Кск что такое в гинекологии: Кольпоскопия шейки матки — подготовка и проведение процедуры в медицинском центре «Мать и Дитя»

Содержание

диагностика, лечение, выгодные цены, опытные врачи!

Кольпоскопия в гинекологии — это специальный метод исследования слизистой влагалища и шейки матки при помощи современного оптического прибора в условиях дополнительного освещения. Чаще всего используется в гинекологии для лечения эрозии шейки матки.

Наш медицинский центр проводит эту диагностическую процедуру по показаниям, с целью диагностики разных патологий влагалища и шейки матки, а также в процессе лечение при оценке динамики течения заболевания. Кольпоскопия в гинекологии используется в комплексной диагностике следующих заболеваний:

  • Цервицит (воспаление шейки матки)
  • Генитальные бородавки и кондиломы
  • Предраковые изменения тканей вульвы
  • Предраковые изменения тканей влагалища
  • Рак шейки матки
  • Рак влагалища
  • Рак вульвы

Кольпоскопия позволяет:

  • Оценить состояние слизистой шейки матки и влагалища
  • Диагностировать доброкачественные и злокачественные изменения в тканях
  • Выявить очаги поражения
  • Провести прицельное взятие мазков и биопсии

В каких случаях необходима кольпоскопия

Симптомы, при которых назначается кольпоскопия гинекологом (на консультации) следующие:

  • Кровотечения, не связанные с месячными,
  • Зуд и выделения из влагалища (в составе комплексной диагностики),
  • Боль и кровянистые выделения во время полового акта и после него,
  • Длительные «тянущие» боли внизу живота.

ОБЯЗАТЕЛЬНО кольпоскопия проводится в двух случаях:

  • Обнаружение остроконечных кондилом на половых органах (прочитайте статью про удаление кондилом)
  • Плохие результаты мазка на онкоцитологию

Как подготовиться к кольпоскопии

Лучше проводить обследование в первую фазу цикла (в первые 5-7 дней после окончания менструации). Если гинеколог кольпоскопию назначил на определенный день, постарайтесь подготовиться заранее. Выполните несколько несложных правил:

  • За 1-2 дня до обследования воздержитесь от половых актов
  • Не используйте накануне лекарств, заранее не оговоренных врачом
  • Не проводите спринцеваний
  • Не используйте никакие средства интимной гигиены
  • Не используйте вагинальные свечи, если они не были накануне обследования назначены врачом

Как проводится кольпоскопия

Диагностическая кольпоскопия в гинекологии может проводиться как в амбулаторных условиях, так и в условиях стационара без какой-либо специальной подготовки.

Пациентка располагается на гинекологическом кресле, с помощью гинекологических инструментов обнажается шейка матки и врач осматривает ее и стенки влагалища при помощи кольпоскопа, установленного рядом с креслом.

Одно из основных направлений, которым занимается наша гинекология — это лечение эрозии шейки матки, поэтому мы проводим подробную диагностику. Простая кольпоскопия дополняется расширенной, когда шейка матки осматривается после обработки ее 3% раствором уксусной кислоты. Это абсолютно безболезненно для пациентки, и дает возможность наиболее четко выявить патологические изменения и охарактеризовать вид эпителия шейки матки (цилиндрический, многослойный, плоский), а также оценить состояние сосудов.

После этого проводится обработка шейки матки раствором люголя, также не причиняющая никакого дискомфорта или болезненных ощущений — люголь окрашивает здоровый эпителий в темно-коричневый цвет, а патологически измененные клетки остаются неокрашенными, приобретая вид белесоватых пятен.

Видеокольпоскопия

Данная разновидность исследования отличается тем, что при его проведении изображение, которое видит врач-гениколог, выводится на экран в режиме реального времени. Патологические изменения могут быть наглядно продемонстрированы: кондиломы на стенках влагалища и наружных половых органах, полипы, эрозия шейки матки и т. д.

Диагностика

Вы можете записаться к нам без очередей, в удобный для Вас день. По Вашему желанию после исследования врач-гинеколог подробно проконсультирует Вас по любому вопросу, который Вас беспокоит. Если Вам нужна недорогая гинекология, лечение эрозии шейки матки, УЗИ или кольпоскопия — приходите, мы Вам поможем!

Цены на кольпоскопию

Кольпоскопия2000
Взятие мазков без консультации800
Гирудотерапия1500
Обработка влагалища
1300
Обработка влагалища + тампон/свечка1600
Пайпель-биопсия эндометрия5500

* Указанные на сайте цены не являются публичной офертой. Определить точную стоимость лечения возможно только на приеме у врача. Цены на услуги ведущих специалистов клиники могут отличаться от цен, указанных на сайте.

Прайс на все услуги медицинского центра «Лиана» представлен в разделе Цены


Что показывает кольпоскопия? — DocDoc.ru

Женщинам важно знать, что такое кольпоскопия шейки матки, ведь это неотъемлемая процедура в гинекологии. Диагностика проводится с помощью прибора кольпоскопа, оснащенного лампой и линзой, которая увеличивает в 30 раз.

Что показывает кольпоскопия шейки матки и для чего она нужна?

Такая процедура обследования выявляет изменения в клетках эпителия шеечного канала, указывающие на воспалительные патологии, предраковые состояния, доброкачественные и злокачественные опухоли. Кольпоскопия бывает простая и расширенная, обе процедуры проводятся на приеме у гинеколога и занимают не более 20 минут. Простой кольпоскопии достаточно чтобы оценить состояние слизистой, выделения из цервикального канала и увидеть границу между плоским и цилиндрическим эпителием, которая называется зоной трансформации.

В расширенную диагностику кроме осмотра входят несколько тестов с применением уксуса и йода. В некоторых случаях врач сразу берет биопсию для цитологического и гистологического исследования в лаборатории.

Протокол о проведенном исследовании выдается пациентке на руки, в связи с медицинской безграмотностью у женщин возникает много вопросов и опасений. Например, насколько опасно и что это значит, если написано, что атипическая зона трансформации неадекватная или неудовлетворительная, так как стык не виден. В данном случае речь идет о плохой визуализации зоны трансформации или наличии атипичных сосудов. Изучению переходной области уделяется особенное внимание, выделяют три зоны трансформации.

  • Патология 1-го типа находится на шейке матки и допустима для беременных.
  • Трансформация 2-го типа локализуется в цервикальном канале что для рожавших женщин в пределах нормы.
  • Бывают случаи, когда область границ эпителия вообще не удается обнаружить с помощью кольпоскопии, вот что значит зона трансформации 3-го типа. Трансформация третьего типа считается нормальной в период менопаузы.

Еще один популярный вопрос интересует женщин: показывает ли тест уксусной кислотой вирус папилломы человека. При обработке тканей уксусной кислотой в норме эпителий ненадолго белеет в зоне трансформации. Ацетобелый эпителий может указывать на вирус папилломы человека или на дисплазию или быть вариантом допустимой нормы. В зависимости от расположения белесых зон врач решает есть ли необходимость взять биопсию для уточнения диагноза. Кроме этого вызванный уксусом спазм сосудов показывает состояние кровеносных сосудов. Следующий тест на выявление пораженных клеток делают йодным раствором. Здоровые ткани равномерно окрашиваются йодом, патологические не реагируют на контрастное вещество. Такие очаги называются йод-негативная зона и требуют дополнительной диагностики. Йоднегативная зона при кольпоскопии не всегда означает онкологический диагноз, очаги могут указывать на воспалительную патологию. Мозаичный рисунок может указывать на онкологию, цервицит, дисплазию.

В любом случае нельзя сказать наверняка что если кольпоскопия нормальная, то рака нет. Окончательное заключение врач сделает после получения гистологических результатов биопсии.

Кольпоскопия выявляет следующие болезни:

  • эрозия, эктопия;
  • эритроплакия;
  • полипы;
  • предраковые состояния;
  • цервицит;
  • уточнение диагноза дисплазии или рака шейки;
  • эндометриоз;
  • кондиломы.

Процедуру делают не только для постановки диагноза, но и перед ЭКО, перед операцией по удалению миомы и другими.

Если вас беспокоит какая-то проблема со здоровьем, запишитесь на диагностику. Успех лечения зависит от правильно поставленного диагноза.

Показания для назначения диагностики:

  • дифференциальная диагностика характера клеточных изменений;
  • результат цитологии, в котором обнаружены атипичные клетки;
  • плановый скрининг при наступлении климакса;
  • изменения слизистой, которые врач увидел при осмотре;
  • выделения и тянущие боли у беременных женщин, указывающие на низкое расположение плаценты;
  • длительные мажущие выделения из влагалища;
  • при выявлении вируса папилломы человека обследование делают ежегодно.

Подготовка

При записи администратор клиники расскажет, как подготовиться к процедуре. Готовиться к исследованию начинают за два дня. Подготовка к кольпоскопии шейки матки предполагает отказ от половых контактов, а также от использования вагинальных средств и спринцеваний. Гигиенические процедуры проводятся исключительно водой без мыльных средств.

Преимущества диагностики:

  • проходит безболезненно для пациентки;
  • занимает 10-20 минут;
  • проводится амбулаторно;
  • информативно.

Данная статья размещена исключительно в познавательных целях, не заменяет приема у врача и не может быть использована для самодиагностики.

10 декабря 2019

Кольпоскопия – что это за операция и как к ней подготовиться :: Первая гинекологическая клиника в Красноярске, женская гинекология

Опубликовано 21. 06.2019

Рак шейки матки — основная причина смертности женщин в возрасте от 30 до 35 лет. При этом женщина зачастую не может самостоятельно обнаружить патологию, испытывая незначительные жалобы.

Шейка матки имеет особое анатомическое строение. Она устроена таким образом, что гинеколог может увидеть только грубые изменения шейки матки, которые, как правило, являются показателем запущенного процесса. Более детально рассмотреть шейку матки на предмет патологии возможно только под большим увеличением, которое, как раз, и обеспечивает прибор под названием кольпоскоп.

Что такое кольпоскопия

Эта диагностический метод исследования слизистой вульвы, влагалища и шейки матки с помощью специального оптического прибора – кольпоскопа. Процедура является современным, безболезненным и низко затратным методом диагностики шейки матки. При выявлении патологий женской половой системы без кольпоскопии порой не обойтись.

Кольпоскопия позволяет выявить злокачественные, предраковые и доброкачественные патологии шейки матки. При этом при кольпоскопии гинеколог может дополнительно взять соскоб на цитологический анализ, если во время осмотра возникли подозрения или женщина находится в группе риска по возникновению раковых заболеваний.

Многие девушки, у которых есть эрозия шейки матки без напоминаний обращаются к гинекологу и проходят необходимое обследование. Так же о своем здоровье должна заботится каждая девушка, даже при отсутствии патологии, не реже 1раза в год.

Кольпоскопия позволяет увидеть незначительные изменения шейки матки, даже когда на первый взгляд она выглядит абсолютно здоровой. Окрашивание различными красителями помогает выявлять те патологические изменения, которые невозможно рассмотреть при визуальном осмотре шейки матки доктором.

Особенности кольпоскопии

Эта процедура абсолютна безболезненна, напоминает осмотр на кресле, возможно появление небольших неприятных ощущений, которые быстро проходят.

Пациент ложится на гинекологическое кресло, далее с помощью гинекологического зеркала обнажается шейки матки и к необходимой зоне обследования на расстоянии около 30см подводят кольпоскоп. Он представляет собой микроскоп, который подсоединен к экрану. На экране врач видит структурные и анатомические части шейки матки в высоком разрешении. Увеличенное изображение высокого качества позволяет отличить патологию от нормы.

Проведение процедуры возможна в любой день менструального цикла. Период проведения исследования индивидуален и зависит от длительности менструального цикла, но в некоторых случаях и по рекомендации врача рекомендуется проходить процедуру до 10 дня менструального цикла. Проведение кольпоскопии во время менструации невозможно.

При осмотре врач увидит нормальное состояние шейки матки или измененное. Некоторые виды «эрозии» относятся к норме, они требуют регулярного обследования и не нуждаются в «прижигании». При выявлении патологических процессов гинеколог назначает взятие биопсии или анализы на бактериальные и вирусные инфекции.

Зачем проводят кольпоскопию

Чтобы быстро выявить раковые и предраковые заболевания. Пациентке сначала делают пробу по Папаниколау. При выявлении атипичных клеток при цитоморфологическом исследовании мазков назначается биопсия шейки матки.

Если пациентка проходит лечение доброкачественных изменений со стороны шейки матки, вульвы или влагалища, врач назначает кольпоскопию в динамике для контроля эффективности этого лечения.

Как подготовиться к процедуре

Для данной процедуры нет необходимости менять рацион питания, специально брать отпуск или выходные. Т.е. никакой специальной подготовки не требуется. Главное — тщательно следить за гигиеной влагалища и не применять вагинальные средства за 3-4 дня до процедуры.

В течение двух дней до начала исследования разрешается половой акт только в презервативе. Также не рекомендуется использование вагинальных свечей, таблеток, антибактериальных и противогрибковых препаратов, любых медикаментов местного применения. Исключите спринцевание за двое суток до посещения врача.

Процедуру не назначают девушкам без опыта половой жизни, за исключением серьезных показаний и видимых отклонений в стационарном обследовании.

Не стоит бояться данного обследования, так как оно полностью безболезненно и не вызывает осложнений. Напротив, всего 15 минут в кабинете врача могут спасти вашу жизнь. Раковые изменения на ранних стадиях порой невозможно отличить от нормы при обычном гинекологическом осмотре.

Совместно с проведением кольпоскопии врач должен назначить исследование мазков.

Проводят ли кольпоскопию беременным

Гинекологи советуют проводить данное обследование до зачатия ребенка. Если показания к исследованию выявлены во время беременности, это может означать, что зачатие наступило на фоне развивающегося заболевания. Хотя это не всегда подтверждается.

Это безопасная процедура, если соблюдать главные правила этого обследования при беременности:

  • Не проводить его на ранних сроках, так как велик риск самопроизвольного аборта;
  • Биопсия берется в обязательном порядке при подозрении на злокачественные опухоли;
  • Не стоит пугаться сукровичных выделений в течение 5 суток после посещения доктора, при этом они должны быть скудными и не причинять сильную боль.

Кольпоскопия во время беременности не только выявляет раковые и предраковые состояния, но и помогает контролировать ход заболевания, так как не все методы лечения разрешены при беременности.

В течение нескольких дней после процедуры пациентка получает результаты. Лечащий врач прописывает вагинальные свечи и другие лекарственные средства, которые разрешены во время беременности. При небольших отклонениях врач не назначает медикаментозных препаратов — только регулярное наблюдение. После родов назначается повторное обследование.

Какие действия необходимы после процедуры

В течение нескольких дней после обследования возможны небольшие выделения, рекомендуется применять ежедневные средства гигиены. В остальном, женщине нет необходимости изменять привычный образ жизни, питание или отказываться от спорта.

Если брали биопсию… 14 суток после

  • Нельзя принимать препараты, в составе которых есть ацетилсалициловая кислота;
  • Нельзя делать спринцевания, принимать ванны, посещать сауны и бани;
  • Откажитесь на время от тампонов.
  • Ограничьте половую жизнь.

При появлении температуры и других нетипичных симптомов, обратитесь к врачу.

При частых аллергических реакциях, следует проверить реакцию организма на раствор уксуса и раствор Люголя. Иногда наблюдается аллергическая реакция, а также цервицит и вагинит.

В наше время различные патологии шейки матки считаются одним из самых распространенных недугов женской половой системы. Из ряда онкологических заболеваний раковые и предраковые состояния шейки матки уступают лишь раку молочной железы.

Кольпоскопия помогает на ранних стадиях выявить патологию и быстро решить проблему. Важно регулярно проходить осмотр гинеколога даже без видимых жалоб. При отклонении мазков по Папаниколау врач назначает биопсию, которая диагностирует проблему на любых стадиях.

Важный совет при проведении кольпоскопии — правильно подбирайте гинекологическую клинику или отделение, читайте отзывы о врачах, узнавайте мнение знакомых.

Имеются противопоказания, необходима консультация специалиста

Список статей

Что такое кольпоскопия, и для чего она нужна?

Что такое кольпоскопия?

Кольпоскопия представляет собой высокоинформативный, широкодоступный и недорогой метод диагностики заболеваний шейки матки и влагалища, без которого сегодня невозможно представить обследование женщин с гинекологической патологией. Кольпоскопия является одним из ведущих методов обследования, позволяющим подобрать оптимальные способы лечения и контролировать состояние эпителия шейки матки и влагалища в различные физиологические периоды жизни женщины, избавить ее от порой ненужных лечебных процедур.

 Зачем женщине необходимо делать кольпоскопию?

Именно кольпоскопия позволяет заподозрить возникновение  злокачественного заболевания на ранних стадиях развития и определить локализацию образования, когда его еще не видно невооруженным глазом. Она помогает правильно определить участок для прицельной биопсии и забора материала для цитологического мазка.

Цитологический  метод  диагностики и профилактики злокачественных заболеваний шейки матки дает возможность оценить структуру и клеточный уровень повреждения тканей, попадающих в мазок-отпечаток.

 Какие противопоказания есть у процедуры?

Кольпоскопия является неинвазивным безопасным методом обследования, не имеющим противопоказаний.

 Это болезненная процедура? Как проходит?

Простая кольпоскопия представляет собой осмотр поверхности шейки матки и влагалища с помощью кольпоскопа при стандартном увеличении в 8-40 раз без использования медикаментозных средств.

Расширенная кольпоскопия – осмотр эпителия с применением различных эпителиальных и сосудистых тестов, при которых оценивается реакция тканей в ответ на обработку медикаментозными составами.

 С чем в комплексе желательно проходить кольпоскопию?

Использование кольпоскопии и цитологического исследования дает результаты значительно лучше при профилактических осмотрах женщин. Использование кольпоскопии вносит большой вклад в профилактику гинекологической патологии.

В результате объемных исследований, подтвержденных гистологическим методом при патологии шейки матки, правильная диагностика цитологическим методом была подтверждена в 75,6 % случаев, а при расширенной кольпоскопии правильный диагноз установлен у 86,8 % пациенток. При сочетании этих двух методов достоверность диагностики повышается до 96,5 %.

 ИНТЕРЕСНЫЙ ФАКТ:

На 43-м заседании Общества по акушерству и гинекологии были сделаны следующие выводы:

—  Кольпоскопию необходимо применять при каждом углубленном гинекологическом обследовании.

—  Кольпоскопию необходимо проводить наряду со взятием мазка по Папаниколау, что дает оптимальный  результат.

С заботой о Вас,

Врач УЗД, Акушер-гинеколог-эндокринолог

Елена Анатольевна Самотаева.

Как готовиться к приему у врача-гинеколога? – статьи о здоровье

Оглавление

Женское здоровье нуждается в постоянном наблюдении. Обращаться к врачу представительницам прекрасного пола следует не только при наличии симптомов различных патологических процессов и заболеваний, но и с целью профилактических осмотров. Консультация гинеколога является обязательной хотя бы раз в год!

Только опытный специалист может обнаружить как явные, так и скрытые патологии. Врач-гинеколог способен выявить любое заболевание на начальных стадиях, когда оно еще не представляет угрозы для женского здоровья.

Клиники акушерства и гинекологии в СПб сегодня активно применяют как традиционные, так и современные методы диагностики и лечения всех патологий (в том числе раковых и предраковых состояний матки, шейки матки, молочных желез и яичников). Специалисты успешно решают задачи, связанные с планированием беременности, зачатием, вынашиванием и рождением ребенка.

Особое внимание уделяется и операциям по гинекологии, которые проводятся в СПб и других городах. Своевременно проведенные вмешательства позволяют сохранить здоровье и способность женщины стать матерью.

Всем известно, что для некоторых женщин прием у врача-гинеколога – не самая приятная процедура. Поэтому подготовка к нему нередко затягивается или вообще откладывается. Но следует понимать, что так вы только усугубляете состояние своего здоровья и подвергаетесь неоправданным рискам.

Рассмотрим все аспекты приема у врача-гинеколога, чтобы вы могли убедиться в том, что он действительно важен и не является неприятным, если правильно выбрать клинику и специалиста.

Кому нужна консультация?

Медцентры с отделениями гинекологии сегодня работают во многих городах. Записаться на прием к врачу не составляет труда. Причем пациентка всегда может выбрать удобное для нее время консультации. Если женщину ничего не беспокоит, посещать врача следует 1 раз в год. При наличии в анамнезе различных гинекологических заболеваний консультации назначаются чаще. Обычно они включают и полное обследование.

Как можно скорее следует попасть на прием к гинекологу при следующих симптомах заболеваний:

  • Покраснениях и высыпаниях на слизистой оболочке наружных половых органов
  • Зуде и жжении
  • Болях в нижней части живота
  • Нестандартных выделениях и неприятном запахе из влагалища
  • Нерегулярном менструальном цикле, задержках месячных
  • Межменструальных кровянистых выделениях

Также женщине следует посетить врача, если она хочет подобрать максимально надежный способ контрацепции или планирует беременность.

Как подготовиться к приему?

Подготовка к приему в любой из клиник акушерства и гинекологии в СПб не представляет собой никакой проблемы. Она проста и понятна многим женщинам.

  • За сутки до посещения врача следует отказаться от половых контактов
  • Вечером накануне приема следует принять душ
  • На консультацию следует надеть удобную одежду, которую можно легко и быстро снять для проведения осмотра
  • Волосы с лобка сбривать не обязательно, так как осмотру они не мешают

На прием следует взять с собой менструальный календарь (особенно важно это в случае, если у вас постоянно возникают сбои цикла).

Осмотр

Первичная консультация включает:

  • Изучение жалоб пациентки и сбор анамнеза. Гинеколог узнает, беспокоит ли что-то женщину, когда у нее была последняя менструация, уточняет течение предыдущих беременностей (если они были). Также определяются перенесенные заболевания, уточняются все их симптомы, особенности лечения. Врач узнает и генетическую предрасположенность пациентки к различным патологиям
  • Осмотр. Проводится на гинекологическом кресле с помощью специального зеркала. Во время осмотра берутся мазки для проведения общего и цитологического анализов. Врач изучает и состояние молочных желез. Во время осмотра женщина не испытывает выраженного дискомфорта. Все действия врач осуществляет максимально тактично и аккуратно
  • Назначение дополнительного обследования. Оно требуется для подтверждения или исключения беременности (если это необходимо) и выявления заболеваний
  • Выдачу направлений к другим узким специалистам. Если в ходе приема подтверждается беременность, пациентка обязательно отправляется к целому ряду специалистов. Каждый из них дает заключение о состоянии здоровья женщины, ее готовности к вынашиванию плода. Некоторым женщинам (с хроническими заболеваниями или подозрениями на некоторые патологии) требуется осмотр у эндокринолога, кардиолога и других врачей
  • Какие анализы берет врач при осмотре?

    Цитологический мазок

    Такой анализ позволяет выявить опухолевые и предопухолевые изменения. Выполняется мазок путем соскоба с цервикального канала и поверхности шейки матки. Цитологическое исследование обязательно к проведению 1 раз в год.

    Мазок на флору

    Данное исследование позволяет определить микрофлору влагалища (микробный состав). Диагностика направлена на обнаружение воспалительного процесса и определение возбудителя патологического состояния.

    КПИ

    Такие мазки позволяют определить гормональную функцию эпителия влагалища. Исследование проводится женщинам репродуктивного возраста и во время климакса. Диагностика направлена на определение функции яичников и степени гормональной недостаточности.

    При подозрении на беременность, а также гормональные и воспалительные патологии гинеколог может направить пациентку на сдачу анализов крови и мочи.

    Дополнительно проводится и комплексное обследование, включающее:

    • УЗИ
    • Кольпоскопию
    • Зондирование матки
    • Гистероскопию
    • Лапароскопию
    • Компьютерную и магнитно-резонансную томографию
    • Биопсию

    Некоторые клиники гинекологии в СПб отличаются полноценным оснащением смотровых кабинетов. Благодаря этому большую часть из назначаемых обследований врач может провести сразу же (УЗИ, зондирование матки, кольпоскопию). Благодаря этому женщина экономит время и одновременно получает полный комплекс медицинских услуг.

    Как записаться к врачу?

    Записываться к врачу-гинекологу лучше заранее. Это позволит гарантированно получить консультацию в удобное для вас время.

    Чтобы записаться в клинику МЕДСИ, достаточно позвонить по номеру +7 (812) 336-33-33. Наш специалист озвучит стоимость услуг по профилю гинекология и ответит на все возникшие вопросы.

    Преимущества обращения к гинекологу в МЕДСИ

    • Опытные врачи-гинекологи. Наши специалисты постоянно повышают квалификацию, что дает им возможности для эффективного лечения различных патологий даже в запущенных стадиях
    • Новейшие методы диагностики. В МЕДСИ проводятся УЗИ экспертного класса, видеокольпоскопия, жидкостная цитология и другие исследования. Все они позволяют на ранних стадиях выявить огромный перечень заболеваний
    • Уникальные методы лечения (в том числе без операций). В клинике проводятся терапия широкого спектра патологий, лазерное лечение заболеваний шейки матки, лапароскопия миомы, удаление новообразований половых органов и др.
    • Возможность получения направлений на консервативное или оперативное лечение по полису ОМС в московские клиники
    • Комфортные осмотры и индивидуальный подход. Мы всегда внимательно относимся к каждой пациентке, благодаря чему на приеме вы сможете полностью расслабиться и довериться специалисту

    Не откладывайте посещение врача на потом, даже если вас ничего не беспокоит! Уточняйте цену услуг в нашей клинике в СПб, другие условия приема и записывайтесь к нашим специалистам в сфере гинекологии.

Гистологические исследование матки и эндометрия — биопсия с гистологическим исследованием

Гистологический анализ широко применяется для диагностики онкологических заболеваний. Он дает высокоточную информацию о типе клеток взятого материала. Такой метод обследования основывается на изучении тканей, полученных в результате различных процедур: биопсии, среза, пункции, мазка.

Что диагностируют с помощью гистологического анализа

Гистологический анализ призван помочь в диагностике:

  • злокачественных, доброкачественных опухолей – это основное его назначение;
  • причин женского бесплодия;
  • заболеваний ЖКТ воспалительного характера;
  • оценки характера патологического процесса – воспалительного, дегенеративного, предракового;
  • аутоиммунных, инфекционных заболеваний;
  • заболеваний спинного, головного мозга.

Кроме того, такой метод обследования актуален в рамках пренатальной диагностики. Он позволяет своевременно уточнить состояние здоровья плода и подтвердить/опровергнуть предположение о наличии внутриутробной патологии.

Значение анализа в гинекологии

Гистологическое исследование биопсийного материала имеет особое значение в гинекологии. Оно не только позволяет изучить ткани шейки и тела матки, но и дает возможность получить точную информацию о состоянии будущего малыша.

Этот диагностический метод в обязательном порядке применяется после выкидыша или прерывания замершей беременности. Это позволяет выявить причины патологии и принять меры для профилактики в будущем.

Кроме того, гистологию проводят женщинам, страдающим от увеличения периода менструации, обильных выделений, болях в пояснице и внизу живота. При подозрениях на заболевания воспалительного характера, опухоли, кондиломы, дисплазии и ряд других заболеваний такой анализ также является неотъемлемой частью диагностических мероприятий. Гистологию яичниковой ткани проводят для определения типа опухолей.

Как выполняется анализ

В связи с тем широким перечнем заболеваний, в диагностике которых может помочь гистологическое исследование, забор тканей проводится разными способами.

Биопсия с гистологическим исследованием – основной способ получения материала. Она может осуществляться в результате хирургического вмешательства и носит название инцизионной биопсии. Эксцизионная представляет собой изучение опухоли или части тканей, полностью удаленных хирургически.

Забор вне оперативного вмешательства выполняется с помощью щипчиков, иглы или небольшой трубочки, кюреты, инструментов для забора мазка – врач выбирает способ в зависимости от того, какие именно ткани подлежат изучению.

Далее материал направляется в лабораторию и исследуется с помощью электронного микроскопа. Предварительно его обрабатывают специальным веществом и проводят уплотнение парафином, нарезают тонкими срезами и окрашивают. Специалист получает возможность увидеть структуру причинного участка, определить характер патологических изменений. Срок готовности результатов составляет около 7-10 дней.

Если требуется получить данные быстрее, применяют ускоренную методику – материал быстро замораживают, нарезают и изучают под микроскопом. В этом случае результатов придется ждать не более часа.

Где сдать анализ на гистологию?

Сдать гистологический анализ в Москве вы можете в клинике «Семейный доктор». Забор материала выполняют квалифицированные специалисты с соблюдением всех условий и норм. У нас вы можете сдать анализ в комфортных условиях и получить результаты в регламентированные сроки.

Мы работаем в выходные и праздничные дни. Запись по телефону контакт-центра +7 (495) 775 75 66 и в регистратуре клиники.

Стоимость

врач акушер-гинеколог, врач ультразвуковой диагностики, ведущий специалист клиники

врач акушер-гинеколог, врач ультразвуковой диагностики

врач акушер-гинеколог, врач ультразвуковой диагностики

врач акушер-гинеколог, врач ультразвуковой диагностики, ведущий специалист клиники

врач акушер-гинеколог, врач ультразвуковой диагностики

врач акушер-гинеколог, врач ультразвуковой диагностики

врач акушер-гинеколог, врач ультразвуковой диагностики

врач акушер-гинеколог, врач ультразвуковой диагностики

врач акушер-гинеколог, врач ультразвуковой диагностики

врач акушер-гинеколог, врач ультразвуковой диагностики

врач акушер-гинеколог, врач ультразвуковой диагностики

Мазок на онкоцитологию | Медицинский центр «Президент-Мед»

Мазок на онкоцитологию – микроскопическое исследование клеток, взятых из шейки матки и цервикального канала. Он позволяет идентифицировать аномальные клетки шейки матки, провести дальнейшее обследование, поставить диагноз и назначить адекватную терапию. Анализ проводят для раннего распознавания предраковых поражений шейки матки, эндометрия, вульвы и выявления бессимптомно протекающих патологий половых органов.

Рак шейки матки часто можно предотвратить. Изменения, обнаруженные при цитологическом исследовании мазка и указывающие на то, что рак может развиться, – не повод паниковать. Это шанс вовремя пролечить состояние и не дать перерасти отклонению в злокачественную опухоль. Скрининг рака шейки матки – отнюдь не тест на рак. Его используют для выявления ранних патологий шейки матки.

Показания к онкоцитологическому скринингу

Онкоцитологический мазок показан всем женщинам, и крайне необходим пациенткам с высокой степенью риска.

Ежегодный диагностический тест рекомендован женщинам с:

  • семейной историей гинекологических онколопатологий;
  • высоким титром ВПЧ;
  • псевдоэрозией;
  • лейкоплакией;
  • эрозией шейки матки;
  • аденомиозом;
  • полипами;
  • дисплазией;

а также женщинам старше 40 лет

Онкоцитологический скрининг – способ профилактики рака шейки матки. Он выявляет наличие изменений в клетках, которые могут, если их не лечить, перерасти в рак.

Как проходит процедура

Скрининг является частью обычного гинекологического обследования и выполняется быстро. Процедура практически безболезненна. Гинеколог проводит забор биоматериала с помощью цитощетки с мягкой щетиной или специального шпателя. Сначала врач вводит и фиксирует обычное гинекологическое зеркало, затем, путем соскабливания, получает клеточный материал с влагалищного участка шейки матки. Стеклышки с образцами тканей передают в лабораторию.

Подготовка к онкоцитологическому скринингу

При любых воспалительных процессах взятие мазка не рекомендуют. Необходимо сначала пройти курс противовоспалительной терапии, а затем проводить скрининг. Мазок нельзя «сдавать» во время менструаций.

За 48 часов до обследования пациенткам советуют воздержаться от сексуальной активности (вагинальных контактов). Запрещено использование вагинальных свечей, кремов. Женщине нельзя принимать ванну, купаться в бассейне. Разрешен только душ. Исключены любые спринцевания. Если накануне проводилась кольпоскопия, то после процедуры должно пройти 48 часов.

Интерпретация результатов онкоцитологического теста

Мазок на онкоцитологию помогает обнаружить атипичные клетки с высокими онкогенными рисками. Отрицательный результат информирует о присутствии в исследуемом биоматериале нормальных клеток. Положительный результат мазка свидетельствует об обнаружении аномальных клеток, что отнюдь не означает наличие рака. Отклонения в тесте могут дать непролеченные инфекции: хламидиоз, гонорея, кандидоз и другие.

Аномальные клетки показывают, что рак может развиться когда-нибудь в будущем. Большинство изменений не приведет к раку шейки матки. Порядка шести процентам пациенток с аномальными клетками потребуется дальнейшее обследование плюс лечение, которое предотвратит риск развития онкопатологий.

Чтобы сдать мазок на онкоцитологию для профилактики рака шейки матки обращайтесь в медицинские центры Президент-Мед в Москве (м. Коломенская, м.ВДНХ) и в Видном

Автор: Лаврова Нина Авенировна

Заместитель генерального директора по медицинской части

Окончила Ярославский государственный медицинский институт по специальности «Лечебное дело»
Медицинский опыт работы — 25 лет

Записаться к врачу

ОТЗЫВЫ КЛИЕНТОВ

Евгения

Была на приёме у гинеколога Ольги Александровны, была только один раз, но врач показался очень квалифицированный, далее судить буду в процессе лечения, и отпишусь. Клиника платная, но деньги не дерут! Профессионализм на высшем уровне, а цены ниже чем во многих псевдоклиниках. Девушка на телефоне очень приятная и уважительно относится к клиентам, старается помочь и выгодно для…[…]

Анастасия

Спасибо огромнейшее за Вашу работу! Все четко, ясно, понятно и быстро! Без лишних разговоров «о судьбе отечества». Просто невероятно позитивные эмоции после общения![…]

Инна

Прекрасный врач, имеет огромный опыт, может правильно поставить диагноз, все объяснить клиенту. К каждому находит свой подход.[…]

Наталья

Спасибо от меня и всей моей семьи за профессионализм, поддержку, чуткое и внимательное отношение. Это – огромное счастье, что такие компетентные, умелые и талантливые, неравнодушные люди работают именно там, где они больше всего нужны. Ваши терпение, отзывчивость, чуткость, понимание, забота, доброжелательное и внимательное отношение, лечат и успокаивают. Желаю крепкого…[…]

Светлана

Хочу выразить огромную благодарность Чулак Ольге Александровне, за внимательность, инд. подход к пациенту, а так же профессионализм, доброжелательность и заботу! А ТАк же клинику Президент-мед и всему персоналу на ресепшн. Ольга Александровна- вы лучшая :)[. ..]

Светлана

Хочу выразить огромную благодарность Чулак Ольге Александровне, за внимательность, инд. подход к пациенту, а так же профессионализм, доброжелательность и заботу! А ТАк же клинику Президент-мед и всему персоналу на ресепшн. Ольга Александровна- вы лучшая :)[…]

Екатерина

Добрый день, хочу выразить свое восхищение Екатериной Викторовной, врач высшей категории, с первой секунды располагает пациента, чувствуется высокий профессионализм, очень доброжелательная, внимательная, реально всегда на связи со своими пациентами, что очень важно, так как в наше время мало кто может брать на себя ответственность. Всем советую![…]

Информация о гинекологическом раке | KSK Онкологический центр Ирвина

Общие сведения о гинекологическом раке


Гинекологические раковые заболевания включают раковые заболевания женской репродуктивной системы, включая шейку матки, вульву, матку, маточные трубы, яичники и влагалище. За последние два десятилетия в области выявления и лечения гинекологических онкологических заболеваний были достигнуты значительные улучшения.

Факты о гинекологическом раке

  • Рак шейки матки — Второй по распространенности рак у женщин.ВПЧ (вирус папилломы человека) — самый большой фактор риска, связанный с раком шейки матки. Это также связано с курением. Раннее выявление рака шейки матки включает скрининг мазка Папаниколау. Недавно FDA одобрило вакцинацию от ВПЧ, которая может снизить заболеваемость раком шейки матки.
  • Рак вульвы — наименее распространенный из всех гинекологических видов рака, на который приходится менее 5% всех гинекологических онкологических заболеваний. Заболевание обычно поражает пожилых женщин.ВПЧ показал корреляцию с заболеваемостью раком вульвы.
  • Рак эндометрия (или матки) — Включает несколько типов злокачественных новообразований, которые происходят из внутренней оболочки матки, также известной как эндометрий. Рак эндометрия — наиболее распространенный вид рака женских половых путей в США. Некоторые общие факторы риска включают высокий уровень эстрогенов, ожирение, гипертонию, гиперплазию эндометрия и гипертонию.
  • Рак яичников — Болезнь показала корреляцию с увеличением заболеваемости в более промышленно развитых странах. Риск развития рака яичников также увеличивается с возрастом и уменьшается с увеличением числа беременностей.

Признаки и симптомы гинекологического рака

  • Рак шейки матки — Второй по распространенности рак у женщин. ВПЧ (вирус папилломы человека) — самый большой фактор риска, связанный с раком шейки матки.Это также связано с курением. Раннее выявление рака шейки матки включает скрининг мазка Папаниколау. Недавно FDA одобрило вакцинацию от ВПЧ, которая может снизить заболеваемость раком шейки матки.
  • Рак вульвы — наименее распространенный из всех гинекологических видов рака, на который приходится менее 5% всех гинекологических онкологических заболеваний. Заболевание обычно поражает пожилых женщин. ВПЧ показал корреляцию с заболеваемостью раком вульвы.
  • Рак эндометрия (или матки) — Включает несколько типов злокачественных новообразований, которые происходят из внутренней оболочки матки, также известной как эндометрий.Рак эндометрия — наиболее распространенный вид рака женских половых путей в США. Некоторые общие факторы риска включают высокий уровень эстрогенов, ожирение, гипертонию, гиперплазию эндометрия и гипертонию.
  • Рак яичников — Болезнь показала корреляцию с увеличением заболеваемости в более промышленно развитых странах. Риск развития рака яичников также увеличивается с возрастом и уменьшается с увеличением числа беременностей.

Анатомия гинекологического рака

Полезные термины в отношении гинекологического рака

  • Дизурия — Боль при мочеиспускании, которая может быть временным побочным эффектом лучевой терапии.
  • Брахитерапия HDR (высокая мощность дозы) — форма внутреннего излучения, при которой для лечения гинекологического рака временно имплантируется радиоактивный источник.
  • Линейный ускоритель — Аппарат, обеспечивающий лучевую терапию.
  • Диссекция лимфатических узлов — Хирургическое удаление лимфатических узлов, при гинекологическом раке лимфатические узлы в тазу иссекаются.
  • TAH / BSO — Полная абдоминальная гистерэктомия с двусторонней сальпингооферэктомией — хирургическая процедура при раке матки.

Лечение гинекологического рака

Рак шейки матки

Для лечения ранних стадий требуется гистерэктомия (хирургическое удаление всей матки / шейки матки и части влагалища) и забор лимфатических узлов. Операция по сохранению фертильности, известная как трахелэктомия, также может выполняться на очень ранних стадиях рака шейки матки. Это включает удаление шейки матки с сохранением матки и яичников. Заболевание на ранней стадии также можно лечить с помощью внешней лучевой терапии (ДЛТ) и внутреннего облучения (брахитерапия). Более крупные и запущенные стадии обычно лечат лучевой терапией и химиотерапией.

Рак вульвы

Хирургическое вмешательство является основным методом выбора и обычно включает радикальную вульвэктомию (полное удаление вульвы). На более поздних стадиях можно использовать химиотерапию и лучевую терапию.

Рак эндометрия (или матки)

Первичным лечением заболевания на ранней стадии является хирургическое вмешательство. Женщинам с более высоким риском заболевания может потребоваться дополнительная лучевая терапия, чтобы улучшить их шансы на выздоровление. Пациентам с более поздней стадией рака матки может потребоваться химиотерапия.

Рак яичников

Часто лечат комбинацией химиотерапии и хирургического вмешательства, но иногда использование лучевой терапии может улучшить прогноз. В зависимости от стадии и степени диагностированной опухоли хирургическое вмешательство может включать удаление всех или некоторых гинекологических органов. Частичные операции могут включать яичники, маточные трубы и матку. Полная резекция всех структур известна как операция TAHBSO (полная абдоминальная гистерэктомия и двусторонняя сальпингооферэктомия).

Рак влагалища

Лечение зависит от вашего конкретного случая. Часто это операция, лучевая терапия и химиотерапия.Оптимальное лечение определяется вашей онкологической бригадой.

Часто задаваемые вопросы

Q: Каковы побочные эффекты облучения гинекологических органов (таза)?

A: Лучевая терапия рассчитана на локализацию и привязку к месту. По этой причине любые потенциальные побочные эффекты напрямую связаны с обрабатываемой областью. Общие острые побочные эффекты при лучевой терапии таза включают покраснение кожи, тошноту, рвоту и потерю веса. Долгосрочные побочные эффекты могут варьироваться в зависимости от обрабатываемой области. Большинство побочных эффектов легкие и временные.

В: Какой диеты мне следует придерживаться во время лучевой терапии?

A: Пациентам с риском диареи следует минимизировать потребление клетчатки. Если у вас жидкий стул или диарея, мы рекомендуем есть овсяные хлопья, белый рис, спелые бананы, яблочное пюре, белые тосты, консервированные фрукты без кожуры, такие как персики и груши, белую лапшу из макарон, рисовые хлопья и простой несладкий грэм. сухарики.Если у вас диарея, убедитесь, что вы достаточно гидратированы.

Брахитерапия для лечения гинекологического рака

Брахитерапия для лечения гинекологического рака


Брахитерапия относится к лучевой терапии, при которой радиоактивный материал помещается непосредственно в опухоль или рядом с ней, а не через внешние лучи. Сегодня брахитерапия является стандартной методикой лечения большого количества злокачественных новообразований и часто используется в сочетании с ДЛТ. В брахитерапии используются радиоактивные материалы, такие как цезий-137, иридий-192, палладий-103 или йод-125. Радиоактивные источники, которые доставляют излучение с высокой мощностью дозы, такие как иридий-192, называются HDR (лучевая терапия с высокими дозами). С помощью брахитерапии источник радиоактивного излучения можно разместить рядом с опухолью или непосредственно в ней. Поскольку энергия радиоактивного источника мала, большая энергия доставляется к опухоли, а близлежащие нормальные окружающие ткани получают очень небольшую дозу.Брахитерапию можно проводить с использованием множества методов, все в зависимости от обрабатываемой опухоли.

Внутриполостная брахитерапия при гинекологическом раке использует аппликатор для введения радиоактивных источников в естественные или хирургические полости тела. Введение радиоактивного источника (иридий-192) в полости тела было жизнеспособным компонентом лучевой терапии в течение многих лет и считается важным компонентом лечения гинекологического рака.Существует множество аппликаторов, разработанных и используемых для лечения гинекологических опухолей. Эти конструкции позволяют настраивать сложные распределения дозы, чтобы максимизировать дозу для опухоли, сохраняя при этом дозу для соседних чувствительных структур. Аппликаторы, используемые для гинекологических процедур, бывают разной длины и диаметра, и все они предназначены для оптимизации проведения лечения. Подобно брахитерапии простаты и груди, процедура проводится в специальном кабинете, обычно состоящем из 5-10 минут лечения.Он включает в себя введение аппликатора во влагалище либо вверх по верхушке влагалища, либо через зев шейки матки в матку. Назначенное лечение широко варьируется в зависимости от типа рака, который лечится. Лечение обычно проводится за 3-6 отдельных амбулаторных визитов. Во время этих посещений врач осторожно вводит вагинальный цилиндр во влагалище и стабилизирует его с помощью опорной пластины. Для подтверждения того, что аппликатор находится в желаемом месте, проводится компьютерная томография таза. Как только это подтверждается, конец аппликатора подсоединяется через передаточную трубку к устройству, в котором находится радиоактивный материал.Этот источник излучения (иридий-192) вставляется в верхнюю часть цилиндра и обеспечивает лучевую терапию в течение примерно 5-10 минут. Затем источник втягивается обратно в корпус, вагинальный аппликатор удаляется, и лечение завершается.

KSK Онкологический центр Ирвина

Выберите странуСоединенные Штаты АмерикиИндияСеверные Марианские острова

Выберите состояние

Выберите профессиюВрачМедсестрыДантистФармацевтХиропрактикиАкупунктуристОптометристПомощник терапевтаРеспираторный терапевтСертифицированный техник-полисомнографЗарегистрированная медсестраTesting Testing 1

Выберите SpecialityAbdominal RadiologyAddiction MedicineAdult MedicineAesthetic MedicineAge Управление MedicineAlternative MedicineAndrologyAnesthesia и интенсивная careAnesthesiologyAssisted ReproductionAsthma Клиническая ImmunologyAudiologyBariatric SurgeryBehavioral HealthBioactive CompoundsBreast RadiologyBurn SurgeryCardiologyCardiologyCardiothoracic SurgeryCell и Развивающее BiologyChild и подростковая PsychiatryChild и подростковая PsychiatryChronic DiseasesCleft губы и нёба SurgeryClinical сердца ElectrophysiologyClinical сердца ElectrophysiologyClinical GeneticsClinical HypnosisClinical PsychologyColorectal SurgeryCosmetic груди SurgeryCosmetic gynecologyCritical Уход MedicineCritical Уход MedicineCritical Лечебная медицинаПомощь в реанимацииЦитопатологияЦитопатологияДерматологическая хирургияДерматологияДерматопатологияДерматопатологияДерматопатологияРазвитие поведенческой педиатрииЭмбриологияЭкологическая медицинаЭндокринологияЭндокринология, метаболизм и диабетЭпидемиологияF acial Пластиковое SurgeryFamily и пациента центрированного CareFamily MedicineFamily PracticeFemale тазового Медицина и реконструктивная SurgeryFemale тазового Медицина и реконструктивная SurgeryFertilityFollicular извлечение устройства (ФРУ) Восстановление волоса SurgeryForensic PsychiatryForensic PsychiatryForensic PsychologyFunctional MedicineGastroenterologyGastroenterologyGastrointestinal EndoscopyGeneral Academic PediatricsGeneral и внутренний MedicineGeneral practiceGeneticsGeriatricsGI Опухоль и эндокринная SurgeryHaematologyHaematopathologyHand TherapyHead и шея PathologyHead и шея SurgeryHematology кровь и трансплантация костного мозга alliative MedicineHospital MedicineHyperbaric medicineImmunology и MicrobiologyImmunotherapiesInfectious DiseaseInfectious DiseaseIntegrative MedicineInternal MedicineInternal Медицина и Общие MedicineInternal Медицина PhysiciansInterventional CardiologyInterventional CardiologyInterventional RadiologyKinesiologyLifestyle MedicineMaternal фетальный MedicineMental Здоровье и LawMidwiferyMilitary MedicineMolecular BiologyMusculo Скелетная systemMusculoskeletal RadiologyNanotechnologyNaturopathyNeonatal и PerinatologyNephrologyNephrologyNeurologistsNeurologyNeuropathologyNeuropathologyNeuroradiologyNeuroradiologyNeuroscienceNeurosurgeryNon Терапевтическое KneeNuclear CardiologyNuclear MedicineNuclear PharmacyNuclear RadiologyNuclear RadiologyNutritionOBGYN и Женская HealthObstetrics и GynecologyOccupational MedicineOccupational TherapyOculoplastic SurgeryOncologyOphthalmologyOptometryOrthopaedic Спорт MedicineOrthopaedic Спортивная медицинаОртопедическая хирургияОртопедияОртопедия — стопы и стопы KLE SurgeryOsteopathic MedicineOther SpecialtiesOtolaryngologyOtorhinolaryngologyPain ManagementPain MedicinePain MedicinePain MedicinePain MedicinePain MedicinePain MedicinePain MedicinePathologyPatient и семьи Centered CarePediatric AnesthesiologyPediatric AnesthesiologyPediatric CardiologyPediatric CardiologyPediatric DermatologyPediatric DermatologyPediatric Emergency MedicinePediatric Emergency MedicinePediatric Emergency MedicinePediatric EndocrinologyPediatric EndocrinologyPediatric гастроэнтерологии гепатологии и NutritionPediatric Гематология и костного мозга TransplantPediatric Инфекционный DiseasePediatric NephrologyPediatric NephrologyPediatric OncologyPediatric PulmonaryPediatric RadiologyPediatric RadiologyPediatric RheumatologyPediatric RheumatologyPediatric SurgeryPediatric Хирургия, педиатрия, подростковая медицина, педиатрия, аллергия и иммунология, педиатрия, жестокое обращение с детьми, педиатрия, реанимация, педиатрия, генетика и метаболизм, педиатрия, неврология, педиатрия, Nutriti. onPediatrics PsychologyPhysical Медицина и RehabilitationPhysical TherapyPhysician Хорошо BeingPhysiology и BiophysicsPlastic и реконструктивной SurgeryPlastic SurgeryPodiatryPodiatry — Foot & Ankle SurgeryPractice ManagementPre-больница скорой помощи MedicinePreventive MedicinePrimary CarePrimary Уход PhysiciansPsychiatryPsychologyPsychotherapyPublic HealthPulmonary MedicinePulmonary наук и критические CarePulmonologistsPulmonologyRadiation OncologyRadiological SciencesRadiologyRemedialRenal болезнь Медицина и HypertensionReproductive EndocrinologyRespiratory TherapistsRespiratory TherapyRheumatologyRheumatologyRural MedicineSleep MedicineSleep MedicineSleep MedicineSleep MedicineSleep MedicineSleep Медицина Лекарство от снаВрачи снаПатология речиХирургия позвоночникаСпортивная медицинаСпортивная медицинаСпортивная медицинаСпортивная медицинаСпортивная медицинаСпортивная медицинаИнсульт и цереброваскулярная хирургияХирургия кистиХирургия кистиХирургия кистиХирургия кистиХирургическая кривая крика Терапевтическая помощьХирургическая реанимацияХирургическая онкологияТоракальная радиологияТоракальная хирургияТоксикологияТрансплантационная гепатологияТрансплантационная гепатологияТрансплантационная хирургияТравмаУрологическая патологияУрологияСосудистая и интервенционная радиологияСосудистые заболеванияСосудистая медицинаСосудистая хирургияВенерологияВирологияБезболезни

Колонизация влагалища с помощью papG Allele II + изолятов Escherichia coli от беременных и небеременных женщин как предрасполагающий фактор к пиелонефриту

Вагинальный (61) и фекальный (61) Escherichia coli изоляты от беременных и небеременных женщин (18–45 лет) были исследованы на предмет выявления аллелей papG методом ПЦР. papG аллель II был наиболее распространенным среди вагинальных (32,7%) и фекальных (3,2%) изолятов, тогда как другие аллели были обнаружены только среди вагинальных изолятов. (1,6% для аллелей I и III и 3,2% для аллелей II + III). papG + изолятов беременных женщин существенно не отличаются от таковых у небеременных, обладающих аллелем II papG (90% против 73,3%), тогда как оба (32.7%) существенно различались () по сравнению с фекальными изолятами (3,2%). Подавляющее большинство вагинальных изолятов papG аллеля II + были сгруппированы в группе B2 (81,8%) и гораздо меньше — в группе D (18,1%). Кроме того, большинство из них были положительными для fimH (100%), papC (100%), iucC (90,9%) и hly (72,7%), и около половины из них были положительными для . sfa / foc (45,4%). Кроме того, среднее владение генами VF составило 3.5 (диапазон от 2 до 5). Можно сделать вывод, что колонизация влагалища papG аллелем II + E. coli , возможно, является одним из факторов предрасположенности как беременных, так и небеременных женщин к пиелонефриту, но ее потенциал может быть изменен другими факторами, особенно факторами хозяина.

1. Введение

Прилипание бактерий — важный этап при всех инфекциях, который включает поверхностные взаимодействия между специфическими рецепторами на клеточной мембране млекопитающих и лигандами на поверхности бактерий.Тканевая специфичность инфекции в значительной степени определяется наличием или отсутствием специфических рецепторов на клетках млекопитающих [1]. Способность уропатогенной Escherichia coli (UPEC) прикрепляться к уроэпителию хозяина является важным этапом успешной колонизации мочевыводящих путей и патогенеза инфекции мочевыводящих путей (ИМП). Основной органеллой адгезии UPEC является P fimbriae, которая опосредует Gal ( α 1-4) Gal-специфическое связывание через молекулу адгезина PapG [2].Три молекулярных варианта (от I до III) адгезина кодируются геном адгезина papG , из которых известны три аллеля [3]. Эти варианты обладают различной специфичностью связывания рецепторов [4]. Естественно, что аллель papG встречается в четырех комбинациях: класс Ι плюс III, только класс III, класс II плюс III и только класс II [2, 5]. В соответствии со специфичностью рецептора адгезина PapG, p-фимбриированный уропатогенный E. coli клинически делится на два подтипа: papG аллель II + штаммов, ассоциированных с пиелонефритом и бактериемией, и papG + аллель III штаммы, ассоциированные с циститом, но обнаруженные при пиелонефрите и бактериемии [2, 5–7].

Наиболее распространенной внекишечной инфекцией E. coli у здоровых женщин являются ИМП [8, 9], которые развиваются восходящим образом, при этом E. coli получает доступ к мочевому пузырю через уретру, и первоначальная колонизация слизистая оболочка влагалища считается критическим шагом на пути к инфекции [10–12]. Эти колонизаторы женского интроитуса предрасполагают женщин к рецидиву ИМП [13]. Острый цистит чрезвычайно распространен среди женщин репродуктивного возраста, тогда как острый пиелонефрит, хотя и встречается гораздо реже, связан с высокими затратами на эпизод и заболеваемостью [14] и чаще встречается у беременных женщин, чем у небеременных [11].Поскольку вагинальная колонизация UPEC является возможным предшествующим шагом к инфекции мочевыводящих путей, эта работа была разработана, чтобы увидеть, есть ли какие-либо различия в распределении аллелей papG (особенно аллеля II papG ) среди вагинальных изолятов E. coli из беременных и небеременных женщин, а также для оценки возможной способности изолятов papG аллель II + вызывать пиелонефрит с помощью генотипического анализа филогенетических групп E. coli и внекишечного патогенного E.coli факторы вирулентности (ExPEC VFs) . Изоляты фекалий беременных и небеременных женщин были включены для сравнения.

2. Материалы и методы
2.1. Бактериальные изоляты

Это исследование включало 122 изолята E. coli (61 вагинальный и 61 фекальный изолят). Вагинальные изоляты (23 от беременных и 38 от небеременных женщин) были извлечены как значительный рост из влагалищных мазков с высоким содержанием, собранных гинекологами у беременных и небеременных женщин (в возрасте 18–45 лет), у которых клинически диагностирована симптоматическая инфекция половых путей, без исследования точной причины инфекции (женщины с вагинальным дискомфортом, причины которого не выяснены гинекологическим обследованием).Сразу после сбора мазки наносили штрихами на агар с эозин-метиленовым синим (EMB) (Himedia) и чашки с кровяным агаром. Планшеты инкубировали при 37 ° C в течение 24–48 часов на воздухе.

Фекальные изоляты (включены для сравнения) были получены от здоровых добровольцев (беременных (30 изолятов) и небеременных (31 изолят) женщин в возрасте 18–45 лет). У каждого человека был взят один образец фекалий. Образцы были обработаны согласно Plos et al. [15] путем разведения фекальных масс на EMB.После инкубации из каждой чашки отбирали последние три колонии (с соответствующим цветом и морфологией, то есть характеристиками E. coli ) в конце области штрихов и снова пересевали на чашку EMB, инкубировали, снова пересевали на чашки с триптическим соевым агаром (TSA) (Himedia), а затем хранят в холодильнике для дальнейшей работы.

Все изоляты, включенные в это исследование, были собраны в течение двухлетнего периода с мая 2008 г. по июнь 2010 г. в клиниках акушерства и гинекологии в Аль-Кут / провинция Васит / Ирак и идентифицированы с помощью обычных биохимических тестов [16, 17].

2.2. Обнаружение аллелей
papG методом ПЦР

Все изоляты были проверены на наличие трех аллелей papG (I, II и III) с помощью мультиплексной ПЦР с использованием специфических праймеров (Таблица 1). Для экстракции матричной ДНК каждый изолят пересевали на чашки с TSA в течение 24 ч при 37 ° C. С чашки с агаром отбирали 5 колоний и суспендировали в 100 мкл л стерильной дистиллированной воды. Бактериальные суспензии обрабатывали в течение 10 мин при 94 ° C [18] в термоциклере ДНК (MultiGene, Labnet International, Inc., США), а остатки клеток удаляли центрифугированием (12000 об / мин в течение 1 мин). Реакции ПЦР-амплификации проводили в объеме 25 мкл л, содержащем 12,5 мкл л KapaTaq 2x Ready Mix (KAPA Biosystems, США), 20 пмоль концентрации каждого праймера и 5 мкл л ДНК-матрицы. Параметры цикла [19, 20] были следующими: начальная денатурация при 94 ° C в течение 5 мин; с последующими 26 циклами 94 ° C в течение 1 минуты, 60 ° C в течение 2 минут и 72 ° C в течение 3 минут; и с окончательной выдержкой при 72 ° C в течение 20 мин.Амплифицированные продукты ПЦР подвергали электрофорезу в 2% агарозном геле в 0,5-кратном буфере ТВЕ.

аллэп

Ген Праймерная последовательность (5′-3 ‘) Amplicon
, размер (п.о.)

F TCGTGCTCAGGTCCGGAATTT 461
R TGGCATCCCCCAACATTATCG
papG аллель II
F GGGATGAGCGGGCCTTTGAT 190
R CGGGCCCCCAAGTAACTC
papG аллель III
F GGCCTGCAATGGATTTACCTGG 258
R CCACCAAATGACCATGCCAGA

2.3. Филогенетическая группировка изолятов

Филогенетическая классификация изолятов E. coli была определена с использованием филотипирования на основе триплексной ПЦР, описанного Clermont et al. [21]. Вкратце, геномная ДНК бактериальных штаммов была амплифицирована с помощью триплексной ПЦР с использованием праймеров, нацеленных на три маркера: chuA , yjaA и TspE4.C2. Филогенетическое группирование было выполнено на основе наличия специфических фрагментов, амплифицированных ПЦР, следующим образом: группа B2 ( chuA +, yjaA +, TspE.C2 ±), группа D ( chuA -, yjaA +, TspE.C2 ±), группа B1 ( chuA -, yjaA ±, TspEC2 +) и группа A ( chuA -, yjaA ±, TspE.C2-) (таблица 2).

Характеристика генотипической вирулентности изолятов

Мультиплексная ПЦР использовалась для обнаружения пяти генов, кодирующих детерминанты вирулентности, обычно связанные с внекишечными патогенными штаммами E. coli (ExPEC VF): neuC (капсульный антиген K1), hly (альфа- гемолизин), papC (пили типа P), sfa / foc (пили типа S и фимбрии типа 1C), fimH (пили типа 1) и iucC (аэробактин) [2, 7].Гены фактора вирулентности амплифицировали с праймерами, описанными в таблице 3, в общем объеме 50 мкл л, содержащих 25 мкл л KapaTaq 2x Ready Mix (KAPA Biosystems, США), 20 пмоль концентрации каждого праймера, кроме hly. (30 пмоль) и 5 ​​ мкл л ДНК-матрицы [18]. Условия реакции были следующими [24]: начальная денатурация при 94 ° C в течение 4 мин, затем 25 циклов денатурации при 94 ° C в течение 30 с, отжиг при 63 ° C в течение 30 с и удлинение при 68 ° C в течение 3 секунд. мин, после чего следует последний 10-минутный период удлинения при 72 ° C.Продукты амплификации разделяли электрофорезом в 2% -ном агарозном геле, содержащем бромид этидия. В качестве маркера размера молекулы в каждом геле использовали лестницу ДНК длиной 100 пар оснований (Kappa Universal).


Ген Праймерная последовательность (5′-3 ‘) Размер ампликона (п.н.)

907 F GACGAACCAACGGTCAGGAT 279
R TGCCGCCAGTACCAAAGACA
YjaA
F TGAAGTGTCAGGAGACGCTG 211
R ATGGAGAATGCGTTCCTCAAC
TspE4.C2
F GAGTAATGTCGGGGCATTCA 152
R CGCGCCAACAAAGTATTACG
328TAGG24GAC5AGGATA [24]

Ген Праймерная последовательность (5′-3 ‘) Размер ампликона (п.о.) Ссылка

9025
F AACAAGGATAAGCACTGTTCTGGCT 1,177 [18]
R ACCATATAAGCGGTCATTCCCGTCA
papC
FACG24GGC5 GACTG24GGGC5 [22]
R ATATCCTTTCTGCAGGGATGCAATA
sfa / foc
GATGC7GTGCGC7 [22]
R CGGAGGAGTAATTACAAACCTGGCA
iucC
TACCA
F 9024GACC 9024GACC [23]
R ACCCGTCTGCAAATCATGGAT
fimH
F F
R GCAGTCACCTGCCCTCCGGTA

hly : альфа-гемолизин; papC : P fimbriae; sfa / foc : фимбрии S и фимбрии F1C; iucC : аэробактин; и fimH : фимбрии 1 типа.
2,5. Статистический анализ

Результаты были проанализированы статистически с использованием метода хи-квадрат [25]. Считалось, что значение ниже 0,05 указывает на статистическую значимость.

3. Результаты

Шестьдесят один вагинальный изолят E. coli от беременных и небеременных женщин был исследован на аллель papG как фактор предрасположенности к пиелонефриту. Шестьдесят один фекальный изолят здоровых добровольцев также был включен для сравнения. papG Аллель II был наиболее распространенным аллелем как среди вагинальных (32,7%), так и среди фекальных (3,2%) изолятов, тогда как другие аллели были обнаружены только среди вагинальных изолятов (1,6% для аллелей I и III и 3,2% для аллелей II + III. ). Также 90% (9/10) и 78,5% (11/14) из papG + вагинальных изолятов беременных и небеременных женщин были papG аллель II + , соответственно (Таблица 4).

1 (4,3) 9025 0

Источник изолятов Исследователи (кол.) Кол-во (%) изолятов, положительных по аллелям papG
I II III II + III

9025 9025 Вагинально 9 (39,1) 0 0
Небеременные (38) 0 11 (28,9) 1 (2,6) 2 (5,2) 9241
Итого (%) (61) 1 (1.6) 20 (32,7) 1 (1,6) 2 (3,2)

Фекальные Беременные (30) 0 2 (6,64 0247 2 (6,6)
Небеременные (31) 0 0 0 0

Всего (%) (61) 0 0 0

papG + изолятов были дополнительно генотипированы для E.coli и гены ExPEC VFs (таблица 5). papG + вагинальных изолятов сгруппированы в группы B2 (78,2%) и D (21,7%), тогда как все фекальные изоляты сгруппированы в группу D. За исключением sfa / foc , для всех изученных генов VF ( Таблица 5), вагинальные изоляты papG + существенно не различались по сравнению с papG + фекальными изолятами. Также вагинальные изоляты беременных и небеременных женщин существенно не отличались друг от друга по наличию всех изученных генов ФЖ.

9025 9025 9025 Гены

Признаки Кол-во (%) изолятов, положительных по указанному признаку
Вагинальные изоляты Фекальные изоляты
изоляты для беременных женщин изоляты () Всего () ()

Филогенетические группы
B1 0 0 0 0
B2 8 (80) 11 (78.5) 18 (78,2) 0
D 2 (20) 3 (21,4) 5 (21,7) 2 (100)
ExPEC
fimH 10 (100) 14 (100) 23 (100) 2 (100)
14 (100) 23 (100) 2 (100)
Sfa / foc 6 (60) 7 (50.0) 13 (56,5) 0
hly 7 (70) 8 (57,1) 15 (65,2) 1 (50)
901 901 9 (90) 11 (78,5) 20 (86,9) 2 (100)

Подавляющее большинство изолятов papG аллеля II40 vaginal + были сгруппированы в группу B2 (81.8%) и намного меньше в группе D (18,1%) (таблица 6), тогда как все фекальные изоляты сгруппированы в группу D. Кроме того, большинство из них были положительными для fimH (100%), papC (100%). %), iucC (90,9%) и hly (72,7%), и около половины из них были положительными для sfa / foc (45,4%) (Таблица 6). Кроме того, среднее владение геном VF составляло 3,5 (диапазон от 2 до 5).

9024 9024 9024 9024 9024 9024 9024 9024 9024 9025 9024 Гены ExPEC VFs 9024

Признаки No.(%) изолятов, положительных по указанному признаку
Вагинальные изоляты фекальные изоляты
Изоляты беременных женщин () Изоляты небеременных женщин () Всего () ()
Филогенетические группы
A 0 0 0 0
B2 8 (88.8) 10 (76,9) 18 (81,8) 0
D 1 (11,1) 3 (23,0) 4 (18,1) 2 (100)
fimH 9 (100) 13 (100) 22 (100) 2
9 (100) 13 (100) 22 (100) 2 (100)
Sfa / foc 3 (33.3) 7 (53,8) 10 (45,4) 0
hly 7 (77,7) 9 (69,2) 16 (72,7)
iucC 9 (100) 11 (84,6) 20 (90,9) 2 (100)

75 9 4. Обсуждение , подавляющее большинство вагинальных изолятов papG аллеля II + сгруппированы в группу B2 и гораздо меньше — в группу D, и большинство из них были положительными для fimH , papC , iucC и hly , и около половины из них были положительными на sfa / foc (Таблица 6).Предыдущие исследования продемонстрировали, что вагинальный E. coli имеет общие профили факторов вирулентности, филогенетические группы и серотипы со штаммами E. coli из мочевого и неонатального (кровь и CSF) происхождения [11, 20], поскольку влагалище способствует колонизации штаммами. которые обладают свойствами, отличными от штаммов фекальной флоры, поэтому влагалище можно рассматривать как анатомический барьер, который отбирает штаммы с большей способностью вызывать заболевание [26]. Такая высокая распространенность филогенетических групп B2 и ExPEC VF среди изолятов данной работы указывает на их патогенный потенциал как ExPEC (особенно пиелонефрита E.coli ), поскольку большинство штаммов UPEC относятся к филогенетической группе B2 и, в меньшей степени, группе D [7]. Кроме того, штаммы UPEC содержат множество VF, таких как адгезины (P-фимбрии, фимбрии 1-го типа, фимбрии S и F1C и афимбриальный адгезин), токсины (гемолизин и цитотоксический некротизирующий фактор), сидерофоры (система аэробактина) и полисахаридные покрытия (групповые покрытия). II капсулы) [7, 27, 28]. По сравнению с циститом и фекальными изолятами у пиелонефрита E. coli была гораздо большая распространенность филогенетической группы В2, О-антигенов, связанных с ИМП, и отдельных ФЖ, плюс более высокие совокупные показатели ФЖ [7].Предполагается, что PapGII и PapC связаны с пиелонефритом, и что аллель II papG является одним из важных предикторов этой инфекции [2, 29]. Все изоляты papG с аллелем II + в этой работе были положительными как для papC , так и для fimH , и около половины из них были положительными для papC , fimH и sfa / foc . Это согласуется с другими, которые продемонстрировали, что фимбрии типа 1, P, S, F1C и Dr, как известно, связываются с разными участками в почках человека [2], и что фимбрии P и типа 1, по-видимому, действуют синергетически, способствуя колонизации. почек [30].Наличие нескольких фимбриальных типов способствует общему успеху патогена во время почечной колонизации [2].

Изоляты беременных женщин существенно не отличались от изолятов небеременных, обладающих аллелем II papG (39,1% против 28,9%), тогда как оба (32,7%) значительно отличались по сравнению с фекальными изолятами (3,2%) (Таблица 4) . Кроме того, изоляты papG с аллелем II + существенно не отличались друг от друга в отношении филогенетических групп и распределения генотипов VF ExPEC (таблицы 5 и 6), это указывает на то, что как беременные, так и небеременные женщины имеют одинаковые шансы заболеть пиелонефритом в в соответствии с предложением этой работы, хотя предыдущие исследования показали, что острый пиелонефрит чаще встречается у беременных, чем у небеременных [11, 31], что означает, что физиологические различия, по-видимому, являются критическими детерминантами предрасположенности к этой инфекции из-за застоя мочи и бактериурия в мочевыводящих путях, вызванная относительной обструкцией [11].Экосистема влагалища и особенно Lactobacillus , а также кишечные популяции E. coli , половой акт и физиологические и анатомические условия мочевыводящих путей также играют важную роль в патогенезе инфекций мочевыводящих путей [32].

Нельзя исключить возможную роль колонизации влагалища такими изолятами как предрасполагающего фактора к пиелонефриту, и для этого потребовались дополнительные анализы in vitro и in vivo , поскольку ранее было обнаружено, что колонизация влагалища E.coli представляет собой промежуточную стадию внекишечного патогенеза E. coli [10], и женщины часто страдают повышенной восприимчивостью к рецидивирующим инфекциям мочевыводящих и половых путей в связи с уропатогенными штаммами E. coli [13]. Таким образом, можно сделать вывод, что колонизация влагалища papG аллелем II + E. coli , возможно, является одним из факторов предрасположенности как беременных, так и небеременных женщин к пиелонефриту, но ее потенциал изменяется другими факторами, особенно факторами хозяина. .

Страница не найдена — גטר ביומד

Одежда, лаборатория и уборка

Ушная защита

Защита для глаз

Перчатки промышленные

Перчатки, лаборатория и чистые помещения

Очищающие средства для рук

Опасное обращение, хранение и утилизация

Защита головы

Коврики

Швабры и чистящие средства

Защита органов дыхания

Обувь и бахилы

Утечка

Салфетки / дворники

Рабочая и верхняя одежда

Кесарево сечение гориллы Западной низменности с дистрессом плода и подозрением на преэклампсию | Уолтер

ВОЗ.Рекомендации ВОЗ по профилактике и лечению преэклампсии и эклампсии: последствия и действия. 2013. Доступно по адресу: http://www.who.int/reproductivehealth/publications/maternal_perinatal_health/program-action-eclampsia/en/

.

Палмер А.Е., Лондон В.Т., Слай Д.Л., Райс Дж.М. Спонтанная преэкламптическая токсемия беременности у обезьяны патас (Erythrocebus patas). LAB. ЖИВОТНОЕ. SCI. 1979; 29 (1): 102-106

Cavanagh D, Rao PS, Tung KSK, Gaston L. Экламтогенная токсемия: разработка экспериментальной модели на недочеловеческих приматах, Am J Obstet Gynecol.1974

Бэрд-младший, Дж. Н. Эклампсия у низинной гориллы. Am J Obstet Gynecol. 1981; 141 (3): 345-6

Thornton JG, Onwude JL. Судороги при беременности у родственных горилл. Am J Obstet Gynecol. 1992; 167 (1): 240-1

Pijnenborg R, Vercruysse L, Carter AM. Глубокая инвазия трофобластов и ремоделирование спиральной артерии в плацентарном ложе низменной гориллы. Плацента. Август 2011 г .; 32 (8): 586-91

Кросли Э.Дж., Эллиот М.Г., Кристиан Дж.К., Креспи Б.Дж. Плацентарная инвазия, риск преэклампсии и адаптивная молекулярная эволюция у происхождения человекообразных обезьян: данные полногеномного анализа.Плацента. Февраль 2013; 34 (2): 127-32.

О’Грейди Дж. П., Дэвидсон Дж. Э., Томас В. Д., Эсра Г. Н., Глюк Л., Кулович М. В.. Кесарево сечение у гориллы. J Ame Vet Med Assoc. 1978 ноя; 173 (9): 1137-40.

Коул RE. Акушерское ведение затяжных родов у горилл западной низменности в неволе. Am J Obstet Gynecol. 2000; 182: 1306-11.

Купер, Джон Э. и Гордон Халл. Патология и здоровье горилл, под редакцией Джона Э. Купера и Гордона Халла, Elsevier Science, 2016. ProQuest Ebook Central

Харкорт А., Стюарт К., Фосси Д.Размножение горилл в дикой природе. В: Грэм, К. (ред.), Репродуктивная биология больших обезьян: сравнительные и биомедицинские перспективы. Academic Press, Нью-Йорк, штат Нью-Йорк; 1981: 265-279. Купер, Джон Э. и Гордон Халл.

Чанг Э.И., Вуд CE. Кетамин ослабляет реакцию АКТГ на гипоксию у плода овцы на поздних сроках беременности. Неонатология. Июнь 2015 г .; 107 (4): 249-255.

Paixa ˜ o TA, Tinoco HP, Malta MdeC, Teixeira da Costa MEL, Soave SA, Pessanha AT et al. Патологические находки у содержащихся в неволе старческих горилл западной низменности (Gorilla gorilla gorilla) с хронической почечной недостаточностью и септическим полиартритом.Braz J Vet Pathol. 2014; 7 (1): 29-34.

Паал С., Каса Л., Борос Г., Фабиан Л. Тубулярный нефроз — возможная причина смерти гориллы. Верх. Бер. Erkrg. Zootiere. 1982; 24: 205-8.

Lowenstine LJ, McManamon R, Terio KA. Сравнительная патология старения человекообразных обезьян: бонобо, шимпанзе, гориллы и орангутанги. Vet Pathol. 2016 Март; 53 (2): 250-76.

Рамзи MM, Tame JD, Winter JA, Carbone LG, Schlafer OH, Nathanielsz PW. Протеинурическая гипертензия у беременной бабуины: это была преэклампсия ?.J Med Primatol. 1997 1 августа; 26 (4): 207-12.

Поездка к врачу за рубежом: Германия

Добро пожаловать в мою новую серию «Посещение врача за рубежом» — серию интервью с эмигрантами, живущими за границей, о различиях в здравоохранении в их принятой стране. Любить это? Ненавидеть это? Считаете это полезным? Дай мне знать.

Сегодня мой замечательный друг Али с сайта Aliadventures.com согласился рассказать нам о здравоохранении в Германии.

Сначала расскажи о себе. Что вы делаете? Откуда ты? Какая у вас история в двух словах?

Я родом из США.Я жил в Нью-Джерси, пока мне не исполнилось 15, а затем в Атланте, пока мне не исполнился 31 год. Когда мне было 30, я встретил (через Твиттер!) Американца по имени Энди, который жил во Фрайбурге, Германия. Мы полюбили друг друга, поженились, и я переехал в Германию. Мы недавно переехали в Берлин, потому что это удивительный город.

