Наличие ≥ 100 000 КОЕ / мл как минимум в двух образцах мочи после мочеиспускания у пациентов без симптомов ИМП; (е.g., дизурия, частота, позывы, надлобковая боль)
      • Бактериурия обычно проходит спонтанно у здоровых небеременных женщин без каких-либо побочных эффектов.
      • У женщин с бессимптомной бактериурией в будущем может развиться симптоматическая ИМП; чем женщины без бактериурии.
    • Эпидемиология
      • Распространенность
        • Встречается у 1–5% здоровых женщин в пременопаузе и у 2–10% беременных
        • Встречается у 9–25% пожилых людей и лиц с диабетом, постоянными катетерами или травмами спинного мозга
    • Этиология: E.coli - наиболее распространенный возбудитель.
    • Факторы риска
    • Диагноз: общий анализ мочи под микроскопом
      • Образец мочи в середине потока: рост бактерий ≥ 100000 КОЕ / мл в двух последовательных образцах у женщин или в одном образце у мужчин
      • Образец катетеризованной мочи: рост бактерий ≥ 100000 КОЕ / мл с одним видом бактерий, выделенным у женщин или мужчин
    • Ведение
      • Лечение рекомендовано:
      • Лечение не рекомендуется:
        • Здоровые небеременные женщины
        • Пожилые люди и люди с диабетом, постоянными катетерами или травмами спинного мозга

    Другие дифференциальные диагнозы

  • Вагинит
  • Воспалительные заболевания органов малого таза (ВЗОМТ)
  • Простатит [29]
  • Уретрит при инфекциях, передающихся половым путем (например,g., Neisseria gonorrhoeae, Chlamydia trachomatis), Candida или раздражители
  • Туберкулезный цистит (см. «Урогенитальный туберкулез»)
  • Цистит, индуцированный лекарствами (например, циклофосфамид, НПВП) или радиационный цистит
  • Геморрагический цистит
  • Травма
  • Структурные аномалии уретры (например, дивертикулы, стриктуры)
  • Другие заболевания мочевого пузыря (например, мочекаменная болезнь, рак мочевого пузыря, инородные предметы)

Перечисленные здесь дифференциальные диагнозы не являются исчерпывающими .

Лечение

Антибактериальная терапия неосложненных ИМП

Принципы терапии [14] [30]

Лечение острых неосложненных ИМП нижних отделов полости рта

  • Лечение первой линии [32]

ВОЗ | Вспышки болезней

  • Глобальный
  • Регионы Региональные веб-сайты ВОЗ
    • Африка
    • Америка
    • Юго-Восточная Азия
    • Европа
    • Восточное Средиземноморье
    • Западная часть Тихого океана
.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *