Мазня во время менопаузы: Кровотечения при климаксе: Что это значит?

Содержание

Могут ли быть при климаксе коричневые выделения: причины и лечение

Климакс подразумевает переход на полное отсутствие менструальных выделений, и только лишь радует женщин. Однако, вовсе не означает, что вместе с климаксом исчезнут любые выделения. Именно поэтому важно знать, какие выделения в климактерический период считаются нормой, а какие вызывают опасения и должны немедленно сопровождаться походом к врачу. Иногда женщины замечают коричневые выделения во время климакса. В этой статье мы подробно разберем,  могут ли быть при климаксе коричневые выделения, и стоит ли их опасаться?

Внимание! Коричневые кровянистые выделения во время менопаузы обычно считаются нормальными, так как говорят о постепенном прекращении месячных. Однако, с такой проблемой стоит показаться врачу, хотя бы для того, чтобы перестраховаться, ведь у некоторых женщин такая проблема может указывать на онкологические заболевания женских половых органов.

Содержание статьи

Когда нужно начинать беспокоиться?

Есть ряд признаков, по которым нормальные выделения можно отличить от тех, вызывающих опасение:

  1. Мазня слишком обильного характера.
  2. Когда в кровянистые или коричневые выделения при климаксе вкрапливаются желтые или черные примеси.
  3. Выделения при климаксе неоднородной консистенции, похожие на творог.
  4. Сопровождаются крайне неприятным запахом гноя или протухшей рыбы.
  5. Слишком жидкие и прозрачные, похожие на воду или же наоборот, слишком густые.
  6. Во время таких выделений наблюдается болевой синдром, зуд и жжение, терпеть которые становится невыносимо.
  7. Боль во время мочеиспускания, боль в области груди.
  8. Боль и ощущения дискомфорта во время занятий сексом в менопаузе.

Что нужно делать при появлении коричневых выделений в период климакса?

Если Вы заметили кровь на туалетной бумаге или прокладке, то нужно определить, откуда именно она идет.

Даже если Вы узнаете, из какого места идет кровь, то это не освобождает от похода к врачу. Но зато, Вы будете знать, к какому именно специалисту нужно обращаться. К примеру, если кровь идет все же из влагалища, то записываться нужно к гинекологу, а если из заднего прохода, то к проктологу.

Если Вы не знаете, как определить источник кровотечения, то купите обычные гигиенические тампоны и вставьте один во влагалище. Вытащите его через некоторое время и внимательно осмотрите. Если на тампоне есть коричневые выделения, то их источником является влагалище. Если тампон чист, то выделения идут из прямой кишки или мочевого пузыря. В любом случае, нужно обратиться к врачу и проконсультироваться с ним по поводу того, может ли быть коричневое выделение при климаксе из влагалища.

Почему могут быть коричневые выделения из влагалища во время менопаузы?

Порой даже самые незначительные выделения из влагалища во время менопаузы могут свидетельствовать об очень серьезной патологии.

  1. Механические травмы влагалища. Как известно, во время менопаузы женщины отмечают сухость во влагалище. Во время неосторожного полового акта или даже осмотра врача может случиться механическое повреждение. Если этот диагноз подтверждается, то специфического лечения это не требует, а в дальнейшем для профилактики механических повреждений влагалища во время полового акта нужно пользоваться мазью или свечами с высоким содержанием эстрогенов (необходимо мазать на ночь и перед занятиями сексом).
  2. Болезни шейки матки. Если выделения коричневого цвета с явными сгустками крови идут из влагалища обильно, то это может говорить о раке шейки матки. Очень долгое время это заболевание никак не дает о себе знать, выявляется чаще всего на поздних стадиях, когда уже трудно что-то сделать для спасения пациентки. Иногда кровянистые выделения, свидетельствующие о раке шейки матки, могут выступать после полового акта и сопровождаться болью в пояснице.
  3. Миома матки. Миомой называют доброкачественную опухоль в области матки, о ней говорят кровянистые выделения в период менопаузы, причем обильного характера. Когда миома не лечится и достигает больших размеров, то дает о себе знать в виде боли в области поясницы, промежности и крестца.
  4. Разрастание матки. Такой патологический процесс, как разрастание внутреннего кожного слоя матки, тоже является одним из самых распространенных причин коричневых выделений. Эти кровотечения по силе могут быть совершенно разные: могут начаться и достаточно обильные кровотечения, которые ведут к дальнейшему развитию малокровия в организме.
  5. Опухоли яичников. Симптом этого заболевания проявляются довольно нетипично, и вряд ли женщина обратит на них внимания. А все дело в том, что кожа дамы, волосы и ногти вдруг становятся намного лучше, чем прежде, да и сама она становится сравнительно моложе. При этом из влагалища есть коричневые выделения, очень похожие на менструальную кровь. Скорее всего, прекрасная дама сочтет, что менопауза временно отступила, и ей вновь выдалась возможность побыть красивой и привлекательной, но это не так. Это довольно тревожный симптом, с которым нужно немедленно обращаться к гинекологу.
  6. Полипы в области матки. Это тоже нередкое заболевание, которое мучает женщин в возрасте менопаузы. Все коварство полипов состоит в том, что данное заболевание сопровождается какой-либо инфекцией, и характер выделений при этом обычно мажущий.

Диагностика заболевания

Как только у женщины появляются какие-либо нетипичные симптомы во время менопаузы, она должна как можно скорее идти на прием к гинекологу, так как женщины климактерического возраста подвержены раковым заболеваниям в большей степени. Для того, чтобы поставить точный диагноз, врачу нужно провести ряд следующих мероприятий:

  1. Для начала врач должен внимательно выслушать все жалобы пациентки и уточнить интересующие его детали.
  2. Сбор истории болезни.
  3. Осмотр матки и влагалища при помощи метода пальпации (когда осматривается и влагалище, и матка сразу, используется двухпальцевый метод).
  4. Метод обследования промежности при помощи зеркала. Он нужен для того, чтобы выявить опухолевые заболевания, механические повреждения, полипы и так далее.
  5. Ультразвуковое исследование всех без исключения органов малого таза.
  6. Исследования в лаборатории подразумевают биопсию (для исключения или подтверждения онкологии), а также проверку женщины на чувствительность к медикаментозным препаратам.
  7. Если есть подозрения на то, что женщина больна инфекционным заболеванием, то крайне необходимо выявить его возбудителя.

Внимание! Вовсе не означает, что абсолютно каждой женщине назначают пройти весь этот список анализов. Скорее всего, назначаться будет только часть в зависимости от заболевания, на которое есть подозрение.

Как лечить коричневые выделения из влагалища в период менопаузы?

Лечение назначается в зависимости от заболевания, характера выделений и самочувствия пациентки. В каждом из случаев врач обязан действовать по-разному.

  1. Если кровотечение обильное и не прекращается довольно долгое время, то это может привести к большим кровопотерям. Обычно в такой ситуации больной показано выскабливание полости матки с удалением лишнего эндометрия. Кровяная масса, которая получилась в ходе выскабливания отправляются на биопсию, где подтверждается или исключается онкологическое заболевание. В зависимости от этого врач принимает решение о дальнейшем лечении.
  2. Если выделения коричневого цвета умерены, а УЗИ показало, что органы малого таза в порядке, то назначается медикаментозная терапия, направленная на то, чтобы снизить ломкость капилляров и сосудов, и устранить тот спазм, который приводит к их повреждению.
  3. Хирургическое вмешательство назначается тогда, когда выявляются опухоли матки и ее придатков. Нужно быть готовой: при этом не проводятся операции, которые направлены на сохранение органа как такового и его работоспособности. Как правило, больной орган удаляется полностью. Это делается потому, что в период климакса он уже не нужен, так как женщина утрачивает свою детородную функцию. А также потому, что если не удалить орган полностью, остается слишком высокий риск развития рецидива.

Таким образом, установить причину коричневых выделений во время климакса самостоятельно довольно сложно, поэтому все же стоит доверить это профессионалу и посетить врача. Это поможет выявить заболевание на ранних стадиях, и исключить опасные последствия.

Интересное и познавательное видео по теме:

Выделения во время климакса

Климактерический период серьезно ухудшает качество жизни женщины. Новые, ранее не проявляющиеся признаки вызывают опасения, особенно кровянистые выделения при климаксе, когда, казалось бы, менструация закончилась и ее больше быть не должно.

Что является нормой

Работа репродуктивной системы полностью зависит от гормонального баланса женщины. Наличие гормонов способствует активной работе шейки матки и яичников, а также регулирует отторжение эндометрия в конце каждого цикла и начало нового цикла с приходом менструации.

Приближение климакса значительно снижает активность гормонов и их количество в крови, соответственно, функция репродуктивных органов также угасает. Выделения при менопаузе возможны, но и они имеют другой характер.

Климакс состоит из нескольких фаз, причем в начальных фазах месячные еще продолжаются и только затем начинают наступать все реже. Яичники продолжают функционировать в первой фазе климакса – пременопаузе. Затем обновление эндометрия проходит реже – раз в несколько месяцев, раз в полгода.

Наблюдать за выделениями важно по той причине, что они могут свидетельствовать о каких-либо осложнениях климакса, либо о развитии гинекологических заболеваний. Нормой считаются следующие выделения:

  • Кровяные, наподобие менструаций, но в меньшем объеме, чем раньше;
  • Прозрачные с равномерной консистенцией, постепенно уменьшающиеся в объемах;
  • Не вызывающие дискомфорта, боли, сильной слабости;
  • Запах при климаксе у женщин также не проявляется.

Патологические выделения

Некоторые выделения по своим качественным и количественным характеристикам могут свидетельствовать о наличии гинекологических заболеваний или обострении имеющихся. Следующие выделения нельзя считать нормальными:

  • Желтые, темные, коричневые выделения;
  • Слишком интенсивные;
  • Творожистые;
  • Белые, густые;
  • С рыбным или тухлым запахом;
  • С болевым синдромом;
  • С зудящими ощущениями.

При обнаружении подобных выделений необходимо срочно обращаться к врачу – чем раньше обнаружится патология, тем быстрее и легче ее можно будет вылечить.

Слизистые выделения

Среди всех вопросов о климаксе женщину больше всего беспокоит вопрос о том, какие возможны выделения при климаксе, и могут ли они быть слизистыми, с вкраплениями крови.

Такие вкрапления свидетельствуют о том, что функция яичников до конца еще не угасла. Они продуцируют гормоны, отторжение эндометрия в какой-то степени происходит, но по большому счету от выделений остается только мазня.

Если же такие выделения достаточного обильны и продолжаются долго, назвать их нормальными нельзя. Они могут свидетельствовать о гормональных, воспалительных, онкологических заболеваниях и многих других, так как подобный симптом сопровождает большое количество болезней.

Опасные симптомы

Причинами кровянистых выделений при климаксе могут быть и достаточно серьезные заболевания, требующие полноценного лечения. Диагностировать их окончательно можно только с лечащим врачом.

Опасными заболеваниями, требующими максимально быстрого лечения, являются:

  • Фибромы, полипы – вызывают не только слизистые выделения, но и ярко выраженную боль внизу живота, могут появиться довольно водянистые месячные.
  • Гиперплазия – из-за снижения концентрации гормонов ткани матки начинают разрастаться, выходить может не только кровь, но и ее сгустки. Для выяснения характера клеточной природы проводят пункцию – не исключено, что клетки имеют злокачественный характер, особенно если женщина болела сахарным диабетом, ожирением, была гинекологически нестабильной в репродуктивном возрасте.
  • Нарушения в гормональном фоне, вызывающие патологии работы щитовидной железы или поджелудочной, замедляют или значительно ускоряют липидный и углеводный обмен.
  • Онкологические заболевания – опухоли могут долго не подавать симптомов, но темно-коричневые выделения становятся одним из маячков, что проверка требуется. Онкология возникает на фоне перенесенных гинекологических заболеваний, операций и других причин, связанных с наследственностью.

Заранее ставить себе диагноз и назначать лечение ни в коем случае нельзя. Организмы настолько индивидуальны, что у разных женщин одного и того же возраста климакс может совершенно по-разному проходить.

Когда кровь не опасна

Кровяные выделения не всегда свидетельствуют о заболеваниях. Их причиной могут стать и другие факторы внешней природы, которые совпадают с гормональными изменениями в женском организме.

  • Климакс может проходить настолько тяжело и снижать качество жизни женщины, что приходится применять заместительную терапию гормональными препаратами. Некоторые из гормональных препаратов требуют небольшого перерыва между курсами – именно в этот период возможны коричневые выделения. Дело в том, что выделения очень малы, выходят медленно, и кровь успевает окислиться.
  • Мажущиеся выделения в период климакса тоже не всегда страшны. Врачи склоняются к тому, что она вызвана низкой концентрацией эстрогенов. Недостаток гормонов задерживает развитие эндометрия, делает матку менее напряженной, ослабляет ее стенки. Из-за этого могут появляться незначительные пятнышки на нижнем белье.

  • Выделения с сукровицей могут не только маточными, но и влагалищными. Количество смазки в этот период заметно снижается, половая связь может закончиться повреждением слизистой оболочки влагалища и разрывом капилляров.
  • В некоторых случаях, источником крови становится уретра или патологические изменения в кишечнике. Проверить это можно с помощью тампона, который остается чистым, если дело не в матке или влагалище.

Такой процесс выделения крови вполне нормальный, но требует наблюдения у врача при изменении характера выделений.

Климакс не означает окончание половой жизни, потому нередко выделения появляются именно по причине недостатка слизи и натирания. Капилляры достаточно близко расположены к стенкам влагалища, потому их повреждение вероятно.

Инфицирование

Одной из причин, по которым женский организм во время климакса может отвечать нетипичными выделениями, являются инфекции. Они могут быть занесены во время полового акта, при этом, организм при климаксе становится более уязвим и вероятность распространения инфекции значительно выше.

Кровянистые выделения могут возникать по причине инфекционных заболеваний, при этом они будут сопровождаться следующими симптомами:

  • Кисловатый, тухлый запах влагалища. Выделения, смешиваясь с микрофлорой слизистой влагалища, являются благоприятной средой для распространения инфекций. Выделения могут обретать желтый, серый цвет, что свидетельствует о нагноении. Такие выделения наблюдаются не только в период климакса, но и в постклимактерическом периоде. Такие симптомы характерны гонорее, хламидиозу, вагинозу. Дополнительно наблюдается общая слабость организма, повышенная температура, интоксикация организма, болезненное опорожнение мочевого пузыря.

  • Зудящие ощущения, жжение не могут быть вызваны нормальными выделениями. Если влагалище сухое, ощущается недостаток слизи, жжение может быть вызвано трением стенок. В противном случае имеет место инфекция, которая может развиться и дальше, поражая яичники и мочеточники. Дополнительно может сопровождаться боль, покраснение. Лечение назначается врачом после взятия мазка и определения возбудителя.
  • Интенсивные выделения, которые при нормальном течении климакса не могут наблюдаться. Это один из самых ключевых поводов к обследованию. Даже изменение гормонального фона не может способствовать подобным выделениям, так как, напротив, снижает количество выделений. Попадающие внутрь инфекции вызывают токсическое раздражение слизистых, отслоение внешнего клеточного слоя слизистых, откуда и увеличение объема выделений.

Кандидоз

Отдельно стоит поговорить о молочнице. Она нередко встречается и у молодых девушек, так как грибок-возбудитель данного заболевания всегда присутствует в женском организме. Чтобы он начал активно размножаться, требуется внешний фактор или их сочетание, например:

  • Снижение общего и местного иммунитета;
  • Нарушения в обменных процессах;
  • Хронические депрессии, бессонницы;
  • Ухудшение кровотока к репродуктивным органам.

Эти условия являются идеальными для размножения грибка молочницы. Симптомы заболевания известны практически каждой женщине: белые выделения с творожистой консистенцией, сильные жжение и зуд, покалывания при мочеиспускании, возможны боли в области малого таза.

В группе риска находятся женщины с заболеваниями эндокринных органов и сахарным диабетом, особенно инсулинозависимого типа. Недостаточная личная гигиена – это еще один благоприятный повод для развития кандидоза.

Последнее вовсе не означает, что для профилактики молочницы требуется очень частое подмывание и тем более спринцевание. Такие процедуры могут поспособствовать разрушению собственной микрофлоры. Но так как она выполняет защитную функцию влагалища, распространение грибка кандиды еще более вероятно. Наилучший способ профилактики:

  • Достаточная гигиена со средствами, имеющими нейтральный рН;
  • Укрепление иммунитета;
  • Прием витаминов;
  • Избегание переохлаждений.

Выделения при климаксе могут быть совершенно нормальным признаком, если подчиняются описанию ожидаемых выделений. При выявлении любых отклонений, требуется обязательное вмешательство медицины, иначе последствия могут длиться значительно дольше, чем сам климакс.

Кровянистые выделения у женщин при климаксе и после менопаузы

В период менопаузы организм женщины претерпевает серьезные гормональные изменения, сопровождающиеся различными симптомами. Выделения являются одним из проявлений климакса и носят разный характер.

Причины

Нормальное функционирование репродуктивной системы женщины находится под влиянием гормонов. Благодаря колебаниям уровней эстрогена и прогестерона сохраняется регулярность менструального цикла, возможность зачать и выносить ребенка.

После 45 лет в женском организме происходит гормональная перестройка, проходящая в три этапа:

  • Пременопауза длится с первых признаков угасания функции яичников до последних месячных. Этот этап продолжается от 2 до 10 лет и характеризуется яркими симптомами климакса:
    • снижается секреция слизистых желез, в результате чего появляется сухость и жжение во влагалище;
    • ухудшается качество половой жизни;
    • эмоциональная неустойчивость;
    • головокружение и мигрень;
    • приливы;
    • скачки артериального давления;
    • нарушение обменных процессов;
    • потливость;
    • выделения из влагалища.
  • Менопауза длится 12 месяцев с момента последней менструации.
  • Постменопауза тянется до конца жизни.

Виды выделений в менопаузе

Появление выделений провоцирует гормональный дисбаланс в период пременопаузы.

Нормальными выделения при климаксе считаются:

  1. Белые, не имеющие запаха и не сопровождающиеся чувством дискомфорта. Со временем количество белей уменьшается.
  2. Кровяные или розовые выделения скудного характера, появившиеся в пременопаузе, как результат частичного сохранения функциональности яичников. Поэтому мазня при климаксе на начальной стадии – это нормально. Период между такими выделениями будет увеличиваться. После прекращения функционирования яичников могут появляться прозрачные водянистые однородной консистенции.
  3. Мажущие выделения при климаксе могут появиться на фоне приема гормональных препаратов, употребление которых необходимо для блокирования негативных симптомов.

В период менопаузы организм женщины становится уязвимым. Снижение секреторной функции желез слизистых оболочек снижает местный иммунитет, что повышает вероятность заражения инфекционными заболеваниями.

Как понять при климаксе, что появившиеся выделения — норма? Признаками патологии являются:

  • желтые или темные выделения;
  • обильный секрет, имеющий резкий неприятный запах, неоднородной консистенции;
  • сукровичные выделения через год после климакса;
  • выделения сопровождаются зудом и жжением.

Какие выделения бывают при климаксе:

ТипСопровождающие симптомыВозможные причины появления
СлизистыеРезкий запах тухлой рыбы, пенообразная консистенция, обильность выделенийИнфекционные и воспалительные заболевания (хламидиоз, гарднереллез, трихомониаз и др.).
ГнойныеЖелто-зеленый цвет, неприятный тухлый запах, боль в малом тазу, возможны симптомы интоксикацииВенерические заболевания, неспецифический вагинит бактериальной природы.
ВодянистыеС примесью слизи, зуд и жжение при мочеиспусканииДисбиоз влагалища, уреаплазменная инфекция

Отдельно следует рассмотреть два типа выделений:

  • Творожистые, являющиеся продуктом жизнедеятельности грибков рода Candida. Молочница при климаксе имеет и другие характерные симптомы:
    • зуд;
    • жжение при мочеиспускании;
    • выделения белого или светло-желтого цвета, имеющие кислый запах.
  • Кровянистые выделения при климаксе, причины появления:
    • гиперплазия эндометрия;
    • миома матки;
    • эндометрит;
    • эрозия шейки матки;
    • полипы;
    • злокачественные опухоли;
    • травмы влагалища;
    • воспаление шейки матки или слизистой влагалища.

Если после менопаузы кровянистые выделения сопровождаются болевыми ощущениями внизу живота, необходимо незамедлительно пройти обследование.

Опасные симптомы

Наибольшее беспокойство вызывают кровяные выделения, появившиеся в период менопаузы и постменопаузы. После того как закончилась последняя менструация, детородная функция полностью утрачивается. Матка становится меньше, эндометрий истончается, прекращается синтез половых гормонов.

Кровяных выделений из влагалища в период менопаузы быть не должно. А в постменопаузе являются симптомом серьезного гормонального сбоя, развития онкологических процессов и иных заболеваний репродуктивных органов.

Появившиеся во время менопаузы розовые выделения являются признаком выхода жидкости из лимфатической системы репродуктивных органов при повреждении их тканей. Экссудат такого характера, а также коричневые выделения после 60 лет у женщин, сопровождающиеся чувством боли в малом тазу, могут являться признаком доброкачественных или злокачественных новообразований в детородных органах, гиперплазии эндометрия, дисплазии шейки матки.

Сочетание кровяных и водянистых выделений при климаксе – возможный симптом рака матки или шейки матки, придатков, влагалища.

Развитие злокачественных опухолей в репродуктивных органах также сопровождается:

  • болевыми ощущениями внизу живота при физической нагрузке;
  • кровянистыми выделениями с запахом гнилого мяса;
  • ощущением инородного предмета внутри половых органов;
  • гнойными выделениями.

Диагностика

При появлении нехарактерных выделений и иных тревожных симптомов необходимо обратиться к гинекологу. В дальнейшем может потребоваться консультация эндокринолога, онколога, маммолога, хирурга.

Для диагностирования причин нехарактерных выделений необходимы:

  • общие анализы крови и мочи;
  • мазок из влагалища на флору;
  • бактериологический посев;
  • анализ крови на содержание гормонов;
  • анализы для определения возбудителей ЗППП;
  • анализ на онкоцитологию;
  • мазок на выявление вируса папилломы человека.

Обязательно проводятся осмотр на гинекологическом кресле. По показаниям назначается УЗИ репродуктивных органов, кольпоскопия, УЗИ и рентген молочных желез. При необходимости выполняется гистероскопия с биопсией. Вовремя выявленная патология позволяет спасти жизнь женщины.

Лечение

Лечение патологических выделений в период менопаузы сводится к устранению причины их появления:

  • При инфекционных заболеваниях необходимо пройти курс противовоспалительной терапии. В этом случае назначаются антибиотики и свечи, обладающие бактерицидным действием (Гексикон, Полижинакс, Метронидазол и др.).
  • Молочница при климаксе лечится противогрибковыми препаратами (Флуконазол, Дифлюкан, Нистатин, Пимафуцин и др.), которые могут использоваться местно и внутрь.
  • При атрофии желез слизистой влагалища может потребоваться прием гормональных препаратов. В дополнение назначаются вагинальные суппозитории (Овестин, Эстриол), средства, поддерживающие баланс микрофлоры.
  • При обильных кровяных выделениях назначаются кровоостанавливающие медикаменты.
  • При диагностировании онкологических процессов необходимо оперативное вмешательство. Наиболее подвержена раку шейка матки.
  • По показаниям при развитии онкологических процессов назначается гормональная и лучевая терапии.
  • На поздних стадиях развития рака у женщин периода менопаузы матка удаляется полностью без сохранения придатков. Дальнейшее лечение заключается в прохождении химиотерапии.

Примерная схема терапии при самых распространенных гинекологических заболеваниях во время климакса

ДиагнозКонсервативная терапияХирургическое лечение
Миома маткиАгонисты гонадотропин рилизинг гормона, гестагеныМиомэктомия, гистерэктомия
Гиперпластический процесс эндометрияАгонисты гонадотропин рилизинг гормона, гестагеныГистерэктомия
Полипы эндометрияНе проводитсяПолипэктомия
Эндометрит, сальпингоофоритАнтибактериальная, противогрибковая терапияУдаление матки и/или придатков при выраженном гнойном поражении
Опухоли яичниковНе проводитсяУдаление яичника
Патология шейки маткиДеструктивные методы (криодеструкция, лазерное, аргоноплазменное, радиоволновое прижигание)Конизация шейки матки
Злокачественные опухоли матки и придатковНе проводитсяУдаление органа с последующей лучевой и химиотерапией

Прогноз и профилактика

Профилактика появления выделений при климаксе заключается в укреплении иммунной системы.

Для своевременного обнаружения опасных патологий женщинам после 45 лет необходимо регулярно проходить гинекологический осмотр, УЗИ репродуктивных органов, сдавать анализы на выявление возбудителей ЗППП.

Комплексное лечение гинекологических заболеваний при климаксе гарантирует благоприятный исход лечения. Вовремя начатое лечение онкологических заболеваний в большинстве случаев проходит успешно.

Полезные советы

Сбой обменных процессов в организме при климаксе приводит к тому, что запах тела у женщины становится резким и кислым, нарушается микрофлора, появляются проблемы с ЖКТ. Поэтому в климактерическом возрасте особое внимание следует уделить питанию. Рацион нужно обогатить свежими овощами и фруктами, маложирными кисломолочными продуктами, которые способствуют нормализации пищеварения.

Полезно употреблять большое количество жидкости, в том числе настоев и чаев на основе трав, содержащих фитогормоны (душица, шалфей, боярышник, липовый цвет и др.).

Поскольку количество вырабатываемого внутреннего секрета влагалища снижено в период менопаузы, рекомендуется во время интимной близости использовать специальные гипоаллергенные смазки. Это позволяет снизить риск травмирования стенок влагалища и предотвратить кровяные выделения.

Для поддержания эластичности тканей влагалища рекомендуется выполнять гимнастические упражнения Кегеля.

причины появления и методы лечения

Является естественным переходным этапом в жизни женщины, который предшествует менопаузе. Пременопауза является этапом репродуктивной жизни женщины, который начинается за несколько лет до менопаузы, когда яичники постепенно снижают продукцию эстрогенов. Такое состояние, как правило, развивается к 40 годам, однако у некоторых женщин изменения в репродуктивной системе могут начаться и с 30 лет.

Пременопауза, являясь переходным периодом может длиться от 2 до 11 лет, до полного прекращения менструаций. Период пременопаузы начинается, когда деятельность репродуктивной системы женщины замедляется, что приводит к снижению продукции гормонов (главным образом эстрогенов и прогестерона). Пременопауза – это интервал, в котором женский организм делает естественный переход от регулярных менструальных циклов и ежемесячной овуляции к нерегулярным менструальным циклам, ановуляции и постоянному естественному бесплодию.

Женщины подходят к пременопаузальному периоду в разном возрасте, но в большинстве случаев, это происходит к 40 годам. Первым сигналом пременопаузы являются нерегулярные менструации — задержки, отсутствие менструаций в течение нескольких циклов, короткие и скудные менструальные кровотечения, иногда в виде коричневых выделений.

Тёмно-коричневые влагалищные выделения вместо нормального менструального кровотечения являются распространенным симптомом пременопаузы. В пременопаузу женщины могут также наблюдать такие симптомы, как приливы, ночная потливость, перепады настроения, нарушения сна, сухость влагалища и т.д. Замещение менструального кровотечения коричневой мазнёй происходит вследствие понижения уровня женских половых гормонов и недостаточной трансформации эндометрия. Постепенно менструальные циклы в виде коричневой мазни прекращаются и у женщины наступает менопауза.

Характер коричневых выделений, которые женщина может наблюдать в пременопаузальном периоде, зависит от гормонального статуса, образа жизни, физической активности, и т.д. Так, некоторые женщины наблюдают коричневую мазню каждый месяц, другие раз в несколько месяцев. Длительность периода нерегулярных менструаций у каждой женщины индивидуальна. У некоторых этот этап короткий и завершается внезапной менопаузой, у других может длиться несколько лет. Однако, как правило, продолжительность периода нерегулярных менструаций, включая появление коричневых выделений, длится около года.

Появление коричневых выделений связано с понижением уровня женских половых гормонов и атрофией эндометрия, на фоне которой, сосуды внутренней слизистой Оболочки матки становятся хрупкими и могут легко кровоточить. Повышение уровня фолликулостимулирующего гормона (ФСГ) говорит о начале менопаузального периода. Уровень ФСГ женщина может проверить самостоятельно с помощью специальных тестовых систем.

Несмотря на то, что нерегулярные коричневые выделения в пременопаузальный период явление довольно частое, в некоторых случаях нарушения менструального ритма, необходима консультация гинеколога:

  • Обильное вагинальное кровотечение после периода коричневых выделений;
  • Неожиданное вагинальное кровотечение после 6 месяцев коричневых выделений;
  • Любое вагинальное кровотечение, которое длится дольше двух недель (с наличием или отсутствием коричневых выделений).

Женщины в пременопаузальном периоде, наблюдающие подобные нарушения менструального цикла и страдающие атериальной гипертензией, ожирением, сахарным диабетом, имеют повышенный риск развития рака эндометрия.

Как ни странно, некоторые женщины считают, что при нормальной работе организма, влагалищных выделений быть не должно, вследствие чего их появление, в независимости от характера и интенсивности, становится поводом для беспокойства. Следует понимать, что наличие выделений из влагалища — физиологическая норма, естественный процесс, сопровождающий женщину на протяжении всей жизни.

Чтобы понять, какие изменения в характере влагалищных выделений считаются нормальными для периода менопаузы, а что является патологией, необходимо разобраться в основных характеристиках данного процесса.

Основным назначением выделений из влагалища является смазка тканей влагалища и защита внешних половых органов от инфекции. Интенсивность нормальных выделений индивидуальна для каждой женщины, зависит от возраста, гормонального фона, сексуального возбуждения и других факторов. В состав выделений входят эпителиальные клетки, слизь, жидкость, бактерии и другие микроорганизмы. Запах — легкий, кисловатый, вследствие кислотной среды слизистой влагалища, или отсутствует.

В период климакса, нестабильный гормональный фон в большей или меньшей мере влияет на работу всего женского организма, поэтому характер и интенсивность влагалищных выделений также меняется. У женщин, в периоде пременопаузы, нормальная интенсивность выделений — от 2 до 5 мл в сутки. С течением времени, интенсивность уменьшается, что может вызвать неприятные и болезненные ощущения. Сухость влагалища, вследствие уменьшения количества природной смазки, является одной из наиболее распространенных проблем женщин в периоде климакса.

Чаще, данное явление объясняется следующими физиологическими процессами:

Вульвовагинальная атрофия — ткани вульвы и слизистой оболочки влагалища становятся суше, истончаются и теряют упругость. Количество вагинальных выделений уменьшается и, соответственно, естественной смазки становится меньше. Регулярная половая активность, в этом случае, способствует сохранению тканей влагалища.

Атрофический вагинит — воспалительное заболевание слизистой оболочки влагалища, обусловленное дефицитом эстрогена либо старением организма. Атрофические изменения слизистой влагалища (истончение эпителия, сглаживание вагинальных складок) служат фоном для развития хронических воспалительных процессов, требующих лечения. Это наиболее частое гинекологическое заболевание у женщин в климактерическом периоде. Атрофический вагинит не передается половым путем.

В случае вульвовагинальной атрофии уменьшение количества выделений спровоцировано естественными процессами в женском организме во время климакса, тогда как развитие воспалительных процессов на фоне атрофического вагинита может быть чревато серьезными осложнениями.

Одними из основных симптомов заболеваний мочеполовой системы являются патологические влагалищные выделения.

Изменение структуры, запаха, цвета, интенсивности выделений может свидетельствовать о развитии заболевания, поэтому женщина должна внимательно относиться к «сигналам» организма и четко понимать, что любое нехарактерное проявление может быть симптомом развивающегося заболевания. Ниже приведены наиболее распространенные заболевания урогенитальной сферы, которым свойственны патологические выделения:

Заболевание Характерные особенности влагалищных выделений Сопутствующие симптомы
Рак шейки матки белые или кровянистые; кровотечение во время или после полового акта на ранних стадиях протекает бессимптомно; по мере развития сопровождается болями в области крестца, поясницы, внизу живота
Рак эндометрия (тела матки) водянистые, с небольшим количеством крови, в развитии — обильные кровяные выделения; на поздних стадиях могут присутствовать гнойные сгустки боль в области таза, боль при мочеиспускании, при половом акте; на поздних стадиях — снижение массы тела, повышенная утомляемость
Саркома матки обильные, водянистые, с неприятным запахом боли в области таза; на ранней стадии развития симптомы выражены незначительно
Кандидоз (молочница) белые, творожистые, с кисловатым запахом, мазеподобные или жидкие; в некоторых случаях — зеленоватого оттенка зуд или жжение в области наружных половых органов; резкая боль при половом акте, мочеиспускании; часто болезнь протекает в скрытой форме
Цервицит обильные слизистые или гнойные, белого или желтого цвета, с кровяными сгустками редко проявляется боль внизу живота; может протекать в скрытой форме
Кольпит слизистые, гнойные, молочного или серого цвета, с запахом «гнилой рыбы»; с развитием болезни становятся желто-зеленого цвета, пенистыми, липкими; зуд и жжение в области гениталий, боль при мочеиспускании; в хронической стадии симптомы практически не проявляются; при обострении, оболочка влагалища становится ярко-красной, развивается отек
Воспаление органов малого таза густые, с неприятным запахом боли в нижней части живота, нижней части спины, повышенная усталость, рвота, понос, болезненное мочеиспускание, боли во время полового акта
Инородный предмет во влагалище обильные выделения, мазеподобные или жидкие, со сгустками крови; кровотечение зуд иди жжение в области гениталий, боль при мочеиспускании, боли или дискомфорт внизу живота
Трихомониаз (трихомоноз) обильные, белые или желто-зеленого цвета, пенистые или водянистые, с резким запахом рыбы зуд в области гениталий, боль во время мочеиспускания, полового акта, покраснение гениталий, отек половых губ
Хламидиоз белого, желтого цвета или прозрачные; кровотечение при половом акте боль внизу живота, боль при мочеиспускании, мутная моча, зуд в области гениталий; часто протекает бессимптомно
Гонорея (триппер) гнойные, сливкообразные боль при мочеиспускании, ложные позывы и учащенное мочеиспускание, боль внизу живота, зуд и жжение во влагалище; часто протекает бессимптомно

При первых проявлениях патологических влагалищных выделений, необходимо обращение к врачу — большинство заболеваний «маскируются» на ранних стадиях, могут проходить бессимптомно. Самостоятельно определить природу патологических выделений из влагалища в абсолютном большинстве случаев невозможно, так как для этого необходимо проведение лабораторного анализа. Сходные симптомы, в том числе, изменение характера выделений, имеют различные патологии, поэтому разобраться в ситуации может только гинеколог. Следует помнить, что каждое заболевание в «запущенном» состоянии может не только сопровождаться осложнениями, но приобрести хронический характер и спровоцировать развитие сопутствующих заболеваний мочеполовой системы.

Уделяя должное внимание здоровью, можно заметно снизить или устранить проявления неприятных симптомов. Даже не имея никаких жалоб и несмотря на возраст, каждая женщина должна посещать гинеколога минимум 2 раза в год. При наличии настораживающих симптомов, необходимо посетить врача без промедления, так как чем раньше начать лечение, тем выше шанс на его благоприятный исход.

Климакс подстерегает всех женщин на определенном этапе их жизни.

Наступление климактерического периода связано с гормональной перестройкой в организме .

На физическом уровне климакс протекает достаточно ощутимо: период гормональных изменений связан с перестройкой работы внутренних органов, что не может не сказаться на их деятельности.

Симптомы климакса могут быть ярко выражены, а могут протекать вяло и безболезненно. Слабая симптоматика свидетельствует о мягком течении климакса и быстрой адаптации организма к изменениям.

Изменения в организме

Причиной всех происходящих изменений в организме во время климакса является снижение функции яичников. Женский половой гормон, который вырабатывается яичниками, имеет влияние на работу многих органов и их систем.

Ощутимыми для организма изменениями являются преобразования, касающиеся органов :

  • матки и придатков . Маточные (фаллопиевы) трубы претерпевают структурные изменения, просвет в них сужается, происходит разглаживание складок. Внутренняя полость матки становится значительно меньше, часть волокон замещается клетками соединительной ткани;
  • наружных половых органов . Сокращается жировая прослойка в наружных кожных покровах, уменьшается количество волосяного покрова на лобковой части;
  • влагалища . Существенно увеличивается сухость вагинального прохода, риск травматичности и инфекции внутренних кожных покровов;
  • груди . Жировая ткань истончается, заметно снижается тонус и объем;
  • мочевыводящих органы . Сфинктер мочевого пузыря теряет мышечный тонус, мочевой пузырь может менять положение;
  • эндокринной системы . Щитовидная железа, кора надпочечников, поджелудочная железа работают в ином режиме, что приводит к расстройствам нервной системы, приливам, повышению сахара, скачкам артериального давления;
  • сердечно-сосудистой системы . Снижение эластичности сосудов приводит к тахикардии;
  • кожных покровов . Состояние кожи значительно ухудшается, она становится сухой, образуются морщины, шелушение;
  • мышц . Мышечные волокна существенно ослабевают, утрачивают тонус, особенно в репродуктивных органах;
  • костной ткани . Кости становятся более хрупкими, пористыми, подверженными к переломам при незначительном механическом воздействии.

ОБРАТИТЕ ВНИМАНИЕ!

Остроту и влияние всех изменений в организме можно значительно снизить, если принимать дополнительно витамины и придерживаться правильного питания.

Это касается не только климактерического периода, но предварительно и после менопаузы важно придерживаться здорового образа жизни.

Могут ли при климаксе быть выделения

В любом возрасте незначительные слизистые выделения без присутствия в них крови и запаха (если это не менструальные выделения) являются естественным состоянием: это подтверждает функционирование слизистых тканей стенок вагинального прохода. Однако, во время климактерической перестройки в целом слизистый покров существенно уменьшается и возникает сухость кожи влагалища. Естественные слабые бели без запаха являются нормой .

Если выделения во время климактерического периода отличаются неприятным запахом, имеют густую структуру, отличительный от молочного цвет, либо отличаются кровяными мазками или обильной кровяной секрецией, то такие выделения можно отнести к патологическим, они сигнализируют о наличии внутреннего заболевания . Необходимо обратиться к врачу для обследования и необходимого лечения.

Виды

Слизистые чаще всего — норма, если их количество не превышает 5 мл в сутки. Слишком обильные являются патологией, так как их количество в связи со снижением секреции слизистой должно наоборот сокращаться.

ОСТОРОЖНО!

Кровяные выделения в постменопаузу могут свидетельствовать об онкологии, поэтому необходимо срочно обратиться к врачу.

Читайте также про причины появления после климакса.

Гнойные процессы свидетельствуют о воспалительных или инфекционных процессах. Чаще всего имеют желтый или зеленоватый оттенок. Не следует медлить с визитом к специалисту.

Творожистые чаще всего сопровождаются зудом в промежности, причиной чего является наличие грибковых инфекций, возникающих из-за травматичности сухих стенок влагалища. Молочница — самая распространенная причина творожистообразных выделений .

Причины появления выделений при менопаузы

В период климакса происходят не только гормональные изменения в организме. Иммунная система переживает значительный стресс, поэтому противостоять инфекциям организму значительно сложнее. Особенно это касается кожных покровов влагалища: сухость приводит к травматичности, мазне и подверженности влиянию любых бактерий.

Распространенными причинами появления выделений являются :

  • вагинит;
  • воспаление шейки матки;
  • раковые процессы;
  • хламидиоз;
  • молочница;
  • гонорея;
  • полипы.

Эти и другие процессы могут провоцировать появление выделений. Следует обратиться к врачу для диагностики и лечения патологических процессов.

Менопаузу можно смело охарактеризовать как самый тяжелый этап, который наступает в жизни каждой женщины. Происходит постепенное угасание репродуктивной функции, изменяется гормональный фон, начинается комплексная перестройка организма. В это непростое время практически каждая женщина сталкивается с неприятными соратниками менопаузы, каждый из которых доставляет неудобство и дискомфорт. Быть поводом серьезных переживаний могут кровянистые выделения при климаксе, причину возникновения которых важно выявить своевременно.

В большинстве случаев явление такого рода относится к вариантам нормы и не причиняет серьезных проблем. Но в некоторых случаях симптом может быть свидетельством наличия серьезного заболевания. Стоит поговорить более подробно о том, при появлении каких выделений при климаксе следует бить тревогу и незамедлительно обратиться к врачу.

Особенности климактерического периода

Климактерий представляет собой своеобразный возрастной и физиологический барьер, переступив который, женщина утрачивает способность к рождению потомства. При достижении женщиной возраста 45 – 50 лет, происходит постепенное угасание деятельности яичников и гормональной активности, обеспечивающей полноценное функционирование репродуктивной системы.

Один из естественных физиологических процессов, который видоизменяется с наступлением климакса – выделения. Появление небольшого количества жидкости из половых органов является абсолютно нормальной особенностью женского организма. Этот процесс обеспечивает естественное очищение слизистых тканей, препятствуя проникновению патогенной микрофлоры.

Однако после менопаузы под влиянием гормональных перестроек организма количество слизи существенно уменьшается вплоть до болезненной сухости влагалища. Специалисты подразделяют климактерий на три основных этапа, каждый из которых характеризуется определенной симптоматикой, отклонение от норм которой может быть свидетельством развития патологий.

  • Пременопауза или ранний климактерий. Началом его считается этап появления первых физиологических изменений, затрагивающих репродуктивную функцию, которые характеризуются выраженными симптомами, например, повышенной потливостью, приливами, нарушениями менструального цикла, повышенной утомляемостью. Логическим завершением периода пременопаузы, который длится около шести — семи лет, является прекращение месячных. При этом такого рода выделения у женщин при климаксе могут появляться как систематически, так и хаотично. Во многом указанная особенность зависит от состояния здоровья женщины.
  • Менопауза. Как правило, этот этап длится не более года и может считаться завершенным только в том случае, если с момента завершения последней менструации прошло двенадцать месяцев. Слизистые выделения в период менопаузы появляются в минимальных количествах, не имеют оттенка и не причиняют дискомфорта.
  • Постменопауза. Особенность постменопаузального периода — общая его продолжительность. Этот этап начинается сразу после менопаузы и продолжается на протяжении всей оставшейся жизни.

Абсолютная норма на протяжении всех трех этапов климактерия — слизистые жидкости, обладающие однородной консистенцией. Что касается менструаций, то продолжительность между циклами постепенно увеличивается, уменьшается количество теряемой крови.

Важно! В той ситуации, если выделения во время климакса приобретают нехарактерный цвет, например, желтый или коричневый, следует немедленно обратиться к специалисту для выявления причин.

Признаки патологий

Выделения из влагалища во время менопаузы могут носить и патологический характер, что происходит, как правило, по причине развития воспалительных процессов и заболеваний инфекционной или неинфекционной природы. Подобные патологи характеризуются также появлением дополнительных симптомов, к числу которых относят болезненные ощущения в нижней области живота, трудности с мочеиспусканием, ухудшение общего самочувствия.

Не отнесенные к вариантам нормы отделение секрета у женщин в период климакса отличаются следующими особенностями:

  • Появление слизи сопровождается зудом, покраснениями, жжением, раздражением слизистых тканей и кожи половых органов.
  • Нарушается их консистенция, они становятся жидкими и водянистыми.
  • Также они могут быть чрезмерно густыми, творожистыми, не исключено появление сгустков крови, гноя, белесых прожилок.
  • Появляется неприятный запах.

Между менструациями или в последующем в слизи может появиться кровь. Этот симптом относится к числу наиболее опасных. Причиной его может быть и онкологическое заболевание.

Кровянистые

Как уже было отмечено выше, кровянистые выделения возникающие при климаксе относят к числу наиболее опасных симптомов. В зависимости от того, какой цвет, консистенцию и запах имеет отделяемый секрет, можно сделать соответствующие выводы о состоянии здоровья женщины. В подавляющем большинстве случаев кровянистые выделения в менопаузе являются симптомом следующих патологий:


  • Возрастные изменения. Кровянистые выделения в менопаузу могут быть вариантом относительной нормы в том случае, если к причинам их относятся возрастные изменения, характеризующиеся истончением, снижением эластичности и атрофией слизистых тканей. Чаще всего мажущие выделения в незначительном количестве появляются после полового акта или врачебных осмотров.
  • Воспалительные процессы. Характерными особенностями заболеваний воспалительного патогенеза являются следующие: выделяемый секрет приобретает выраженный неприятных запах, а также желтоватый оттенок, свидетельствующий о примеси незначительного количества крови. Возможно появление слизистых сгустков и гноя.
  • Онкологические заболевания. Кровянистые выделения после климакса, а также непосредственно в менопаузе могут быть симптомами роста злокачественной опухоли. Но следует отметить, что на ранних этапах развития онкологического заболевания появление крови относят, скорее, к исключениям.

Читайте также по теме

О чем свидетельствует появление розовых выделений перед месячными?

Факторами, провоцирующими отделение кровянистого секрета, могут стать гинекологические заболевания, в том числе, эрозия шейки матки, миома и другие. Важно помнить, что даже разовое появление кровянистых выделений в менопаузе, причины которых могут быть более чем серьезными — это повод незамедлительного обращения к врачу.

Важно! Кровяные выделения в постменопаузе, а также в раннем климактерии могут быть отнесены к вариантам нормы только в том случае, если секрет выделяется в умеренных количествах после полового акта. Для предупреждения повреждения слизистых тканей рекомендуется использовать специальные гели.

Творожистые

Особенно распространенным симптомом среди женщин любого возраста являются белые или желтого цвета выделения, обладающие характерной творожистой консистенцией и неприятным резким запахом. Чаще всего они сопровождаются сильным зудом, жжением, болезненностью в области нижней части живота и ухудшением общего самочувствия. Перечисленные симптомы являются признаками кандидоза – грибкового поражения слизистых тканей.

Кандидоз или молочница относится к числу особенно распространенных болезней и возникает у дам любого возраста. Проведение лечения в данном случае обязательно, в противном случае существует вероятность развития воспалительных процессов и усугубления состояния больной.

Также творожистый секрет с неприятным запахом может быть одним из признаков заболеваний инфекционной природы, передающихся половым путем, например, хламидиоза, уреаплазмоза и других. Независимо от количества отделяемой слизистой жидкости и наличия запаха, выделения такого рода не относятся к вариантам нормы, соответственно, при появлении подобных проблем важно своевременно выявить причину и начать лечение.

Слизистые

Слизистые выделения при менопаузе, в том числе, у женщин после 60 лет и более, если они появляются в умеренных количествах, не обладают неприятным запахом и не сопровождаются жжением и зудом, относятся к числу нормальных и не причиняют беспокойства. Единственное, на что следует обратить внимание – соблюдение правил личной гигиены. Засыхание на коже слизистой жидкости может привести к зуду и покраснению.


Однако если слизистая жидкость отделяется в больших количествах, меняет консистенцию, цвет и запах, это может быть симптомом воспалительных процессов или инфекционных поражений половых органов. Чаще всего обильное количество слизистого отделяемого является признаком воспаления шейки матки или тканей влагалища.

Водянистые

Отделение в умеренных количествах водянистого секрета является нормой, но только в том случае, если женщина имеет репродуктивный возраст. В период менопаузы водянистый секрет может быть симптомом серьезных гинекологических заболеваний, в числе которых, например, саркома матки.

Гнойные

Гнойные или сукровичные выделения по праву относятся к числу тревожных признаков развития заболеваний воспалительной или инфекционной природы. Чаще всего гнойный секрет с запахом отделяется на фоне заболеваний, передающихся половым путем. В этом случае возможно присоединение косвенных признаков, таких, например, как болезненные ощущения в нижней части живота, сильный зуд и жжение в области наружных половых органов, ухудшение общего самочувствия.

Причины патологий

Патологические выделения при климаксе у женщин чаще всего свидетельствуют о развитии каких-либо патологий. Кроме того, они могут быть следствием гормональных или эндокринных нарушений, патологий органов малого таза, воспалительных процессов.

Важно! Обратиться в медицинское учреждения для постановки диагноза и назначения лечения следует при выявлении даже незначительных симптомов. Устранить любой недуг значительно проще на ранних этапах его развития.

Заболевания инфекционного и воспалительного патогенеза

Одна из наиболее частых причин выделений в менопаузальный период – развитие воспалительных процессов. Причиной их является истончение и атрофия слизистых тканей, появление трещинок на стенках влагалища и занесение болезнетворных микроорганизмов. Патологиями, сопряженными с развитиями воспалений, являются:

  • Цервицит. Это воспалительный процесс, поражающий слизистые ткани стенок матки. Недуг отнесен к числу распространенных и выявляется у каждой пятой пожилой дамы. Объяснить это достаточно просто – угасание репродуктивной функции характеризуется также ослаблением иммунных сил и снижением резистентности к негативному действию патогенной микрофлоры. Особенность цервицита — коричневые выделения при климаксе, нередко сопряженные с отторжением сгустков гноя.
  • Вульвовагинит. Недуг также характеризуется в качестве болезни воспалительного патогенеза, поражающего слизистые ткани стенок влагалища. При данной патологии выделения могут быть серого или белого цвета. Как правило, секрет в данном случае обладает неприятным запахом рыбы.

Читайте также по теме

Какие причины возникновения кровянистых выделений после месячных?

Если в период климакса появились отделяемые секреты белого или желтоватого цвета, они, как правило, говорят о развитии воспалительных процессов, некоторые из которых приведены выше. Кроме того, подобные симптомокомплексы могут быть последствием грибковых поражений, к числу которых относится и кандидоз.

Заболевания, передающиеся половым путем

Говоря о том, какие выделения при климаксе считаются нормальными, а какие говорят о протекающих в женском организме патологических процессах, нельзя не акцентировать внимание на столь актуальную в настоящее время проблему распространенности недугов, передающихся половым путем. К сожалению, в климактерии женщина также подвергается риску заражения малоприятными болезнями. Соответственно, вопрос о необходимости применения барьерных средств контрацепции все столь же актуален даже на фоне отсутствия риска наступления беременности.


Гнойные, белые или желтые выделения при климаксе могут быть симптомом следующих патологий:

  • Гонорея. Секрет приобретает зеленый или серый оттенок, становится более густым и обладает неприятным запахом. Дополнительными признаками патологии являются: сильный зуд, жжение, постоянные позывы к посещению туалета.
  • Хламидиоз. Обращая внимание на характер выделений при климаксе, какие возможно говорят о развитии процессов воспаления, следует насторожиться, если секрет становится более жидким и приобретает белесый оттенок. Этот признак вполне может быть отнесен к заражению хламидиозом. Дополнительным отличием патологии является изменение цвета мочи – она становится более мутной и приобретает резкий запах.
  • Трихомониаз. При заражении секрет становится более жидким и пенистым. Кроме того, возможен интенсивный неприятный запах.

При инфекционных поражениях слизистых тканей половых органов не могут быть исключением темные или розовые кровянистые выделения в период климакса. Как правило, они говорят об истончении и механическом повреждении тканей стенок влагалища, возникновение которых возможно при совершении полового акта или при гинекологическом осмотре.

Гормональные изменения

Перестройка гормонального фона является вполне естественным физиологическим процессом при менопаузе. Обусловлено это угасанием функций яичников и постепенным снижением вырабатываемых женской репродуктивной системой гормонов. На фоне значительных изменений вполне нормальными являются кровянистые выделения в постменопаузе и непосредственно в период климактерия. Однако в некоторых случаях гормональные нарушения и перестройки могут привести к развитию недугов и патологий, в числе которых:


  • Миома матки. Сопровождается развитием опухоли в мышечных тканях стенок матки. Миома может быть сопряжена с сильным кровотечением или выделениями с кровянистыми прожилками.
  • Полипы. Об их разрастании свидетельствует слизь светло – серого или белесого оттенка с прожилками крови. Почему появляются полипы? Как правило, они образуются по причине нарушения целостности стенок матки, которое происходит при проведении аборта или иных хирургических вмешательств, и представляют собой плотные патологические разрастания тканей.
  • Эрозия шейки матки. Одна из наиболее частых патологий. Эрозия представляет собой патологическое изменение тканей шейки матки и сопровождается болезненными ощущениями и незначительным количеством кровянистой слизи. В том случае, если кровь на фоне эрозии будет выделяться в течение длительного времени, важно своевременно обратиться за помощью в медицинское учреждение.
  • Эндометриоз. Своеобразной климактерической особенностью, причиной которой является снижение количества вырабатываемых женских гормонов, называется снижение интенсивности разрастания эндометрия. То есть, в период климакса женщины, страдающие эндометриозом, отмечают полное излечение. Однако нарушения гормонального фона могут привести и к интенсивному разрастанию эндометрия. Как правило, подобное случается на фоне перенесенных болезней инфекционного и воспалительного патогенеза.

Следует знать, что болезни, включенные в приведенный выше список, особенно тяжело поддаются лечению именно при климактерии, что обусловлено глобальными изменениями гормонального фона, ослаблением иммунного барьера, а также рядом иных причин. Начинать лечение необходимо своевременно, так как упущение сроков может привести к весьма негативным последствиям.

Важно! На ранних этапах, а также после завершения климактерического периода эндометриоз – это один из факторов, предрасполагающих развитие онкологических образований.

Итак, при климаксе выделения являются вариантом нормы только в том случае, если они не имеют цвета, запаха, появляются в незначительных количествах и не сопровождаются зудом, болезненными ощущениями или жжением. При выявлении любого беспокоящего симптома важно своевременно выявить причину его возникновения и начать применение адекватной терапии. Быстро устранить недуг и предупредить осложнения можно только при условии своевременно принятых терапевтических мер.

Высшее медицинское образование, врач венеролог, кандидат медицинских наук.

Женская половая система функционирует благодаря достаточно сложным процессам, независимо от возраста и состояния организма.

Если появились коричневые выделения при климаксе, то важно понимать и разбираться в симптоматике, относящейся к нормальному состоянию или патологическому.

Любой случай требует консультации лечащего врача.

Процессы в организме женщины в период менопаузы

Наступление климакса и перестройка организма происходит в течение нескольких лет . Завершение этого периода характеризуется полным прекращением . После наступления климакса месячные становятся нерегулярными, а также меняется характер выделений и их обильность.

ОБРАТИТЕ ВНИМАНИЕ!

Для менопаузы характерно постепенное прекращение работоспособности яичников, прекращение выработки женских половых гормонов, организм больше не вырабатывает фолликулов, яйцеклетка не созревает.

Виды

Во время климакса . Существует норма таких выделений, и проявления не должны вызывать беспокойство у женщины.

Но есть и те, которые являются сигналами о патологии :

  • слизистые . Характеризуются ярким, неприятным запахом и консистенцией пены. Встречаются как обильные, так и скудные;
  • гнойные . Густой консистенции, серовато-зелёного цвета, обладают резким и неприятным запахом;
  • творожистые . В консистенцию включены комочки, напоминающие творог. Характеризуются белым цветом и кисловатым запахом;
  • . Могут быть как ярко-красными, так и коричневыми, напоминают сукровицу или скудное кровотечение.

Читайте также про после климакса.

Из вышеуказанных видов кровотечений наиболее опасными являются последние, в особенности если они проявились в постменопаузу .

Коричневые выделения — описание и причины

Выделения, с которыми могут столкнуться женщины при климаксе, бывают различного характера. Они отличаются по цвету и консистенции. Коричневые выделения многие называют «мазней» и она чаще всего не слишком обильна. Если коричневые выделения идут сгустками или в больших количествах, то это тревожный сигнал и важно незамедлительно обратиться к специалисту . Кроме выделений коричневого и светло коричневого цвета, в них могут быть различные включения, по которым в дальнейшем врач сможет диагностировать заболевание, спровоцировавшее таковые.

Для более досконального обследования выделений из влагалища при климаксе можно воспользоваться гигиеническим тампоном. Его помещают во влагалище и через несколько часов достают, после чего изучают характер выделений, а также их обильность.

Причины, которые провоцируют появление коричневых выделений при климаксе, несколько .

Также читайте, почему могут появляться в период менопаузы.

Из наиболее распространённых выделяют такие как :

  • травмы влагалища механического типа . Это связано с тем, что при наступлении менопаузы влагалище теряет влагу и его стенки становятся сухими и, соответственно, подверженными к различным травмам. Повредить целостность стенок влагалища можно во время интимной близости или при осмотре у гинеколога. Если причиной коричневых выделений стала механическая травма, то нет необходимости прибегать к какому-либо специальному лечению. Понадобится лишь в качестве профилактики использовать увлажняющую мазь или свечи, в которых содержатся эстрогены;
  • заболевания шейки матки . Определить данную болезнь можно по коричневым выделением при климаксе, в которых содержатся сгустки крови, при этом выделения обильные. Последний признак является свидетелем того, что есть риск развития онкологии матки. Учитывая, что патология в процессе своего развития зачастую никак не проявляет себя, то диагностировать ее получается лишь на последних стадиях развития. Это является препятствием для лечения и избавления от болезни. Бывают случаи, когда кровянистые или коричневые выделения, появляющиеся из-за рака шейки матки, начинаются через некоторое время после интимной близости, их также сопровождает болевой синдром, иритирующий в поясничный отдел позвоночника;
  • . Заболевание представляет собой опухоль доброкачественного характера в матке. Симптоматикой и для такого заболевания являются коричневые выделения или кровянистые в менопаузальный период. Для выделений и характерна обильность. Если не заниматься лечением патологии и дать возможность ей достигнуть больших размеров, то выявить это можно по симптоматике в виде болевого синдрома в поясничном отделе позвоночника, в крестце и промежности;
  • разрастание матки . Причина, являющаяся одной из самых распространенных, провоцирующих появление коричневых выделений при климаксе. Происходит увеличение количества кожного эпителия внутри матки. Зачастую коричневые выделения при таком недуге становятся кроваво-красного цвета, характер и их изменчив: от обильных до скудных. В дальнейшем есть риск появления малокровия;
  • опухоль яичников . Заболевание, которое проявляет себя весьма странным, нетипичным способом и женщины часто не обращают на них внимания, а точнее, не подозревают, что подобная симптоматика может свидетельствовать о недуге. При появлении патологии кожа, волосы и ногти улучшаются, внешний вид женщины становится более привлекательным и моложавым. Одновременно с этим присутствуют выделения коричневого цвета из влагалища, напоминающие кровь при менструации. Чаще всего женщины предполагают, что такая симптоматика свидетельствует о временном прекращении менопаузы, однако, это весьма тревожный признак, требующий незамедлительного обследования у специалиста;
  • полипы в маточной области . Патология встречается достаточно часто в менопаузальный период. Кроме непосредственных наростов области матки (полипов), болезнь сопровождается появлением какого-либо инфекционного процесса. Выделения при этом имеют коричневый цвет и мажущий характер.

Диагностика проблемы при климаксе

Диагностируют проблему, используя следующие мероприятия :

  • первое, что необходимо сделать — это максимально подробно описать все симптомы и проявления своему лечащему врачу;
  • специалист должен изучить историю болезни;
  • проводят гинекологический осмотр, используя метод пальпации;
  • обследование влагалища при помощи гинекологического зеркала. Метод позволяет выявить наличие опухолевых патологий, повреждения механического характера, полипов;
  • лабораторные исследования, а именно биопсия. Необходима в случае подозрения на наличие онкологических заболеваний;
  • если есть подозрение, что в организме пациентки развивается инфекционный процесс, то проводят анализ для выявления возбудителя.

При обращении к специалисту не факт, что все вышеуказанные мероприятия необходимо пройти. Зачастую ограничиваются осмотром и ультразвуковым исследованием, после чего назначают лечебные мероприятия.

Возможные методы лечения

В случае с коричневыми выделениями, проявившими себя в период менопаузы, методов лечения существует несколько :

  • если наблюдается обильное кровотечение, которое самопроизвольно не прекращается достаточно долго, то есть риск кровопотери и обезвоживания . Лечение в такой ситуации заключается выскабливании избыточного эндометрия из маточной полости. В дальнейшем полученная ткань отправляется на лабораторный анализ для изучения. Выясняется наличие или отсутствие раковых клеток. Только после этого врач проводит назначение;
  • в случае скудных или умеренных коричневых выделений специалист направляет пациентку на УЗИ . Если исследование показало, что нет никаких патологий в органах половой системы женщины, то прибегают к медикаментозной терапии. Она необходима для устранения повышенной чувствительности и ломкости капиллярно-сосудистой сетки, также медикаменты направлены на устранение спазмов, которые провоцируют повреждение сосудов;
  • хирургическое вмешательство требуется в случае обнаружения раковых клеток в матке или других органов половой системы . В такой пораженный орган полностью удаляется, поскольку нет необходимости сохранять его при климаксе. Если удалить лишь фрагмент, поражённый раковыми клетками, есть риск появления рецидива.

Заключение

Несмотря на то, что коричневые выделения при климаксе в некоторых случаях являются абсолютной нормой, рекомендуется обращаться к специалисту. Самостоятельно разобраться в проблеме и диагностировать какое-либо заболевание не представляется возможным. В ситуации, связанной с дисбалансом в работе половой системы, справится только врач.

Полезное видео

Из данного видео вы узнаете, какая причина появления коричневых выделений:

Вконтакте

Тематические материалы:

Обновлено: 15.11.2020

103583

Если заметили ошибку, выделите фрагмент текста и нажмите Ctrl+Enter

Выделения при климаксе какие возможны (мазня): желтые, белые, коричневые

Вагинальная секреция является важным индикатором женского здоровья в любом возрасте. И период климакса не исключение. Хотя женщина теряет репродуктивную функцию, вопросы гинекологического здоровья в этом возрасте как никогда актуальны. Какие должны быть нормальные выделения у женщин при климаксе и на что нужно обратить внимание, чтобы не упустить тревожные симптомы?

Естественные выделения при климаксе

В репродуктивном возрасте на характер и объем вагинального секрета влияют фазы менструального цикла и половые гормоны. Так в первой половине цикла, количество выделений увеличивается по мере роста уровня эстрогена. К моменту овуляции секрет становится более обильным и слизистым, а во второй фазе цикла под влиянием прогестерона наблюдаются более густой секрет.

Фото нормальных выделений в в менопаузе:

Нормальная консистенция варьируется от слизистой до кремообразной. Цвет может быть прозрачным или белым, иногда с бежевым оттенком или желтоватого цвета. У здорового секрета не должно быть неприятного аромата. Он также не должен быть слишком обильным и доставлять какой-либо дискомфорт.

Основная часть вагинального секрета — это слизь выделяемая шейкой матки под влиянием гормонов. Однако с приближением климакса приостанавливается гормональная функция яичников. Уровень эстрогена и прогестерона падает, что не может не влиять на характер выделений. Какие естественные выделения возможны при климаксе?

Логично, что чем меньше эстрогена, тем меньше становится выделений.

При климаксе нормальный объем вагинального секрета составляет 2–3 мл.

Исключением может стать начало пременопаузы. Это переходной период, в котором эстроген все еще выделяется организмом и могут происходить овуляторные циклы.

Из-за нерегулярности менструальных циклов и овуляций, обильная секреция становится более редким явлением и может насторожить. Вероятно, это будет похоже на бели, которые присутствовали у вас в фертильном периоде и не доставит дискомфорта. Цвет секрета при менопаузе в норме не должен отличаться от вариантов фертильного периода. А вот консистенция чаще слизистая, чем густая.

Зуд и сухость в интимной зоне без выделений — результат гормональной перестройки. Из-за дефицита эстрогена постепенно уменьшается объем матки, шейки матки и влагалища. Подобные изменения чреваты неприятными ощущениями во время секса, могут вызывать раздражение половых органов, жжение и зуд.

Менструальные выделения в пременопаузе

Пременопауза — это начальный этап климактерических изменений. В этот период уровень эстрогена уже начинает снижаться, однако в яичниках еще остается небольшое количество функциональных фолликулов. Это означает, что все еще могут происходить месячные в начале климакса. Однако циклы становятся нерегулярными и появляются сильные задержки (от 2 до 6 месяцев).

Характер менструальных выделений также меняется. В первое время кровотечение может стать более обильным и длительным, либо наоборот. Однако по мере снижения уровня эстрогена, менструации будут становиться все более скудными и короткими.

Цвет кровянистого секрета варьируется от бордово-красного до коричневатого. Коричневый оттенок чаще присутствует в последние дни менструации. Это обычная кровь, которая из-за скудного объема успела окислиться до выхода из влагалища.

Коричневые выделения вместо месячных могут появиться в период пременопаузы по причине атрофических изменений матки и эндометрия, вызванных возрастным дефицитом эстрогенов. Такое явление может быть вариантом здоровой нормы, однако существуют и менее естественные причины подобной мазни. Поэтому, появление коричневых выделений вместо менструальной крови, должно стать поводом для обращения к врачу.

Аномальная секреция

Угасание репродуктивной системы провоцирует в женском организме серьезные гормональные нарушения. Поэтому, опасность развития гинекологических патологий в этом возрасте не только не уменьшается, но порой даже возрастает.

Появление аномальных выделений после наступления климакса может свидетельствовать об угрозе для вашего здоровья.

Насторожить должны следующие виды выделений и сопутствующие им симптомы:

  1. кровавые и коричневые мажущие бели не связанные с месячными;
  2. гнойные, ярко желтые и зеленоватые выделения при климаксе;
  3. слизистый секрет с комками, сгустками крови и гноем;
  4. темно-коричневая и черная мазня;
  5. бели со странной консистенцией — водянистые, пенистые, с комочками;
  6. белые творожистые выделения;
  7. наличие неприятного запаха — кисломолочного, тухлого, рыбного;
  8. любые бели, которые сопровождаются болью, зудом и жжением в интимной зоне.

Патологические выделения всегда сопровождаются неприятными ощущениями, физическим и психологическим дискомфортом. Поэтому женщине важно следить за своим состоянием. Особенно должны насторожить кровотечения и плохо пахнущие бели, при которых женщина чувствует слабость, тошноту, головокружение и другие симптомы недомогания.

Кровотечение и выделения с кровью

Кровь в норме может появляться только в связи с приходом менструации. Однако, если такое происходит в межменструальный период, а также после наступления менопаузы — это повод для беспокойства. Кровянистые выделения у женщин после прихода климакса уже не могут считаться менструацией и требуют гинекологической диагностики. Также аномальными являются длительные кровотечения в пременопаузе, даже если они совпадают с возможной менструацией.

Нельзя оставлять без внимания кровавую и коричневую мазню, а также наличие примесей крови и сукровицы в обычных белях (см. фото ниже).

Кровь в выделениях при климаксе часто является симптомом патологий, которые развиваются из-за дисбаланса гормонального фона.

Наиболее частыми виновниками кровотечений и кровавых выделений становятся такие патологии:

  1. Эндометриоз — патология слизистого слоя матки, при которой эндометриальные клетки разрастаются в область яичников, маточных труб и брюшную полость. Причины развития болезни до конца не изучены. Однако известно, что это гормонозависящее заболевание. Усилить патологический процесс способны заболевания эндокринных желез (щитовидной железы и надпочечников), сахарный диабет и гипертония. Помимо кровянистых выделений, заболевание доставляет дискомфортные ощущения в виде тянущих болей внизу живота и пояснице.
  2. Гиперплазия эндометрия в менопаузе — это процесс разрастания и утолщение эндометрия в пределах матки. Чаще всего развивается на фоне гиперэстрогении и дефицита прогестерона в менопаузальном периоде. Болезнь долгое время может протекать бессимптомно. Иногда наблюдаются боли как при эндометриозе. Однако в запущенной форме гиперплазия вызывает сильные маточные кровотечения и симптомы анемии.
  3. Полипы матки — это очаговая форма разрастания эндометрия, которая развивается на фоне гиперпластических процессов эндометрия. Полипы начинают доставлять дискомфорт по мере увеличения их размеров. Так маленький полип может быть обнаружен только на осмотре у гинеколога, а крупный способен стать причиной кровянистой и коричневой мазни, болей во время полового акта, спазмы внизу живота.
  4. Миома матки — это доброкачественная опухоль, которая развивается в мышечном слое органа (миометрии). Новообразование разрастается под влиянием женских гормонов, поэтому миома матки при климаксе чаще регрессирует и даже может полностью рассасываться. Однако при наличии эндокринных расстройств, нарушении метаболических процессов либо инфекционных воспалениях, опухоль может начать прогрессировать. Признаком болезни могут стать регулярные межменструальные кровотечения и коричневая мазня при климаксе, боль и распирание в нижней части живота, дискомфорт при мочеиспускании, увеличение живота в объеме.
  5. Рак шейки матки — одно из наиболее распространенных онкологических заболеваний половых органов. Часто развивается из доброкачественных предраковых заболеваний таких как миома, эндометриоз, гиперплазия и эрозия. На ранних стадиях протекает почти бессимптомно. Выдать болезнь могут только контактные кровотечения (после секса, спринцевания или физических нагрузок). В более поздних стадиях наблюдаются кровотечения и водянистые бели с примесями крови и сукровицы.

Воспаление мочеполовой системы

Воспалительные процессы мочеполовой системы не менее часто выступают виновниками аномальных выделений при климаксе у женщин после 50 лет. Воспаление и его симптомы могут спровоцировать такие заболевания:
Эндометрит

Это воспаление верхнего слоя матке по причине восходящих инфекций. Инфицирование может произойти во время родов, кесарево, абортов, операций, диагностических процедур в матке, в результате полового акта и нарушения микрофлоры влагалища.

Возможна острая форма заболевания с сильными болями, высокой температурой и кровотечением, а также хроническая — с незначительными болями в пояснице и слизисто-гнойными выделениями.

Цервицит

Воспаление цервикального канала шейки матки называют цервицитом. В острой форме заболевание обусловлено наличием инфекционного возбудителя. В хронической — наличием инородных тел и аллергенами. Симптомами воспаления могут стать контактные кровотечения, слизисто-гнойные бели и нарушения мочеиспускания.

Бактериальный вагиноз

При вагинозе нарушается микрофлоры влагалища, при котором патологически развиваются условно-патогенные микроорганизмы. Во время климакса вагиноз вызывает гормональный дисбаланс и недостаточность естественной смазки.

При вагинозе при климаксе у женщин наблюдаются белые или сероватые выделения как на фото ниже с неприятным рыбным запахом.

Иногда пациентки жалуются на болезненные ощущения во время секса и при мочеиспускании.

Кандидоз

Это грибковое заболевание, вызванное смещением кислотно-щелочного баланса влагалища, при котором патологически размножается условно-патогенный грибок Candida. Проявлением кандидоза являются белые творожистые бели, которые имеют резкий кисломолочный запах (см. фото).

Инфекция сопровождается зудом интимной зоны и жжением при мочеиспускании.

Хламидиоз

Инфекция передается половым путем. Воспалительный процесс вызывают патогенные бактерии — хламидии. Инфекционное заболевание отличается гнойными белями желтоватого цвета с неприятным запахом. Консистенция выделений обычно слизистая, но может быть водянистой или пенистой.

Иногда болезнь вызывает незначительные боли в области наружных половых органов, зуд и жжение. Может сопровождаться слабостью, повышением температуры и тошнотой.

Гонорея

Инфекция поражает слизистую оболочку влагалища и мочеполовой системы. В редких случаях могут поражаться глаза, прямая кишка и слизистая рта. Протекает в острой или хронической форме. Основные симптомы: гнойные выделения с жидковатой или пенистой структурой, боли в уретре, частые и болезненные позывы к мочеиспусканию.

Диагностика и лечение

Аномальные выделения при менопаузе могут стать признаком развития гинекологических заболеваний и онкологии. Поэтому при появлении странного секрета необходимо не медлить с посещением гинеколога. Обследование обязательно включает в себя осмотр в гинекологическом кресле, а также методы лабораторной и инструментальной диагностики:

  • трансвагинальное УЗИ;
  • УЗИ органов малого таза;
  • общий анализ крови;
  • анализ на цитологию;
  • мазок микрофлоры;
  • кольпоскопию;
  • биопсия при подозрении на онкологию.

После определения причины патологического секрета, врач назначит вам подходящую терапию.

Чаще всего применяют медикаментозное лечение. Могут быть применены лекарства для симптоматического лечения или гормозамещающие препараты.

При некоторых заболеваниях эндометрия и матки может понадобиться выскабливание или удаление пораженных болезнью области матки или всего органа.

Лечить половые инфекции потребуется с помощью антибактериальных препаратов. Для этого может понадобиться дополнительный анализ на переносимость антибиотиков.

В период менопаузы также важно следить за цветом и характером секрета, как и в репродуктивном возрасте. Странный секрет является характерным признаком гинекологических и гормональных нарушений.

Возникновение подобного симптома нельзя игнорировать и важно своевременно обратиться за медицинской помощью.

Ответственное отношение к собственному состоянию, поможет сгладить период менопаузы и предупредить развитие опасных патологий.

причины, симптомы, лечение, болезни, осложнения, риски, нужно ли к врачу

Технически менопауза наступает в тот день, когда проходит 12 месяцев со дня последней менструации. Средний возраст входа в менопаузу составляет 51 год, хотя у разных женщин эта цифра широко варьируется.

Коричневые выделения из влагалища после менопаузы обычно не свидетельствуют о серьёзных проблемах со здоровьем, но иногда они могут указывать на наличие у женщины определённых медицинских состояний. Эксперты рекомендуют регулярно проверяться у гинеколога, чтобы диагностировать любые необычные выделения.

В этой статье мы очертим возможные причины коричневых выделений, наблюдаемых после менопаузы. Мы также поговорим о диагностике таких выделений и о том, как ими можно управлять.

Содержание статьи:

Причины

Во многих случаях коричневые выделения после менопаузы не свидетельствуют о серьёзных заболеваниях

Слизистая оболочка влагалища истончается во время менопаузы, поэтому орган может становиться более чувствительным к сухости и раздражению.

Женщины могут сталкиваться с зудом, жжением влагалища и бесцветными выделениями чаще, чем это случалось с ними до наступления климакса.

Коричневые выделения после менопаузы обычно указывают на то, что к влагалищным выделениям подмешивается кровь. Притом что свежая кровь обычно имеет красный цвет, она становится коричневой или чёрной, когда вступает во взаимодействие с кислородом и выходит из влагалища.

Выделения могут иметь немного более светлый оттенок, если у женщины имеются инфекции, например дрожжевые инфекции.

Ниже вы сможете прочитать о наиболее распространённых причинах коричневых выделений после менопаузы.

Атрофический вагинит

Поскольку во время менопаузы уровень эстрогена в организме женщины уменьшается, ткани, выстилающие стенки влагалища, становятся более тонкими. Истончение стенок влагалища в медицине имеет название атрофический вагинит.

Атрофический вагинит часто приводит к тому, что после менопаузы влагалище становится мене гибким, более сухим и более восприимчивым к воспалению и инфекциям. Данное состояние может вызывать следующее:

Атрофический вагинит может стать источником постоянного дискомфорта, поэтому если женщина наблюдает указанные выше симптомы, то ей следует обсудить их с врачом.

Врач может порекомендовать гормональную терапию. Кроме того, он, наверняка, посоветует использовать во время сексуальной активности искусственные смазки на водной основе.

Гиперплазия эндометрия

Эндометриальная ткань после менопаузы может утолщаться. Это происходит из-за того, что организм женщины вырабатывает слишком много эстрогена и слишком мало прогестерона.

Избыток эндометрия может становиться причиной аномальных маточных кровотечений, в том числе коричневых выделений.

В таких случаях врачи могут порекомендовать заместительную гормональную терапию (ЗГТ), чтобы подкорректировать уровни гормонов и избавить женщину от проблем. Они также могут предложить женщине операцию по удалению утолщённой ткани или гистерэктомию (удаление матки).

Инфекции

Влагалищные инфекции обычно вызывают бесцветные выделения, которые сопровождаются неприятным запахом, зудом, болью или раздражением затронутого участка. Иногда такие выделения могут оставлять на нижнем белье пятна коричневатого оттенка.

К факторам, которые повышают риск возникновения инфекций, относится следующее:

  • приём антибиотиков;
  • физическая активность в плотном нижнем белье;
  • спринцевание;
  • диабет.

Для лечения инфекций влагалища врач порекомендует антибиотики или противогрибковые препараты.

Инфекции, передающиеся половым путём

Некоторые венерические заболевания, например гонорея или хламидиоз, могут становиться причиной влагалищных кровотечений. Такие кровотечения или выделения могут быть более заметными после сексуальной активности.

Одни инфекции, передающиеся половым путём (ИППП), кроме коричневых выделений, могут вызывать дополнительные симптомы. Другие, например хламидиоз, редко сопровождаются симптомами, поэтому женщинам необходимо регулярно проверяться у врача, особенно в тех случаях, когда они начинают отношения с новым сексуальным партнёром или имеют нескольких.

Напряжённая физическая активность

Интенсивные упражнения — распространённая причина коричневых влагалищных выделений

Физическая активность играет важную роль в обеспечении здоровья организма, а для женщин в постменопаузе регулярные упражнения приобретают ещё большую значимость. Однако иногда они становятся причиной коричневых выделений из влагалища.

У отдельных женщин тёмные выделения после интенсивных занятий в спортивном зале возникают достаточно часто и, как правило, не указывают на наличие проблем со здоровьем.

Однако если женщина впервые обнаружила коричневые выделения после физической активности, то ей необходимо обсудить этот вопрос с врачом.

Заместительная гормональная терапия

Один из побочных эффектов заместительной гормональной терапии — влагалищные кровотечения. Это наблюдается из-за того, что препараты для ЗГТ вызывают утолщение выстилающего слоя матки (эндометрия).

Кровь от утолщённого эндометрия часто проявляется коричневыми пятнами на нижнем белье женщины. Если такие пятна при использовании ЗГТ наблюдаются часто, то женщине следует обсудить симптом с лечащим врачом, который способен внести в курс лечения необходимые корректировки.

Другие препараты

Не только синтетические гормоны могут вызывать влагалищные кровотечения. Некоторые другие препараты имеют аналогичные побочные эффекты. В частности, к таким фармакологическим продуктам относятся средства для разжижения крови и тамоксифен, который используется для лечения и предотвращения развития рака груди.

Врачи могут порекомендовать смену дозировки или альтернативные средства для ослабления симптомов.

Полипы

Полипы — образования, которые прикреплены к матке или шейке матки. Как правило, они имеют нераковую природу и могут приводить к кровотечениям, коричневым выделениям, а иногда вызывают сильные спазмы.

Многие женщины с полипами не сталкиваются с симптомами. Это ещё одна причина, по которой каждая женщина должна регулярно проходить гинекологические осмотры. Как правило, полипы легко удаляются во время несложной и минимально инвазивной операции.

Рак

В некоторых случаях внезапные коричневые выделения могут указывать на наличие в матке раковых образований. Влагалищные кровотечения — распространённый симптом рака матки.

Раковые образования могут вызывать и другие симптомы, например боль в области таза, боль во время сексуальной активности (диспареунию) и боль во время мочеиспускания.

Рак матки может потребовать выполнение гистерэктомии, химиотерапии или радиационной (лучевой) терапии. Во время удаления матки врач также может удалить близлежащие лимфатические узлы.

Однако симптомы рака матки аналогичны симптомам ряда доброкачественных состояний, поэтому при их появлении важно встретиться с врачом и установить правильный диагноз.

Диагностика

Для выявления причины коричневых влагалищных выделений может быть применено ультразвуковое исследование

Чтобы определить причину коричневых выделений после менопаузы, врач изучит медицинскую историю пациентки и узнает обо всех препаратах, которые она принимает. Специалист также может провести гинекологический осмотр или взять мазок для проверки на наличие инфекций.

Кроме того, врач может порекомендовать женщине пройти следующие процедуры:

  • анализ крови;
  • ультразвуковое исследование области таза;
  • мазок Папаниколау;
  • расширение и выскабливание.

Управление коричневыми выделениями после менопаузы

Методы управления коричневыми выделения после менопаузы зависят от причины, которая лежит в их основе.

Первый помощник при любых влагалищных выделениях — гигиенические прокладки. Кроме того, следует избегать ношения синтетического нижнего белья и отдавать предпочтение «дышащим» тканям, таким как хлопок. Это позволит женщине чувствовать себя более комфортно и предотвращать развитие инфекций. Свободная одежда также позволит избежать раздражения.

Влагалище может стать более чувствительным из-за истончения тканей после менопаузы. Мыла, стиральные порошки и лосьоны часто содержат ароматизаторы или другие химические вещества, которые способны вызывать раздражение.

Притом что интимная гигиена всегда остаётся залогом здоровья половых органов, женщине лучше отказаться от спринцевания, которое может негативно повлиять на чувствительную среду влагалища.

Когда нужно обращаться к врачу

Каждая женщина, обнаруживающая у себя тёмно-красные, чёрные или коричневые выделения первый раз после наступления менопаузы, должна показаться врачу.

Не все из перечисленных выше причин можно предотвратить, но во многих случаях женщинам удаётся избавиться от аномальных выделений.

Признаки пременопаузы

Здравствуйте, уважаемые читатели блога ElenaVolzhenina.com.
Тема пременопаузы, менопаузы, климакса, угасания плодности женщины после 45-50 лет для многих довольно неприятная. Мы не знаем, как жить после 45 лет.

Многие дороги в обществе закрываются перед женщиной в этом возрасте. Мы видим вокруг пожилых нереализованных женщин, имеющих проблемы в семье, с детьми, со здоровьем, с деньгами, с профессией и работой. Наблюдая это, молодые женщины не знают, куда стареть, куда идти, в чём суть старшего возраста.

Поэтому многие женщины «цепляются» за менструации, беременеют и рожают после 40-45 лет, как бы идя на «второй круг». Лишь бы только не эти страшные слова — «менопауза» и «климакс».

В мире всё циклично. Периоды дня, года, жизни – естественны. А в психике женщины всегда присутствуют все её этапы. Девочка, Девушка, Женщина и Старуха, как четыре фазы Луны, находятся в нас в любом возрасте. Важно их знать, владеть их качествами.

Способность рожать детей с возрастом исчезает. Первые признаки снижения плодности женщина может увидеть у себя довольно рано. Это может быть, например, если у неё много стрессов, были аборты, если она принимала гормональные контрацептивы, у неё слабое здоровье и т.д.

Естественное Планирование Семьи и Методы Распознавания Плодности дают возможность профилактики раннего истощения яичников. Женщина, зная свои плодные и неплодные дни, чувствует себя гораздо спокойнее, она полностью владеет информацией о себе. А значит, может избежать абортов, страха, вреда от контрацепции. Поэтому возраст пременопаузы может наступить гораздо позже.

Плодность в пременопаузе.

Пременопауза – период угасания плодности. Признаки угасания плодности могут быть в любом возрасте. Это всегда индивидуально. Но в возрасте приблизительно в 38—40—45 лет, как правило, начинается снижение функции яичников.

Пременопауза — это период от начала затухания функции яичников до полного прекращения менструаций. Он характеризуется резким снижением способности к зачатию и изменением характера менструаций.

Менопауза — последняя самостоятельная менструация в жизни женщины.
Постменопауза — это время от последней менструации (менопаузы) до почти полного прекращения функции яичников.

Прекращение менструации в возрасте 40—45 лет принято расценивать как раннюю менопаузу; старше 55 лет — поздняя менопауза. Возраст 38—39 лет принят в качестве нижней границы ранней пременопаузы. Если у женщины начинаются эти симптомы раньше 38 лет, это расценивается как синдром истощения яичников.

За менструальный цикл отвечают женские половые гормоны — эстрогены и прогестерон, которые обеспечивают подготовку слизистой оболочки матки к беременности.

Но не только эндометрий матки чувствителен к эстрогенам и прогестерону. Это мозг, печень, кишечник, сердце, опорно-двигательный и мочевыделительный аппараты и некоторые другие ткани. Органы содержат чувствительные к женским гормонам рецепторы.

Именно поэтому при снижении уровня женских гормонов развивается так называемый «климактерический синдром», характеризующийся нарушением функций разных органов.

Нарушается равновесие между эстрогенами — женскими гормонами, синтез которых в организме уменьшается, и андрогенами — мужскими гормонами, вырабатывающимися надпочечниками.

Пременопауза, механизмы развития.

В условиях дефицита яичниковых гормонов развиваются компенсаторно-приспособительные механизмы.
Надпочечники начинают продуцировать повышенное количество андрогенов – мужских половых гормонов, которые переходят в эстрогены в подкожной жировой клетчатке.

Нарушение вегетативной регуляции со стороны гипоталамуса провоцирует повышение потливости, головокружения, тошноту и приливы. Эти реакции носят сосудистый характер.

Увеличение синтеза пролактина гипофизом часто сопутствует климактерическому синдрому. Из-за этого секреция эстрогенов яичниками угнетается еще больше. Кроме того, пролактин усиливает пролиферативные процессы в молочных железах и в матке. В результате этого значительно возрастает риск образования миомы матки и мастопатии.

Невротические реакции (повышенная раздражительность, нервозность, плаксивость, расстройство сна, суицидные мысли) возникают на фоне патологии внутренних органов и из-за эмоциональных переживаний женщины по поводу своего возраста и состояния.

Признаки пременопаузы.

  • Обильное кровотечение во время менструации, выделение сгустков крови.
  • Менструация продолжается на несколько дней дольше обычного.
  • Незначительное кровотечение между менструациями.
  • Небольшое выделение крови после полового акта.
  • Сокращение отрезка времени между менструациями.
  • Основным признаком начинающейся пременопаузы является снижение плодности.
  • Уменьшение количества овуляций, укорочение лютеиновой фазы цикла (это признаки недостаточности лютеиновой фазы цикла).

А также:

  • Возможен синдром лютеинизации неовулировавшего фолликула (LUF синдром).
  • Устойчивость яичников к воздействию ФСГ, увеличение его выработки гипофизом. Такая стимуляция яичников приводит к созреванию одновременно нескольких фолликулов, ни один из которых не достигает полной зрелости. Вследствие этого, высокий уровень эстрогенов в крови, изменение шеечного секрета и состояния шейки матки.
  • При падении уровня эстрогенов вследствие разрушения зреющих фолликулов – обильные нерегулярные кровотечения.

О синдроме неовулировавшего фолликула (LUF-синдроме), я писала в отдельном видеокурсе, посвящённом менструальным циклам. Там же я осветила вопрос онедостаточности лютеиновой фазы, ведь именно эти признаки являются первыми «звоночками», которые говорят о начавшемся снижении плодности. Причём речь не идёт только о возрасте пременопаузы, это возможно в любое время.

Признаки пременопаузы могут быть в любом возрасте. Если вы читаете литературу, знакомитесь с этими темами, и видите у себя снижение функции яичников, то стоит подумать об изменении образа жизни, снижении стрессов. Может быть, стоит заняться своим здоровьем.

Наблюдение за признаками плодности и ведение карт наблюдений менструального цикла в возрасте пременопаузы позволит избежать незапланированной беременности, увидеть признаки заболеваний, чувствовать себя свободно в супружеских отношениях. 🙂

А теперь — кино из видеокурса — Плодность в пременопаузе. Урок 1 — Гормональный фон женщины в пременопаузе.

С уважением, Елена Волженина.

Заместительная гормональная терапия, масса тела и риск колоректального рака среди женщин в постменопаузе из Германии

  • Адамс К.Ф., Лейтцманн М.Ф., Албейнс Д., Кипнис В., Моув Т., Холленбек А., Шацкин А. (2007) Масса тела и колоректальный рак риск в когорте NIH – AARP. Am J Epidemiol 166 : 36–45, DOI: 10.1093 / aje / kwm049

    Статья Google ученый

  • Anderson GL, Limacher M, Assaf AR, Bassford T, Beresford SA, Black H, Bonds D, Brunner R, Brzyski R, Caan B, Chlebowski R, Curb D, Gass M, Hays J, Heiss G, Hendrix С., Ховард Б.В., Хсиа Дж., Хаббелл А., Джексон Р., Джонсон К.С., Джадд Х., Котчен Дж. М., Куллер Л., ЛаКруа, Аризона, Лейн Д., Лангер Р.Д., Лассер Н., Льюис К.Э., Мэнсон Дж., Марголис К., Окене Дж., O’Sullivan MJ, Phillips L, Prentice RL, Ritenbaugh C, Robbins J, Rossouw JE, Sarto G, Stefanick ML, Van Horn L, Wactawski-Wende J, Wallace R, Wassertheil-Smoller S (2004) Эффекты конъюгированного конского эстрогена у женщин в постменопаузе с гистерэктомией: рандомизированное контролируемое исследование Инициативы по охране здоровья женщин. JAMA 291 : 1701–1712

    CAS Статья Google ученый

  • Бэнкс Э, Берал В., Кэмерон Р., Хогг А., Лэнгли Н., Барнс И., Булл Д., Эллиман Дж., Харрис К.Л. (2001) Соглашение между данными о рецептах общей практики и самооценкой использования заместительной гормональной терапии и лечения при различных недугах. J Epidemiol Biostat 6 : 357–363

    CAS Статья Google ученый

  • Бэнкс Э, Берал В., Кэмерон Р., Хогг А., Лэнгли Н., Барнс И., Булл Д., Ривз Г., Инглиш Р., Тейлор С., Эллиман Дж., Лоул Харрис С. (2002) Сравнение различных характеристик женщин, которые проходить и не проходить обследование на рак груди. Заявление о раке молочной железы 4 : R1

    Статья Google ученый

  • Beral V (2003) Рак груди и заместительная гормональная терапия в исследовании «Миллион женщин». Ланцет 362 : 419–427

    CAS Статья Google ученый

  • Бергстрём А., Пизани П., Тенет В., Волк А., Адами Х.О. (2001) Избыточный вес как предотвратимая причина рака в Европе. Int J Cancer 91 : 421–430

    Статья Google ученый

  • Brenner H, Chang-Claude J, Seiler CM, Sturmer T, Hoffmeister M (2006) Нужно ли когда-либо повторять отрицательную скрининговую колоноскопию? Кишечник 55 : 1145–1150

    CAS Статья Google ученый

  • Brenner H, Chang-Claude J, Seiler CM, Sturmer T., Hoffmeister M (2007a) Исследование «случай – контроль» поддерживает увеличение интервала наблюдения после колоноскопической полипэктомии как минимум до 5 лет. Am J Gastroenterol 102 : 1739–1744, DOI: 10.1111 / j.1572-0241.2007.01231.x

    Артикул Google ученый

  • Brenner H, Chang-Claude J, Seiler CM, Sturmer T, Hoffmeister M (2007b) Возможности профилактики колоректального рака с помощью сигмоидоскопии по сравнению с колоноскопией: популяционное исследование случай-контроль. Биомаркеры эпидемиологии рака Назад 16 : 494–499

    Статья Google ученый

  • Bromley SE, de Vries CS, Farmer RD (2004) Использование заместительной гормональной терапии в Соединенном Королевстве.Описательное исследование с использованием базы данных исследований общей практики. BJOG 111 : 369–376

    CAS Статья Google ученый

  • Calle EE, Kaaks R (2004) Избыточный вес, ожирение и рак: эпидемиологические данные и предлагаемые механизмы. Nat Rev Cancer 4 : 579–591

    CAS Статья Google ученый

  • Calle EE, Miracle-McMahill HL, Thun MJ, Heath Jr CW (1995) Заместительная терапия эстрогенами и риск фатального рака толстой кишки в предполагаемой когорте женщин в постменопаузе. J Natl Cancer Inst 87 : 517–523

    CAS Статья Google ученый

  • Кейси В.А., Дуайер Дж.Т., Берки К.С., Коулман К.А., Гарднер Дж., Валадиан И. (1991) Долгосрочная память о массе тела и удовлетворенности прошлым весом: продолжительное последующее исследование. Am J Clin Nutr 53 : 1493–1498

    CAS Статья Google ученый

  • Chlebowski RT, Wactawski-Wende J, Ritenbaugh C, Hubbell FA, Ascensao J, Rodabough RJ, Rosenberg CA, Taylor VM, Harris R, Chen C, Adams-Campbell LL, White E (2004) Эстроген плюс прогестин и колоректальный рак у женщин в постменопаузе. N Engl J Med 350 : 991–1004

    CAS Статья Google ученый

  • Dudley EC, Hopper JL, Taffe J, Guthrie JR, Burger HG, Dennerstein L (1998) Использование продольных данных для определения перименопаузы по характеристикам менструального цикла. Климактерический 1 : 18–25

    CAS Статья Google ученый

  • Folsom AR, Mink PJ, Sellers TA, Hong CP, Zheng W, Potter JD (1995) Заместительная гормональная терапия, заболеваемость и смертность в проспективном исследовании женщин в постменопаузе. Am J Public Health 85 : 1128–1132

    CAS Статья Google ученый

  • Frezza EE, Wachtel MS, Chiriva-Internati M (2006) Влияние ожирения на риск развития рака толстой кишки. Кишечник 55 : 285–291

    CAS Статья Google ученый

  • Goodman MT, Nomura AM, Wilkens LR, Kolonel LN (1990) Соглашение между информацией интервью и записями врача об истории использования эстрогенов в менопаузе. Am J Epidemiol 131 : 815–825

    CAS Статья Google ученый

  • Greiser E (2003) Gutachten zur Anwendung der postmenopausalen Гормонотерапия в Deutschland und Vorschläge zur Senkung der Anwendungshäufigkeit . Бремен: Bremer Institut für Präventionsforschung und Sozialmedizin (BIPS)

    Google ученый

  • Grodstein F, Martinez ME, Platz EA, Giovannucci E, Colditz GA, Kautzky M, Fuchs C, Stampfer MJ (1998) Использование гормонов в постменопаузе и риск колоректального рака и аденомы. Ann Intern Med 128 : 705–712

    CAS Статья Google ученый

  • Grodstein F, Newcomb PA, Stampfer MJ (1999) Постменопаузальная гормональная терапия и риск колоректального рака: обзор и метаанализ. Am J Med 106 : 574–582

    CAS Статья Google ученый

  • Херш А.Л., Стефаник М.Л., Стаффорд Р.С. (2004) Использование гормональной терапии в постменопаузе на национальном уровне: ежегодные тенденции и ответ на последние данные. JAMA 291 : 47–53

    CAS Статья Google ученый

  • Hoffmeister M, Chang-Claude J, Brenner H (2007) Валидность эндоскопий толстой кишки, о которых сообщают пациенты, и их значение для оценки риска колоректального рака. Am J Epidemiol 166 : 130–136

    Статья Google ученый

  • Hou L, Ji BT, Blair A, Dai Q, Gao YT, Potter JD, Chow WH (2006) Индекс массы тела и риск рака толстой кишки у китайцев: менопауза как модификатор эффекта. Eur J Cancer 42 : 84–90

    Статья Google ученый

  • Hulley S, Furberg C, Barrett-Connor E, Cauley J, Grady D, Haskell W, Knopp R, Lowery M, Satterfield S, Schrott H, Vittinghoff E, Hunninghake D (2002) Исходы несердечно-сосудистых заболеваний в течение 6,8 лет гормональной терапии: исследование сердца и заместительной терапии эстрогеном / прогестином (HERS II). JAMA 288 : 58–66

    CAS Статья Google ученый

  • Jain MG, Rohan TE, Howe GR (1999) Соглашение о самооценке использования заместительной гормональной терапии в период менопаузы с отчетами врачей. Эпидемиология 10 : 260–263

    CAS Статья Google ученый

  • La Vecchia C, Gallus S, Fernandez E (2005) Заместительная гормональная терапия и колоректальный рак: обновленная информация. J Br Menopause Soc 11 : 166–172

    Статья Google ученый

  • Lin J, Zhang SM, Cook NR, Rexrode KM, Lee IM, Buring JE (2004) Индекс массы тела и риск колоректального рака у женщин (США). Контроль причин рака 15 : 581–589

    Статья Google ученый

  • Löwel H, Heier M, Schneider A, Gösele U, Meisinger C (2003) Hormontherapie (II): Vergleiche sind zulässig. Ergebnisse aus dem KORA-Survey 2000. Dtsch Arztebl 100 : A2561 – A2562

    Google ученый

  • Нанда К., Бастиан Л.А., Хассельблад В., Симел Д.Л. (1999) Заместительная гормональная терапия и риск колоректального рака: метаанализ. Obstet Gynecol 93 : 880–888

    CAS PubMed Google ученый

  • Paganini-Hill A (1999) Заместительная терапия эстрогенами и риск колоректального рака у пожилых женщин. Dis Colon Rectum 42 : 1300–1305

    CAS Статья Google ученый

  • Перри Г.С., Байерс Т.Э., Мокдад А.Х., Сердула М.К., Уильямсон Д.Ф. (1995) Достоверность самооценок веса тела взрослых американцев в прошлом. Эпидемиология 6 : 61–66

    CAS Статья Google ученый

  • Pischon T, Lahmann PH, Boeing H, Friedenreich C, Norat T, Tjonneland A, Halkjaer J, Overvad K, Clavel-Chapelon F, Boutron-Ruault MC, Guernec G, Bergmann MM, Linseisen J, Becker N, Trichopoulou A, Trichopoulos D, Sieri S, Palli D, Tumino R, Vineis P, Panico S, Peeters PH, Bueno-de-Mesquita HB, Boshuizen HC, Van Guelpen B, Palmqvist R, Berglund G, Gonzalez CA, Dorronsoro M, Barricarte A, Navarro C, Martinez C, Quiros JR, Roddam A, Allen N, Bingham S, Khaw KT, Ferrari P, Kaaks R, Slimani N, Riboli E (2006) Размер тела и риск рака толстой и прямой кишки в Европе Проспективное исследование рака и питания (EPIC). J Natl Cancer Inst 98 : 920–931

    Статья Google ученый

  • Rossouw JE, Anderson GL, Prentice RL, LaCroix AZ, Kooperberg C, Stefanick ML, Jackson RD, Beresford SA, Howard BV, Johnson KC, Kotchen JM, Ockene J (2002) Риски и преимущества эстрогена плюс прогестин в Здоровые женщины в постменопаузе: основные результаты Рандомизированного контролируемого исследования Инициативы по охране здоровья женщин. JAMA 288 : 321–333

    CAS Статья Google ученый

  • Зейферт-Клаусс В., Шумм-Дрегер П.М. (2003) Гормонотерапия при менопаузе.Ein aktueller Blick. Der Internist 44 : 1500–1507

    CAS Статья Google ученый

  • Слэттери М.Л., Баллард-Барбаш Р., Эдвардс С., Каан Б.Дж., Поттер Дж.Д. (2003) Индекс массы тела и рак толстой кишки: оценка модифицирующих эффектов эстрогена (США). Контроль причин рака 14 : 75–84

    CAS Статья Google ученый

  • Troisi R, Schairer C, Chow WH, Schatzkin A, Brinton LA, Fraumeni Jr JF (1997) Проспективное исследование менопаузальных гормонов и риска колоректального рака (США). Контроль причин рака 8 : 130–138

    CAS Статья Google ученый

  • Wang Y, Jacobs EJ, Teras LR, Pavluck AL, Rodriguez C, Thun MJ, Calle EE (2007) Отсутствие доказательств модификации эффекта эстрогеном связи между индексом массы тела и риском колоректального рака у женщин в постменопаузе. Контроль причин рака 18 : 793–799

    Статья Google ученый

  • Произошла ошибка при настройке вашего пользовательского файла cookie

    Произошла ошибка при настройке вашего пользовательского файла cookie

    Этот сайт использует файлы cookie для повышения производительности.Если ваш браузер не принимает файлы cookie, вы не можете просматривать этот сайт.

    Настройка вашего браузера для приема файлов cookie

    Существует множество причин, по которым cookie не может быть установлен правильно. Ниже приведены наиболее частые причины:

    • В вашем браузере отключены файлы cookie. Вам необходимо сбросить настройки своего браузера, чтобы он принимал файлы cookie, или чтобы спросить вас, хотите ли вы принимать файлы cookie.
    • Ваш браузер спрашивает вас, хотите ли вы принимать файлы cookie, и вы отказались.Чтобы принять файлы cookie с этого сайта, нажмите кнопку «Назад» и примите файлы cookie.
    • Ваш браузер не поддерживает файлы cookie. Если вы подозреваете это, попробуйте другой браузер.
    • Дата на вашем компьютере в прошлом. Если часы вашего компьютера показывают дату до 1 января 1970 г., браузер автоматически забудет файл cookie. Чтобы исправить это, установите правильное время и дату на своем компьютере.
    • Вы установили приложение, которое отслеживает или блокирует установку файлов cookie.Вы должны отключить приложение при входе в систему или проконсультироваться с системным администратором.

    Почему этому сайту требуются файлы cookie?

    Этот сайт использует файлы cookie для повышения производительности, запоминая, что вы вошли в систему, когда переходите со страницы на страницу. Чтобы предоставить доступ без файлов cookie потребует, чтобы сайт создавал новый сеанс для каждой посещаемой страницы, что замедляет работу системы до неприемлемого уровня.

    Что сохраняется в файле cookie?

    Этот сайт не хранит ничего, кроме автоматически сгенерированного идентификатора сеанса в cookie; никакая другая информация не фиксируется.

    Как правило, в файлах cookie может храниться только информация, которую вы предоставляете, или выбор, который вы делаете при посещении веб-сайта. Например, сайт не может определить ваше имя электронной почты, пока вы не введете его. Разрешение веб-сайту создавать файлы cookie не дает этому или любому другому сайту доступа к остальной части вашего компьютера, и только сайт, который создал файл cookie, может его прочитать.

    Гормональная терапия в постменопаузе и риск колоректального рака по молекулярно определенным подтипам и локализации опухоли | JNCI Cancer Spectrum

    Аннотация

    Предпосылки

    Постменопаузальная гормональная терапия (ГТ) связана со снижением риска колоректального рака (CRC). Поскольку CRC является гетерогенным заболеванием, мы оценили, отличается ли ассоциация HT и CRC между этиологически значимыми, молекулярно определенными подтипами опухолей и локализацией опухоли.

    Методы

    Мы объединили данные о подтипах опухолей (статус микросателлитной нестабильности, статус фенотипа метилатора CpG-островка, мутации BRAF и KRAS , путь: аденома-карцинома, альтернативный, зубчатый), локализация опухоли (проксимальный отдел толстой кишки, дистальный отдел толстой кишки). , прямая кишка) и ГТ среди 8220 женщин в постменопаузе (3898 случаев CRC и 4322 контрольных) по данным 8 обсервационных исследований. Мы использовали полиномиальную логистическую регрессию для оценки отношения шансов (OR) и 95% доверительных интервалов (CI) для ассоциации когда-либо и никогда не использовали ГТ с каждым подтипом опухоли по сравнению с контролем.Модели были скорректированы с учетом исследования, возраста, индекса массы тела, статуса курения и семейного анамнеза CRC. Все статистические тесты были двусторонними.

    Результаты

    Среди женщин в постменопаузе когда-либо использование ГТ было связано с 38% снижением общего риска CRC (OR = 0,62, 95% CI = 0,56–0,69). Эта ассоциация была сходной в зависимости от микросателлитной нестабильности, фенотипа метилирующего островка CpG и статуса BRAF или KRAS . Однако ассоциация была ослаблена для опухолей, возникающих по зубчатому пути (OR = 0.81, 95% ДИ = 0,66–1,01) по сравнению с путем аденома-карцинома (OR = 0,63, 95% CI = 0,55–0,73; P het = 0,04) и альтернативным путем (OR = 0,61, 95% CI = от 0,51 до 0,72). Кроме того, опухоли проксимального отдела толстой кишки имели более слабую ассоциацию (OR = 0,71, 95% CI = 0,62-0,80) по сравнению с опухолями прямой кишки (OR = 0,54, 95% CI = 0,46-0,63) и дистальными отделами толстой кишки (OR = 0,57, 95% CI = От 0,49 до 0,66; P het = 0,01) опухоли.

    Выводы

    Мы наблюдали сильную обратную связь между использованием ГТ и общим риском CRC, что может преимущественно отражать пользу использования ГТ при опухолях, возникающих через аденому-карциному и альтернативные пути, а также опухоли дистального отдела толстой кишки и прямой кишки.

    Колоректальный рак (CRC) — это гетерогенное заболевание, которое развивается несколькими путями, определяемыми генетическими и эпигенетическими событиями (1, 2). Для лучшей характеристики этой гетерогенности обычно используются четыре опухолевых маркера: микросателлитная нестабильность (MSI), фенотип метилирования CpG-островков (CIMP), соматические мутации в BRAF и соматические мутации в KRAS . Вместе эти опухолевые маркеры соответствуют трем различным молекулярным путям колоректального канцерогенеза: аденома-карцинома (традиционная), альтернативная и зубчатая (1, 3, 4).Эти пути устанавливаются на ранней стадии патогенеза заболевания и могут быть идентифицированы в пределах предраковых поражений с помощью микроскопии (3, 5-8). Исследования показали, что эти типы опухолей имеют различный внешний вид, склонность к расположению в толстой кишке и биологическое поведение (8–10). Таким образом, вероятно, что эпидемиологические факторы, лежащие в основе их этиологии, также могут различаться.

    Множество доказательств, включая рандомизированные контролируемые испытания, показывают, что гормональная терапия в постменопаузе (ГТ) связана со снижением риска CRC (11–20).Снижение риска, примерно на 20-40% в недавних исследованиях, наблюдалось у пользователей, принимавших только эстроген, а также комбинированный эстроген и прогестин. В нескольких исследованиях оценивали, различается ли связь между применением ГТ и риском CRC в зависимости от молекулярно определенных подтипов CRC; однако такая информация может улучшить понимание механизмов этого положительного эффекта. Текущая литература предполагает, что использование ГТ связано с более низким риском опухолей с низким MSI или микросателлитно-стабильных опухолей (MSI-L / MSS) и, возможно, с более низким риском CIMP-отрицательных и BRAF опухолей дикого типа (21, 22) .Использование ГТ было связано только с опухолями KRAS дикого типа в дистальном отделе толстой кишки в одном предыдущем исследовании (23). Что касается локализации опухоли, связь между использованием ГТ и CRC, как сообщается, сильнее среди опухолей дистального отдела толстой кишки по сравнению с проксимальным отделом толстой кишки (22, 24). Насколько нам известно, ни одно исследование не оценивало как опухолевые маркеры, так и локализацию в отношении использования ГТ, чтобы обеспечить полное понимание риска CRC, специфичного для подтипа.

    В этом исследовании мы изучили использование ГТ по отношению к молекулярно определенным подтипам CRC, используя доступные данные из реестра семей рака толстой кишки (CCFR) (21, 25, 26) и 7 исследований, внесенных в Консорциум генетики эпидемиологии колоректального рака ( 27, 28).В частности, мы оценили каждый из 4 общих онкомаркеров (MSI, CIMP, BRAF и KRAS ) отдельно, а также 3 пути канцерогенеза, определяемые комбинациями этих маркеров и локализацией опухоли.

    Методы

    Изучаемые группы

    Данные 8 наблюдательных исследований CRC были объединены: исследование по профилактике рака II (CPS-II) (29), немецкое исследование Дармкребса: скрининговое исследование Chancen der Verhutung durch (DACHS) (30, 31), исследование диетической активности и образа жизни. (DALS) (32), шведское население Европейского проспективного исследования рака (EPIC) (33), Мельбурнское совместное когортное исследование (MCCS) (34), Исследование здоровья медсестер (NHS) (35, 36), Исследование здоровья и болезней Северной Швеции (NSHDS) (37) и 3 популяционных сайта из Семейного реестра рака толстой кишки (21, 25, 26).Каждое исследование включало женщин с диагнозом инвазивный CRC и одновременную непораженную контрольную группу. Только женщины с данными по опухолевым маркерам подходили для включения в этот анализ. Детали исследования описаны в дополнительных методах (доступны в Интернете). Все участники предоставили информированное согласие на участие в этом исследовании, и исследования были одобрены их соответствующими институциональными наблюдательными советами.

    Сбор и согласование данных

    Процедура согласования и определение использования ГТ более подробно описаны в Дополнительных методах (доступны в Интернете).Информация о демографических и экологических факторах риска собиралась с помощью телефонных или личных интервью и / или структурированных анкет, заполняемых самостоятельно (24, 38, 39). Использование ГТ обычно определялось как любое использование, о котором сообщают сами пациенты, при базовом обследовании. Кроме того, когда-либо использование специфической рецептуры (только эстроген или эстроген плюс прогестин) HT было получено из 3 исследований (CCFR, CPSII и NHS). В качестве группы сравнения использовали тех, кто не использовал ГТ в контрольное время. Статус в постменопаузе был гармонизирован как 1) статус менопаузы, определенный в исследовании, если таковой имеется; 2) самооценка менопаузального статуса, если данные исследования не были доступны; или 3) возраст 55 лет и старше, если данные исследования и самооценки отсутствуют (40).

    Характеристики опухоли и молекулярное подтипирование

    Тестирование опухолевых маркеров проводилось с использованием ДНК, выделенной из образцов опухолевой ткани, фиксированных формалином и залитых парафином. Индивидуальные протоколы исследования различались, как указано ниже и более подробно описано в дополнительных методах (доступны в Интернете).

    MSI-тестирование в основном проводилось с использованием полимеразной цепной реакции (ПЦР) в соответствии с консенсусной панелью Bethesda Национального института рака (CCFR, CPS-II, MCCS, NHS) (41).Как правило, для классификации опухолей требовалось 4 или более интерпретируемых маркеров, с некоторыми вариациями в исследованиях, указанными в дополнительной таблице 1 (доступной в Интернете). Дополнительные используемые методы включают иммуногистохимию (NSHDS, EPIC и подмножество CCFR и MCCS) и панели мононуклеотидных маркеров (DACHS, DALS) (дополнительные методы, доступны в Интернете). Опухоли были классифицированы как MSI-high (MSI-H), если не менее 30% маркеров показали нестабильность, и MSI-L / MSS, если менее 30% производителей показали нестабильность.Статус MSI удалось определить для 3639 случаев CRC (93,4%).

    В большинстве исследований использовался анализ метилирования Methylight (42) для определения статуса CIMP, классифицируемого как положительный или отрицательный на основании 8- (CPS-II, EPIC, NHS, NSHDS) (43, 44) или 5-гена (CCFR, MCCS) (45–47) панель. Процент метилированного эталонного значения рассчитывали, чтобы определить, был ли каждый ген положительным по метилированию (обычно процент метилированного эталона> 10). DACHS использовала другую панель из 5 генов (48, 49) для определения статуса CIMP и основывала метилирование на наличии или отсутствии продукта ПЦР, специфичного для метилирования.DALS (50) определял статус CIMP с использованием классической панели CpG-островков (51, 52). Конкретные гены, включенные в каждую панель, подробности вызова статуса метилирования и количество присутствующих метилированных генов для классификации опухоли как CIMP-позитивной, приведены в дополнительной таблице 2 (доступна в Интернете). Статус CIMP может быть определен для 3453 случаев CRC (88,6%).

    В исследованиях использовались методы ПЦР, секвенирования и иммуногистохимии для оценки мутаций BRAF и KRAS , как подробно описано в дополнительных методах (доступно в Интернете).В большинстве исследований оценивали BRAF через мутации V600E в экзоне 15 и KRAS через мутации в кодонах 12 и 13, хотя в некоторых оценивали дополнительные локусы. Статус BRAF и KRAS можно было определить для 3564 (91,4%) и 3435 (88,1%) случаев CRC соответственно.

    Опухолевые пути были определены следующим образом в соответствии с ранее предложенными классификациями (3, 8): 1) Аденома-карцинома (традиционный) путь (MSS / MSI-L, CIMP-негативный, BRAF дикого типа, KRAS дикий тип), 2) альтернативный путь (MSS / MSI-L, CIMP-отрицательный, BRAF дикого типа, KRAS -мутированный) и 3) зубчатый путь (CIMP-положительный, BRAF -мутированный, KRAS дикого типа).Путь опухоли можно классифицировать для 2401 случая CRC (61,6%).

    Местоположение опухоли было получено из реестра и отчетов о патологии. Локализация была сгруппирована на основе кодов Международной классификации болезней (МКБ-9) следующим образом: 1) Проксимальный (153,0 / изгиб печени, 153,1 / поперечная ободочная кишка, 153,4 / слепая кишка, 153,6 / восходящая кишка), 2) дистальный (153,2 / нисходящий. ободочная кишка, 152,3 / сигмовидная кишка, 153,7 / изгиб селезенки) и 3) ректальная (154,0 / ректосигмовидное соединение, 154,1 / прямая кишка). Локализация опухоли может быть классифицирована для 3808 случаев CRC (97.7%).

    Статистический анализ

    Мы исключили женщин, которые находились в пре- или перименопаузе на исходном уровне исследования (934 случая, 760 контролей), а также женщин, у которых отсутствовали данные об использовании ГТ (208 случаев, 209 контролей). После исключения в наш анализ были включены 3898 случаев CRC и 4322 контроля (рис. 1).

    Рисунок 1.

    Обзор участников, включенных в аналитическую совокупность. A-C = аденома-карцинома; CIMP = фенотип метилатора CpG-островка; HT = гормональная терапия в постменопаузе; MSI = микроспутниковая нестабильность.* Группы только эстрогена и группы эстрогена плюс прогестин не исключают друг друга.

    Рисунок 1.

    Обзор участников, включенных в аналитическую совокупность. A-C = аденома-карцинома; CIMP = фенотип метилатора CpG-островка; HT = гормональная терапия в постменопаузе; MSI = микроспутниковая нестабильность. * Группы только эстрогена и группы эстрогена плюс прогестин не исключают друг друга.

    Отношения шансов (OR) и 95% доверительные интервалы (CI) из моделей логистической регрессии были использованы для аппроксимации относительных рисков для связи использования HT и CRC.Отдельные модели оценивали для каждого опухолеспецифичного результата с использованием полиномиальной логистической регрессии со статусом маркера опухоли по сравнению с контролем в качестве результата (например, BRAF -мутированный или BRAF дикого типа по сравнению с контролем). Все модели включали сайт исследования, а также ковариаты, выбранные априори на основе известных ассоциаций как с HT, так и с CRC. К ним относятся возраст в годах, индекс массы тела (ИМТ; нормальный или недостаточный [ИМТ <25], избыточный вес [ИМТ 25–30], ожирение [ИМТ> 30], неизвестно), статус курения (в настоящее время, в прошлом, никогда, неизвестно) , и родственник первой степени с CRC (да, нет, неизвестно).Вторичные анализы проводились для терапии только эстрогенами и комбинированной терапии эстрогенами и прогестинами. Для моделей полиномиальной логистической регрессии для оценки неоднородности отношения шансов по статусу маркера опухоли использовались тесты Wald χ 2 (53).

    Кроме того, был проведен анализ чувствительности, за исключением 1) женщин в возрасте 45 лет и моложе (n = 131) и 2) женщин с вероятным синдромом Линча на основе 4 онкомаркеров (определяемых как MSI-H, CIMP-негативный, BRAF wild -типа, KRAS дикого типа; n = 89), потому что обе популяции могут иметь уникальные факторы, изменяющие их риск CRC.Мы также выполнили метаанализ связи любого использования ГТ и риска CRC, чтобы оценить гетерогенность по центрам исследования.

    Все анализы проводились с использованием R версии 3.5.2 с двусторонним P менее 0,05, считающимся статистически значимым.

    Результаты

    Базовые популяционные характеристики 8220 женщин в постменопаузе в нашем исследовании показаны в таблице 1. По сравнению с контрольной группой, пациенты с большей вероятностью имели семейный анамнез CRC и были нынешними или бывшими курильщиками.Случаи реже были пользователями HT, чем контрольные (32,4% против 42,8%). Среди тех, у кого были данные по конкретным препаратам, случаи были менее вероятны, чем контрольные, использовали препараты, содержащие только эстроген (22,2% против 29,7%) и препараты эстрогена и прогестина (14,3% против 17,8%).

    Таблица 1.

    Исходные характеристики 8220 женщин в постменопаузе по статусу случай-контроль

    ) 9057 93 (2,4) 99545 ​​42974 9061 9057 9057 17,6573 ) 18573 3112 (37,9) 1) 45573 9057
    Характеристики a . Всего . Чемодан . Управление .
    (n = 8220) . (n = 3898) . (n = 4322) .
    Возраст, среднее (стандартное отклонение), лет 65,28 (9,08) 64,79 (9,54) 65,72 (8,62) ​​
    Возрастная группа, лет <45 101 (1.2) 84 (2,2) 17 (0,4)
    45–55 828 (10,1) 464 (11,9) 364 (8,4)
    55–65 2780 ( 33,8) 1246 (32,0) 1534 (35,5)
    65–75 3309 (40,3) 1561 (40,0) 1748 (40,4)
    > 75 543 (13,9) 659 (15,2)
    Родственник первой степени с CRC
    Да 1251 (15.2) 722 (18,5) 529 (12,2)
    Нет 6633 (80,7) 2994 (76,8) 3639 (84,2)
    Отсутствует 182 (4,7) 154 (3,6)
    Индекс массы тела
    Нормальный или недостаточный вес 3659 (44,5) 1613 (41,4) 20573
    Избыточный вес 2818 (34.3) 1322 (33,9) 1496 (34,6)
    Ожирение 1571 (19,1) 870 (22,3) 701 (16,2)
    Отсутствует4 79 (1,8)
    Курение
    Текущий курильщик 948 (11,5) 522 (13,4) 426 (9,9) курильщик 2619 (31.9) 1285 (33,0) 1334 (30,9)
    Никогда не курите 4477 (54,5) 2012 (51,6) 2465 (57,0)
    Отсутствует 176 (2,14) 79 (2,0) 97 (2,2)
    Раса, заявленная самим собой
    Белый 8077 (98,3) 3780 (97,0)
    Прочие 113 (1.4) 98 (2,5) 15 (0,4)
    Отсутствует 30 (0,4) 20 (0,5) 10 (0,2)
    Исследование
    CCFR 1985 (24,1) 1215 (31,2) 770 (17,8)
    CPSII 893 (10,9) 412 (10,6) 481 9057 D 9057 D 481 9057 D 9057 2074 (25.2) 872 (22,4) 1202 (27,8)
    DALS 891 (10,8) 427 (11,0) 464 (10,7)
    EPIC4 129 1,63 37 (0,9) 92 (2,1)
    MCCS 455 (5,5) 185 (4,7) 270 (6,2)
    NHS 1649 (20,1) 963 (22,3)
    НСХДС 144 (1.8) 64 (1,6) 80 (1,9)
    Любая гормональная терапия в постменопаузе использует
    Ever 1262 42,8)
    Никогда 5108 (62,1) 2636 (67,6) 2472 (57,2)
    Только эстроген
    506 (13,0) 654 (15,1)
    Никогда 3323 (40,4) 1778 (45,6) 1545 (35,7)
    Отсутствует 1614 (41,4) 2123 (49,1)
    Эстроген плюс прогестин
    Эвер 717 (8,7) 328 (8,4) Никогда 3758 (45.7) 1961 (50,3) 1797 (41,6)
    Отсутствует 3745 (45,6) 1609 (41,3) 2136 (49,4)
    Характеристики . 90,657 ) 90,6573 9061 905 905 905 905,9 Никогда не курите 9057 9057 ) 4910,410 9574 9224 Таблица 1.

    Исходные характеристики 8220 женщин в постменопаузе по статусу случай-контроль

    Всего . Чемодан . Управление .
    (n = 8220) . (n = 3898) . (n = 4322) .
    Возраст, среднее (стандартное отклонение), лет 65,28 (9,08) 64,79 (9,54) 65,72 (8,62) ​​
    Возрастная группа, лет 9057 <45 101 (1,2) 84 (2,2) 17 (0,4)
    45–55 828 (10,1) 464 (11,9) 364 (8,4)
    55 –65 2780 (33.8) 1246 (32,0) 1534 (35,5)
    65–75 3309 (40,3) 1561 (40,0) 1748 (40,4)
    > 75 543 (13,9) 659 (15,2)
    Родственник первой степени с CRC
    Да 1251 (15,2) 7224 (18574) 12.2)
    Нет 6633 (80.7) 2994 (76,8) 3639 (84,2)
    Отсутствует 336 (4,1) 182 (4,7) 154 (3,6)
    Индекс массы тела
    Нормальный или недостаточный вес 3659 (44,5) 1613 (41,4) 2046 (47,3)
    Избыточный вес 2818 (34,3) 1322 (33,9)
    Ожирение 1571 (19.1) 870 (22,3) 701 (16,2)
    Отсутствует 172 (2,1) 93 (2,4) 79 (1,8)
    Курение
    Действующий курильщик 948 (11,5) 522 (13,4) 426 (9,9)
    Бывший курильщик 2619 (31,9) 1285 (33,0) 4477 (54.5) 2012 (51,6) 2465 (57,0)
    Отсутствует 176 (2,1) 79 (2,0) 97 (2,2)
    Самостоятельно заявленная гонка
    Белый 8077 (98,3) 3780 (97,0) 4297 (99,4)
    Прочие 113 (1,4) 98 (2,5) 15 (0,4) 98 (2,5) 15 (0,4) 9057 Отсутствует 30 (0.4) 20 (0,5) 10 (0,2)
    Исследование
    CCFR 1985 (24,1) 1215 (31,2) 7704
    CPSII 893 (10,9) 412 (10,6) 481 (11,1)
    DACHS 2074 (25,2) 872 (22,4) 1205 9057 DACHS 9057 9057 9057 9057 891 (10.8) 427 (11,0) 464 (10,7)
    EPIC Швеция 129 (1,6) 37 (0,9) 92 (2,1)
    MCCS 455 (5,5) 185 (4,7) 270 (6,2)
    NHS 1649 (20,1) 686 (17,6) 963 963 (22,3)
    NSHDS 144 (1,8) 80 (1,9)
    Использование любой гормональной терапии в постменопаузе
    Всегда 3112 (37.9) 1262 (32,4) 1850 (42,8)
    Никогда 5108 (62,1) 2636 (67,6) 2472 (57,2)
    Всегда 1160 (14,1) 506 (13,0) 654 (15,1)
    Никогда 3323 (40,4) 1778 (45,6) Отсутствует 3737 (45.5) 1614 (41,4) 2123 (49,1)
    Эстроген плюс прогестин
    Ever 717 (8,7) )
    Никогда 3758 (45,7) 1961 (50,3) 1797 (41,6)
    Отсутствует 3745 (45,6) 1609 (41,3)
    1534 (35,5) ) 872 (22,4) 90,6573 37454 (45573) 1609 (41,3)
    Характеристики a . Всего . Чемодан . Управление .
    (n = 8220) . (n = 3898) . (n = 4322) .
    Возраст, средний (стандартное отклонение), лет 65.28 (9,08) 64,79 (9,54) 65,72 (8,62) ​​
    Возрастная группа, лет
    <45 101 (1,2) 84 () 9057 17 (0,4)
    45–55 828 (10,1) 464 (11,9) 364 (8,4)
    55–65 2780 (33,8) 1246 (32,0)
    65–75 3309 (40.3) 1561 (40,0) 1748 (40,4)
    > 75 1202 (14,6) 543 (13,9) 659 (15,2)
    Относительный элемент первой степени 4 с CRC 9057
    Есть 1251 (15,2) 722 (18,5) 529 (12,2)
    Нет 6633 (80,7)
    Отсутствует 336 (4.1) 182 (4,7) 154 (3,6)
    Индекс массы тела
    Нормальный или недостаточный вес 3659 (44,5) 16134 (41,4 47,3)
    Избыточный вес 2818 (34,3) 1322 (33,9) 1496 (34,6)
    Ожирение 1571 (19,1) 870 (2261,3)
    870 (2261,3)
    Отсутствует 172 (2.1) 93 (2,4) 79 (1,8)
    Курение
    Текущий курильщик 948 (11,5) 522 (13,4)
    Бывший курильщик 2619 (31,9) 1285 (33,0) 1334 (30,9)
    Никогда не курил 4477 (54,5) 2012 (51,6) 24654 (51,6) 24654 (24654) Отсутствует 176 (2.1) 79 (2,0) 97 (2,2)
    Раса, заявленная самостоятельно
    Белый 8077 (98,3) 3780 (97,0) 42974
    Другое 113 (1,4) 98 (2,5) 15 (0,4)
    Отсутствует 30 (0,4) 20 (0,5) 10 (0,2)
    Исследование
    CCFR 1985 (24.1) 1215 (31,2) 770 (17,8)
    CPSII 893 (10,9) 412 (10,6) 481 (11,1)
    DACHS 2074 (2557 1202 (27,8)
    DALS 891 (10,8) 427 (11,0) 464 (10,7)
    EPIC Швеция 129 (1,6) 9057 9057 ) 92 (2,1)
    MCCS 455 (5.5) 185 (4,7) 270 (6,2)
    NHS 1649 (20,1) 686 (17,6) 963 (22,3)
    NSHDS 144 (1,8) 64 (1,6) 80 (1,9)
    Использование любой гормональной терапии в постменопаузе
    Ever 3112 (37,9) 1262 (32613) 1262 (32613)
    Никогда 5108 (62.1) 2636 (67,6) 2472 (57,2)
    Только эстроген
    Ever 1160 (14,1) 1160 (14,1) 506 (1357,1)
    Никогда 3323 (40,4) 1778 (45,6) 1545 (35,7)
    Отсутствует 3737 (45,5) 1614 (41,4) Эстроген плюс прогестин
    Всегда 717 (8.7) 328 (8,4) 389 (9,0)
    Никогда 3758 (45,7) 1961 (50,3) 1797 (41,6)
    Отсутствует 2136 (49,4)
    40,3) 9057 93 (2,4) 99545 ​​42974 9061 9057 9057 17,6573 ) 18573 3112 (37,9) 1) 45573 9057
    Характеристики a . Всего . Чемодан . Управление .
    (n = 8220) . (n = 3898) . (n = 4322) .
    Возраст, среднее (стандартное отклонение), лет 65,28 (9,08) 64,79 (9,54) 65,72 (8,62) ​​
    Возрастная группа, лет 9057 <45 101 (1,2) 84 (2,2) 17 (0,4)
    45–55 828 (10.1) 464 (11,9) 364 (8,4)
    55–65 2780 (33,8) 1246 (32,0) 1534 (35,5)
    65–75 1561 (40,0) 1748 (40,4)
    > 75 1202 (14,6) 543 (13,9) 659 (15,2)
    относительный первой степени с CRC
    Есть 1251 (15.2) 722 (18,5) 529 (12,2)
    Нет 6633 (80,7) 2994 (76,8) 3639 (84,2)
    Отсутствует 182 (4,7) 154 (3,6)
    Индекс массы тела
    Нормальный или недостаточный вес 3659 (44,5) 1613 (41,4) 20573
    Избыточный вес 2818 (34.3) 1322 (33,9) 1496 (34,6)
    Ожирение 1571 (19,1) 870 (22,3) 701 (16,2)
    Отсутствует4 79 (1,8)
    Курение
    Текущий курильщик 948 (11,5) 522 (13,4) 426 (9,9) курильщик 2619 (31.9) 1285 (33,0) 1334 (30,9)
    Никогда не курите 4477 (54,5) 2012 (51,6) 2465 (57,0)
    Отсутствует 176 (2,14) 79 (2,0) 97 (2,2)
    Раса, заявленная самим собой
    Белый 8077 (98,3) 3780 (97,0)
    Прочие 113 (1.4) 98 (2,5) 15 (0,4)
    Отсутствует 30 (0,4) 20 (0,5) 10 (0,2)
    Исследование
    CCFR 1985 (24,1) 1215 (31,2) 770 (17,8)
    CPSII 893 (10,9) 412 (10,6) 481 9057 D 9057 D 481 9057 D 9057 2074 (25.2) 872 (22,4) 1202 (27,8)
    DALS 891 (10,8) 427 (11,0) 464 (10,7)
    EPIC4 129 1,63 37 (0,9) 92 (2,1)
    MCCS 455 (5,5) 185 (4,7) 270 (6,2)
    NHS 1649 (20,1) 963 (22,3)
    НСХДС 144 (1.8) 64 (1,6) 80 (1,9)
    Любая гормональная терапия в постменопаузе использует
    Ever 1262 42,8)
    Никогда 5108 (62,1) 2636 (67,6) 2472 (57,2)
    Только эстроген
    506 (13,0) 654 (15,1)
    Никогда 3323 (40,4) 1778 (45,6) 1545 (35,7)
    Отсутствует 1614 (41,4) 2123 (49,1)
    Эстроген плюс прогестин
    Эвер 717 (8,7) 328 (8,4) Никогда 3758 (45.7) 1961 (50,3) 1797 (41,6)
    Отсутствует 3745 (45,6) 1609 (41,3) 2136 (49,4)

    Многопараметрические ассоциации Состав ГТ, а также общий и специфический для опухолевых маркеров риск КРР представлены на Рисунке 2 и в дополнительной таблице 3 (доступна в Интернете). Когда-либо применение ГТ было связано со снижением риска КРР на 38% (ОШ = 0,62, 95% ДИ = 0,56–0,69). Оба используют только эстроген (OR = 0.71, 95% ДИ = 0,62-0,83) и составы эстроген плюс прогестин (OR = 0,76, 95% ДИ = 0,64-0,91) были связаны со сниженным риском CRC, хотя оценки эффекта были ослаблены по сравнению с любым использованием HT в этой подвыборке исследуемая популяция. Было отмечено несколько различий в исходных характеристиках между женщинами, у которых были и не были данные о конкретных препаратах (дополнительная таблица 4, доступная в Интернете).

    Рисунок 2.

    Связь между применением гормональной терапии (ГТ) в постменопаузе и колоректальным раком (CRC), в целом и в зависимости от препарата.A-C = аденома-карцинома; ДИ = доверительный интервал; CIMP = фенотип метилатора CpG-островка; CRC = колоректальный рак; MSI = микроспутниковая нестабильность; ИЛИ = отношение шансов.

    * Wald P <0,05. Значения Wald P сравнивают отношения шансов внутри группы; контрольными группами являются BRAF дикого типа, KRAS дикого типа, отрицательный по CIMP, традиционный, дистальный отдел толстой кишки.

    Контроли используются в качестве эталона для всех соотношений шансов. Все отношения шансов скорректированы с учетом возраста, индекса массы тела, статуса курения и семейного анамнеза первой степени CRC.

    ‡ Данные по конкретным препаратам были доступны только для подгруппы женщин (n = 4483 для приема только эстрогена; n = 4475 для эстрогена и прогестина).

    Рисунок 2.

    Связь между применением гормональной терапии (ГТ) в постменопаузе и колоректальным раком (CRC) в целом и в зависимости от препарата. A-C = аденома-карцинома; ДИ = доверительный интервал; CIMP = фенотип метилатора CpG-островка; CRC = колоректальный рак; MSI = микроспутниковая нестабильность; ИЛИ = отношение шансов.

    * Wald P <0.05. Wald P Значения сравнивают внутригрупповые отношения шансов; контрольными группами являются BRAF дикого типа, KRAS дикого типа, отрицательный по CIMP, традиционный, дистальный отдел толстой кишки.

    Контроли используются в качестве эталона для всех соотношений шансов. Все отношения шансов скорректированы с учетом возраста, индекса массы тела, статуса курения и семейного анамнеза первой степени CRC.

    ‡ Данные по конкретным препаратам были доступны только для подгруппы женщин (n = 4483 для приема только эстрогена; n = 4475 для эстрогена и прогестина).

    Среди случаев с соответствующими данными по опухолевым маркерам 19,8% были MSI-H (n = 719), 24,3% были CIMP-положительными (n = 841), 18,4% были BRAF -мутированными (n = 654) и 32,0 % были KRAS -мутированными (n = 1098). Когда-либо использование ГТ было связано со снижением риска почти всех подтипов опухолевых маркеров CRC, с некоторыми вариациями между подтипами (рис. 2; дополнительная таблица 3, доступная в Интернете). Связь любого использования ГТ и CRC была ослаблена среди CIMP-положительных случаев (OR = 0,74, 95% CI = 0.63–0,87) по сравнению с CIMP-отрицательными случаями (OR = 0,62, 95% CI = 0,55–0,69) ( P het = 0,04). Эта тенденция была постоянной для всех составов ГТ, хотя разница в соотношении шансов не была статистически значимой. Использование ГТ было обратно пропорционально связано как с мутировавшими по KRAS индивидуумами, так и с индивидами дикого типа. Эта связь была последовательной при использовании только эстрогена; однако составы эстрогена и прогестина не были статистически значимо связаны с KRAS -мутировавшими индивидуумами (OR = 0.90, 95% ДИ = от 0,70 до 1,14; P het = 0,09). Никаких различий для статуса мутации MSI или BRAF не наблюдалось.