В предыдущей жизни я был страховщиком авиационной страховки, а теперь я пишу-фрилансера и блогер-путешественник. Путешествие — одна из моих самых больших страстей, и я побывал на всех семи континентах до своего 30-летия.

Расскажите нам о среднем количестве обычных посещений врача. Как они работают в Германии? Чем они отличаются от США?

Я еще не был у врача здесь, в Берлине, но я жил во Фрайбурге в Шварцвальде почти четыре года, так что мой опыт основан на этом месте. Мои обычные посещения врача были действительно легкими. Мне почти никогда не приходилось ждать больше, чем несколько минут после назначенного времени (хотя я часто ждал около 30 минут в офисе специалиста), и обычно я мог попасть на прием в течение нескольких дней, если мне действительно нужно было попасть.

В США я привык, что медсестра всегда измеряет мою температуру и артериальное давление, независимо от того, по какой причине я был назначен на прием, но здесь я не сталкивался с этим. Однажды я вошла, потому что у меня поднялась температура, а мне все еще не измеряли температуру. Меня это не беспокоит, но это одна из тех мелочей, которые поначалу кажутся странными.

Поговорим о специалистах. Как попасть к специалисту в случае необходимости?

Каждый раз, когда мне нужна запись к специалисту, я просто звоню и записываюсь на прием.Как и в США, они иногда немного забронированы, но если у меня срочная проблема, они обычно могут меня втиснуть.

Есть ли другие способы посещения специалиста в Германии?

Для женщин посещение акушерства и гинекологии может немного отличаться. Они не дают вам эти бумажные халаты, что имеет смысл, поскольку они все равно собираются увидеть все жизненно важные части, но поначалу это может показаться странным. У моего врача была небольшая занавеска в углу, где мне приходилось снимать майку перед тем, как она проводила обследование груди, а затем я возвращалась, надевала верх и снимала трусы для этой части обследования.Очень странно ходить по комнате полуголым, но в этом нет ничего страшного. Хотя я слышал о некоторых докторах, которые заставляют вас полностью раздеться, так что это бывает по-разному. В целом, европейцы меньше озабочены наготой, особенно если речь идет о медицинских ситуациях.

Есть какие-нибудь советы по поиску англоговорящих врачей в Германии? Насколько обычно врачи говорят по-английски?

Самый простой способ найти англоговорящих врачей — это спросить других эмигрантов в этом районе. Друзья, англоговорящие группы и онлайн-группы эмигрантов — все это вам поможет.По моему опыту, большинство врачей в Германии хоть немного говорят по-английски, и у меня с этим не было никаких проблем. Вам больше повезет с этим в больших городах, чем в небольших городах.

Поговорим об аптеках и рецептах. Они чем-то отличаются от США?

Аптеки здесь — это отдельные магазины, в отличие от аптеки в аптеке или продуктовом магазине в США. Обычно они получают мои рецепты сразу, но иногда им нужно что-то заказать, и тогда оно будет готово к концу дня или на следующее утро, в зависимости от того, когда я оставлю рецепт.Такие препараты, как парацетамол и ибупрофен (общий эквивалент тайленола и адвила), продаются только в аптеках, но вам не нужен рецепт. Вы просто попросите его у фармацевта. В общем, здесь к лекарствам относятся немного осторожнее, но у меня никогда не было проблем с получением того, что мне было нужно.

Какой протокол в Германии в экстренных ситуациях?

Почти то же самое. Либо обратитесь в отделение неотложной помощи, либо позвоните по номеру 112, что эквивалентно 911 в США.

Чем посещение больницы отличается от посещения в США?

Я никогда не лежал в больнице в США, но несколько лет назад я попал в больницу в Германии. Мне не давали никакого больничного халата, что было приятно, потому что это означало, что я мог болтаться в своей собственной одежде или пижаме. Но поскольку я не ожидала, что меня примут, мужу пришлось спешить домой и прихватить для меня кое-что, чтобы мне не пришлось спать в джинсах. Уединения было не так много, как я ожидал, как будто нет занавески, отделяющей мою кровать от кровати моего соседа по комнате.Но я полагаю, что в больнице никогда не бывает уединения.

Были некоторые проблемы с едой, которых я не ожидал. Никто не ожидает хорошей еды в больнице, но я продолжал говорить им, чтобы они не давали мне молочные продукты или большие кучи сырых овощей, потому что я был там из-за болезни пищеварения, которая влияет на мою толстую кишку. Похоже, они не понимали, почему есть все это проблемой. Мне следовало просто сказать им, что у меня непереносимость лактозы, хотя я этого не сделала.

Врачи говорили по-английски, поэтому у меня не было проблем, но у большинства медсестер не было, так что это было сложно.Знание базового немецкого (я только что закончила интенсивный восьмимесячный курс) действительно помогло, но это было немного стрессом.

А как насчет практикующих гомеопатов, иглоукалывания и других немедицинских методов лечения? Доступны ли они? Как вы их находите? Чем они отличаются от США?

Это не то, с чем я когда-либо сталкивался в США, но здесь, в Германии, это гораздо более приемлемо. Мои западные врачи, кажется, понимают, что альтернативная медицина тоже может быть полезной, и даже посоветовали мне обратиться к этим типам врачей.Я ходил к акупунктуристу во Фрайбурге время от времени в течение трех лет, и мне это очень понравилось. В то время я не знала никого, у кого были бы рекомендации, поэтому просто искала в Интернете специалиста по иглоукалыванию. Мой муж звонил нескольким, пока мы не нашли того, кто сказал, что может немного говорить по-английски, хотя он попросил, чтобы Энди (который бегло говорит по-немецки) пришел ко мне на первую встречу, когда было что обсудить.

Я был только на двух приемах к альтернативному практикующему в Берлине, который почти идеально говорил по-английски, но в таких крупных городах, как этот, есть из чего выбрать.

А как насчет медицинского страхования? Какая страховка доступна для эмигрантов в Германии? Вы бы порекомендовали это? Какая стоимость?

Медицинское страхование в Германии является обязательным, так что да, я рекомендую его. Тип медицинской страховки, которую вы получаете, зависит от вашей ситуации, но если вы устроились на работу у немецкого работодателя, вы, как правило, можете получить государственную страховку. Если вы едете в Германию по визе фрилансера, вам необходимо оформить частную страховку. Я точно не знаю, как работают частные планы, но если вы имеете право на них, они иногда могут быть дешевле в зависимости от вашего возраста и состояния здоровья.(Я знаю немца, который не мог получить частную медицинскую страховку, потому что у него заболевание пищеварительной системы, подобное тому, что было у меня, но я не знаю, как это работает, если вы не соответствуете требованиям государственного плана.)

Премия, которую вы платите по общедоступному плану, зависит от вашего минимального и максимального заработка. Если вы зарабатываете на максимальном уровне или выше (который, я думаю, составляет около 50 000 евро в год), ваш страховой взнос составляет около 700 евро в месяц. Если вы работаете, ваш работодатель платит половину, а если вы работаете не по найму, вы платите полную сумму.

Я работаю по плану художника, который предназначен для фрилансеров в творческой сфере (писатели, художники, музыканты и т. Д.). План называется KSK (Künstlersozialkasse), и они действуют как работодатели. Технически я до сих пор застрахован в рамках государственного плана с другой компанией, а KSK на самом деле не является медицинской страховой компанией. Я плачу примерно половину ежемесячного страхового взноса, плюс небольшую сумму в немецкий эквивалент социального обеспечения и медицинского обслуживания / медицинской помощи. В итоге моя премия составляет от 18% до 19% от моего валового дохода.

Все ли покрывает медицинское страхование или это система доплаты? Если да, то сколько вы обычно платите за вещи?

Медицинское страхование здесь оплачивает практически все, что делает дорогие страховые взносы более выгодными. Посещение врача полностью оплачивается, без доплаты или франшиз. Когда я лежал в больнице, мне приходилось платить 10 евро в день. Даже представить не могу, что было бы в США. Альтернативные практики, такие как мой специалист по иглоукалыванию, не оплачиваются, и они могут стоить от 40 до 100 евро за сеанс.Есть несколько планов, которые вы можете добавить к своей обычной медицинской страховке для покрытия некоторых из них, в зависимости от того, какую медицинскую страховую компанию вы выберете.

Если у вас частный план, вы должны заплатить за все заранее и получить компенсацию. Я не знаю, как это сработает во время пребывания в больнице.

А как насчет стоимости лекарств? Как это по сравнению с США?

Рецепты обычно стоят пять евро, иногда 10. Таблетки, которые я принимаю каждый день для лечения язвенного колита, стоят 10 евро на трехмесячный запас.Это намного дешевле, чем в США! То же самое лекарство в США стоило мне 1400 долларов за трехмесячный запас, пока я не достиг своей годовой франшизы, и даже тогда мне пришлось заплатить около 100 долларов.

Я заказывал здесь шесть месяцев за один раз, что стоит 20 евро, и несколько раз фармацевт мне говорил: «Ты же знаешь, что это дорого, правда?» Это заставляет меня каждый раз смеяться.

Что еще нужно знать людям о посещении врача в Германии?

Медицинская система в Германии действительно хороша, даже если есть различия, которые могут показаться вам странными.Они более осторожны, чем американские врачи (в общем), поэтому они не назначают лекарства так часто, и вы можете остаться в больнице по поводу чего-то, что будет амбулаторным в США.

Посещение стоматолога здесь обычно один раз в год, а не два раза в год, как в США. Ежегодная чистка, покрываемая страховкой, тоже не такая обширная, как та, к которой я привык в США, поэтому мы часто платим немного больше за полировочную часть. Стоматологическая помощь также покрывается вашей медицинской страховкой и оплачивает практически все.В прошлом году мне пришлось пойти к стоматологу, чтобы удалить зуб, и это мне ничего не стоило.

Несмотря на то, что я хожу к англоговорящим врачам, я считаю полезным напечатать то, что я хочу сказать врачу, особенно во время первого визита. Это снижает вероятность недопонимания, и я не забуду ничего упомянуть.


Огромное спасибо Али за то, что она поделилась своим опытом в области здравоохранения Германии. Есть вопросы, которые еще не решены? Есть ли что-нибудь, о чем вы бы хотели, чтобы я не спрашивал? Дай мне знать в комментариях.


Помог ли вам этот пост? Поделись любовью:

:: Покупка копии моих путеводителей по Италии, Франции, Швейцарии, Парижу, Барселоне или Праге (один уже есть? Подарите другой другу!)

:: Нажмите здесь перед тем, как сделать следующий заказ на Amazon (не имеет значения, что вы заказываете, если вы начнете с моего сайта, я получу комиссию!)

:: Пожертвование на поддержание работы этого сайта.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *

Copyright © 2008 - 2023