    Из 2401 опухоли (61,6%), которые можно было классифицировать по пути, большинство были классифицированы как опухоли пути аденома-карцинома (48,4%; n = 1162), 32,9% классифицированы как опухоли альтернативного пути (n = 790) и 18,7% — зубчатый путь (n = 449). Не было отмечено серьезных различий в исходных характеристиках между женщинами, которые могли и не могли быть классифицированы по пути (дополнительная таблица 4, доступная в Интернете).Оценки эффекта для использования ГТ как при аденоме-карциноме, так и при альтернативных путях были аналогичны таковым для ГТ в целом (OR аденомы-карциномы = 0,63, 95% ДИ = 0,55–0,73; альтернативное OR = 0,61, 95% ДИ = 0,51–2). 0,72). Однако оценка эффекта была ослаблена и больше не была статистически значимой для опухолей, возникших по зубчатому пути (OR = 0,81, 95% CI = 0,66–1,01; P het против аденомы-карциномы = 0,04). Это различие не было постоянным для всех составов ГТ: для составов, содержащих только эстроген, когда-либо использование было статистически значимо обратно пропорционально связанным со всеми тремя путями (OR аденома-карцинома = 0.71, 95% ДИ = от 0,57 до 0,88; альтернативный OR = 0,60, 95% CI = 0,47-0,77; зубчатый OR = 0,72, 95% ДИ = 0,54–0,98), и не было статистической разницы между путями. Однако для составов эстроген плюс прогестин когда-либо использование было только статистически значимо связано с опухолями, возникшими по пути аденома-карцинома (OR = 0,70, 95% CI = 0,55–0,91).

    Большинство опухолей было расположено в проксимальном отделе толстой кишки (47,3%), причем опухоли дистального отдела толстой кишки (29,4%) лишь немного чаще, чем опухоли прямой кишки (23.3%). По сравнению с дистальным отделом толстой кишки (OR = 0,57, 95% ДИ = 0,49–0,66) и опухолями прямой кишки (OR = 0,54, 95% ДИ = 0,46–0,63), оценка эффекта ассоциации использования ГТ и опухолей проксимального отдела толстой кишки была ослаблена ( OR = 0,71, 95% ДИ = 0,62-0,80; P het vs дистальный = 0,01). Эта тенденция была последовательной для препаратов ГТ, хотя не было статистической разницы между опухолями проксимального и дистального отделов толстой кишки для препарата, содержащего только эстроген ( P het = 0,32).

    Не было отмечено существенных изменений в результатах после удаления 131 женщины в возрасте 45 лет и моложе или 89 женщин с молекулярно определенным синдромом Линча (дополнительные таблицы 5 и 6, доступны в Интернете). Результаты метаанализа соответствовали нашему объединенному основному анализу (суммарный OR = 0,64, 95% ДИ = 0,58–0,71; P het = 0,10).

    Обсуждение

    В этом большом объединенном исследовании женщин в постменопаузе использование ГТ, независимо от типа препарата, было связано со снижением риска CRC, что согласуется с предыдущими исследованиями (11–20).В целом, эта обратная связь наблюдалась независимо от статуса MSI, CIMP, BRAF или KRAS . Однако при рассмотрении всех опухолевых маркеров вместе и группировании случаев по общим путям и локализации опухоли ассоциация была ослаблена для опухолей, возникающих через зубчатый путь, и для опухолей проксимального отдела толстой кишки.

    Наши результаты не подтверждают гипотезу о том, что ассоциация HT и CRC различается отдельными опухолевыми маркерами MSI, BRAF и KRAS .Сильные обратные ассоциации наблюдались для использования HT и CRC, независимо от статуса BRAF и KRAS . Предыдущие исследования показали снижение риска почти на 20% среди тех, кто когда-либо принимал ГТ, независимо от статуса мутаций BRAF и KRAS , хотя оценки эффекта не достигли статистической значимости (22, 23). В этих исследованиях использовались значительно меньшие размеры выборок, чем у нас, что способствовало снижению способности обнаруживать различия в эффектах. Мы также наблюдали сильные обратные ассоциации для использования HT и MSI-L / MSS и MSI-H CRC.Предыдущие исследования несколько противоречивы в отношении ассоциации HT и статуса MSI, при этом большинство исследований предполагают ассоциацию только среди пациентов MSI-L / MSS (22, 24, 54). Есть много возможных объяснений этого несоответствия, включая размер выборки, дизайн исследования, контрольный период, используемый для подтверждения использования ГТ, и панели, используемые для классификации статуса MSI. Поскольку предыдущие исследования показали высокую согласованность между панелями MSI (41), мы подозреваем, что последняя оказала наименьшее влияние.

    Мы обнаружили некоторые доказательства того, что ассоциация ГТ различается в зависимости от статуса CIMP, при этом оценка ослабленного эффекта наблюдается для CIMP-положительных опухолей.Предыдущее исследование имело аналогичные результаты, сообщая о пограничной обратной связи между CIMP-отрицательными опухолями и об отсутствии связи между CIMP-положительными опухолями (22, 47). Этот результат следует интерпретировать с осторожностью, потому что CIMP не определяется единообразно во всех исследованиях, а на распространенность CIMP может влиять метод обнаружения и качество выборки.

    Наши результаты показывают, что комплексный подход к рассмотрению опухолевых маркеров вместе в качестве путей может выявить в противном случае туманные закономерности. Наши результаты показывают, что связь использования HT и CRC в значительной степени обусловлена ​​опухолями, возникающими через аденому-карциному и альтернативным путем.Эти опухоли составляют большинство случаев CRC, тогда как зубчатые опухоли составляют около 20-30% CRC (1, 3, 8, 55-57). Зубчатые опухоли, характеризуемые как CIMP-позитивные, BRAF -мутировавшие и KRAS дикого типа, имеют тенденцию вести себя более агрессивно, с более быстрым прогрессированием и худшим прогнозом (3, 8, 10, 56, 58–60). Основываясь на различном биологическом поведении, внешнем виде, распределении онкомаркеров и генетической предрасположенности зубчатых опухолей, вполне вероятно, что ГТ действительно может играть меньшую роль в их патогенезе.

    Мы также наблюдали более слабую связь с опухолями проксимального отдела толстой кишки, что согласуется с предыдущими исследованиями (22, 24). Имеются данные о том, что зубчатые опухоли с большей вероятностью развиваются в проксимальном отделе толстой кишки (8, 61, 62), поэтому неясно, являются ли это независимыми ассоциациями. В нашем исследовании большинство зубчатых опухолей (n = 391) были в проксимальном отделе толстой кишки. Связь использования ГТ и проксимальных опухолей была сходной (OR = 0,68, 95% CI = 0,60–0,78) после удаления зубчатых опухолей из анализа, что предполагает независимую связь.Однако 43,1% (n = 776) проксимальных опухолей не могут быть классифицированы по пути из-за неполных данных по маркерам опухолей, поэтому этот анализ ограничен. Проксимальный и дистальный отдел толстой кишки имеют разное эмбриологическое происхождение, микробиомы и микроокружение (62–66). Таким образом, они, по-видимому, предрасположены к разным типам опухолей. Например, опухоли проксимального отдела толстой кишки с большей вероятностью будут MSI-H, CIMP-положительными и муцинозными и чаще встречаются у женщин и пожилых людей (67–71). Необходимы дальнейшие исследования, чтобы лучше выяснить, делают ли различия в проксимальном отделе толстой кишки его менее чувствительным к действию эстрогенов (т.е. меньшее количество рецепторов, разная микробиота), являются ли предраковые поражения в проксимальном отделе толстой кишки нечувствительными к эстрогену на основе различий в канцерогенных путях. или какое-то сочетание факторов.

    Наши результаты показывают, что препараты как только эстроген, так и эстроген плюс прогестин снижают риск CRC. В целом, оценки эффекта были ослаблены для составов эстрогена и прогестина по сравнению с составами, содержащими только эстроген, что, возможно, отражает меньшую частоту воздействия. Однако общие тенденции были схожими. Присутствовали два основных исключения. Во-первых, в то время как использование только эстрогена и любое использование ГТ было связано примерно с 40% сокращением опухолей, возникающих по альтернативному пути, использование эстрогена плюс прогестин не было статистически значимо связано с этими опухолями.Это может указывать на то, что альтернативный путь туморогенеза специфически модифицируется эстрогеном, а не прогестином. Аналогичным образом, была нулевая связь между использованием эстрогена и прогестина и опухолями проксимального отдела толстой кишки, несмотря на снижение риска на 24–29% при приеме только эстрогена или любой ГТ соответственно.

    Насколько нам известно, это крупнейшее исследование по оценке того, различается ли связь между использованием ГТ и CRC в зависимости от индивидуальных опухолевых маркеров и локализации. Кроме того, это одно из немногих исследований, в которых комбинируются несколько опухолевых маркеров для оценки ассоциаций, специфичных для пути опухоли.При интерпретации наших результатов следует учитывать некоторые ограничения. Во-первых, вся информация о воздействии и эпидемиологической ковариате, включенная в этот анализ, была основана на самооценке, что могло привести к неправильной классификации воздействия. Во-вторых, использование ГТ оценивалось только в течение отчетного периода, и подробная информация о дозах, частоте и продолжительности использования обычно отсутствовала. В-третьих, мы не смогли оценить эндогенные гормоны, которые могут отражать возраст начала менархе, полового созревания или грудного вскармливания, что также может влиять на риск КРР.В-четвертых, есть некоторые свидетельства того, что пользователи ГТ с большей вероятностью будут проходить скрининг CRC (72, 73). Неясно, как это может повлиять на наши результаты, потому что эта взаимосвязь может быть осложнена различиями в чувствительности скринингового выявления конкретных подтипов CRC. Временные тенденции и региональные различия в скрининге и использовании ГТ также могут влиять на наблюдаемые ассоциации. Наконец, хотя это исследование включает население во многих регионах, участники были преимущественно белыми, и поэтому эти результаты не могут быть обобщены на другие расовые и этнические группы.

    В этом большом, многоцентровом исследовании мы наблюдали сильную обратную связь между использованием ГТ и риском CRC, независимо от индивидуальных онкомаркеров и рецептуры ГТ. Снижение риска может преимущественно отражать опухоли дистального отдела толстой или прямой кишки, а также опухоли, возникающие по пути аденома-карцинома (традиционный), поскольку связь между опухолями проксимального отдела толстой кишки и опухолями, возникающими по зубчатому пути, была относительно слабой. Дальнейшее изучение механизмов, лежащих в основе этих различий, может улучшить наше понимание подтип-специфичного риска CRC и путей туморогенеза.

    Финансирование

    Консорциум по генетике и эпидемиологии колоректального рака: эта работа была поддержана Национальным институтом рака, Национальными институтами здравоохранения, Министерством здравоохранения и социальных служб США R01 CA176272, U01 CA137088 и U01 CA164930. Это исследование частично финансировалось за счет гранта P30 CA015704 Национальных институтов здравоохранения / Национального института рака.

    Реестр семей рака толстой кишки (CCFR) частично поддерживался наградой Национального института рака / Национальных институтов здравоохранения номер U01 CA167551 и через соглашения о сотрудничестве Национального института рака / Национальных институтов здравоохранения U01 / U24 со следующими сайтами CCFR: Онтарио ( OFCCR) (CA074783), Сиэтл (SCCFR) (CA074794 и R01 CA076366) и австралийский (ACCFR) (CA074778 и CA097735).Содержание этой рукописи не обязательно отражает взгляды или политику Национального института рака или любого из сотрудничающих центров CCFR, а также упоминание торговых наименований, коммерческих продуктов или организаций не подразумевает одобрения правительства США или какого-либо онкологического реестра. , или CCFR.

    CPS-II: Американское онкологическое общество финансирует создание, поддержание и обновление когорты исследования профилактики рака II. Это исследование было проведено с одобрения Институционального наблюдательного совета.

    DACHS: Эта работа была поддержана Немецким исследовательским советом (BR 1704 / 6–1, BR 1704 / 6–3, BR 1704 / 6–4, CH 117 / 1–1, HO 5117 / 2–1, HE 5998 / 2–1, KL 2354 / 3–1, RO 2270 / 8–1 и BR 1704 / 17–1), Программа междисциплинарных исследований Национального центра опухолевых заболеваний Германии и Федерального министерства образования Германии. и исследования (01KH0404, 01ER0814, 01ER0815, 01ER1505A и 01ER1505B).

    DALS: Национальные институты здравоохранения (R01 CA48998).

    EPIC: Координация EPIC финансируется Европейской комиссией (DGSANCO) и Международным агентством по изучению рака.Национальные когорты поддерживаются Датским онкологическим обществом (Дания), Шведским онкологическим обществом, Шведским исследовательским советом и советами графств Сконе и Вестерботтен (Швеция).

    MCCS: набор этой когорты финансировался VicHealth and Cancer Council Victoria. MCCS был дополнительно поддержан грантами Австралийского национального совета по здравоохранению и медицинским исследованиям 509348, 209057, 251553 и 504711, а также инфраструктурой, предоставленной онкологическим советом Виктории. Случаи заболевания и их жизненный статус были установлены с помощью Регистра рака штата Виктория и Австралийского института здравоохранения и социального обеспечения, включая Национальный индекс смертности и Австралийскую базу данных по раку.

    Гарвардская когорта (NHS): NHS поддерживается Национальными институтами здравоохранения (R01 CA137178, P01 CA087969, UM1 CA186107, R01 CA151993, R35 CA197735, K07 CA1 и P50 CA127003).

    NSHDS: Шведское онкологическое общество; Фонд исследования рака в Северной Швеции; Шведский исследовательский совет; Мемориальный фонд Дж. К. Кемпе; Медицинский факультет Университета Умео, Умео, Швеция; и грант на передовые исследования от Совета графства Вестерботтен, Швеция.

    Исследователи Центра исследования рака имени Фреда Хатчинсона также получили поддержку от Национального института здоровья T32 CA0 и Национального института здоровья K05 CA152715.

    Примечания

    Роль спонсоров: Спонсоры не играли никакой роли в разработке исследования; сбор, анализ и интерпретация данных; написание рукописи; и решение представить рукопись для публикации.

    Вклад авторов: Концептуализация: JDL, MH, PAN; Курирование данных: TAH, BB, YL, UP; Формальный анализ: JDL, BB, LH, YL, WS; Финансирование: HB, PTC, ATC, JC, JCF, SJG, GGG, MJG, MH, MAJ, RLM, VM, NM, SO, LCS, MLS, SNT, BV, UP, PAN; Исследование: все авторы; Методология: JDL, LH; Администрация проекта: TAH, UP; Ресурсы: HB, PTC, ATC, JC, JCF, SJG, GGG, MJG, MH, MAJ, RLM, VM, NM, SO, LCS, MLS, SNT, BV, UP, PAN; Контроль: UP, PAN; Визуализация: JDL; Написание — первоначальный набросок: JDL, TAH, UP, PAN; Написание — просмотр и редактирование: все авторы.

    Раскрытие информации: У авторов нет конфликта интересов, о котором следует раскрывать.

    Выражение признательности: SCCFR: Авторы хотели бы поблагодарить участников и сотрудников исследований Гормонов и рака толстой кишки и Регистра семей рака Сиэтла (исследования CORE). CPS-II: авторы благодарят участников CPS-II и группу управления исследованием за их неоценимый вклад в это исследование. Авторы также хотели бы отметить вклад в это исследование центральных онкологических регистров при поддержке Национальной программы онкологических регистров Центров по контролю и профилактике заболеваний и онкологических регистров при поддержке программы эпидемиологии и конечных результатов Национального института рака.DACHS: Мы благодарим всех участников и сотрудничающих с ними врачей, а также Уте Хандте-Дауб, Утца Беншайд, Мухаббет Челик и Урсулу Эйлбер за отличную техническую помощь. EPIC: если авторы указаны как сотрудники Международного агентства по изучению рака / Всемирной организации здравоохранения, только авторы несут ответственность за взгляды, выраженные в этой статье, и они не обязательно представляют решения, политику или взгляды Международной организации. Агентство по изучению рака / Всемирная организация здравоохранения.Гарвардская когорта (NHS): протокол исследования был одобрен экспертным советом больницы Бригама и женщин и Гарварда Т. Chan School of Public Health, а также регистры участвующих реестров по мере необходимости. Мы хотели бы поблагодарить участников и сотрудников NHS за их ценный вклад, а также следующие государственные онкологические регистры за их помощь: AL, AZ, AR, CA, CO, CT, DE, FL, GA, ID, IL, IN, IA, KY, LA, ME, MD, MA, MI, NE, NH, NJ, NY, NC, ND, OH, OK, OR, PA, RI, SC, TN, TX, VA, WA, WY.Авторы несут полную ответственность за анализ и интерпретацию этих данных. MCCS: набор когорт в рамках совместного когортного исследования в Мельбурне финансировался VicHealth and Cancer Council Victoria. MCCS был дополнительно дополнен инфраструктурой, предоставленной онкологическим советом Виктории. Случаи заболевания и их жизненный статус были установлены с помощью Регистра рака штата Виктория и Австралийского института здравоохранения и социального обеспечения, включая Национальный индекс смертности и Австралийскую базу данных по раку. NSHDS: Исследователи NSHDS выражают благодарность Исследовательскому отделу биобанка Университета Умео, Программе интервенций Вестерботтен, исследованию MONICA в Северной Швеции и региону Вестерботтен за предоставленные данные и образцы и выражают признательность за вклад Биобанка Швеции при поддержке Шведского исследовательского совета (VR 2017 –00650).

    Список литературы

    1

    Jass

    JR.

    Классификация колоректального рака на основе соотношения клинических, морфологических и молекулярных признаков

    .

    Гистопатология

    .

    2007

    ;

    50

    (

    1

    ):

    113

    130

    ,2

    Jass

    JR.

    Молекулярная гетерогенность колоректального рака: значение для борьбы с раком

    .

    Surg Oncol

    .

    2007

    ;

    16

    (

    1

    ):

    7

    9

    ,3

    Леггетт

    B

    ,

    Whitehall

    V.

    Роль зубчатого пути в патогенезе колоректального рака

    .

    Гастроэнтерология

    .

    2010

    ;

    138

    (

    6

    ):

    2088

    2100

    ,4

    Самаддер

    NJ

    ,

    Фиркант

    RA

    ,

    Tillmans

    LS

    , и другие.

    Связь между молекулярными маркерами и путями колоректального рака с клинико-патологическими особенностями у пожилых женщин

    .

    Гастроэнтерология

    .

    2013

    ;

    145

    (

    2

    ):

    348

    356.e1-2

    .5

    Камбара

    T

    ,

    Simms

    LA

    ,

    Уайтхолл

    VL

    , и другие.

    Мутация BRAF связана с метилированием ДНК в зубчатых полипах и раке толстой кишки

    .

    Кишечник

    .

    2004

    ;

    53

    (

    8

    ):

    1137

    1144

    ,6

    Hawkins

    NJ

    ,

    Палата

    РЛ.

    Спорадический колоректальный рак с микросателлитной нестабильностью и их возможное происхождение в гиперпластических полипах и зубчатых аденомах

    .

    J Национальный онкологический институт

    .

    2001

    ;

    93

    (

    17

    ):

    1307

    1313

    ,7

    Мякинен

    МДж

    ,

    Георгий

    SMC

    ,

    Jernvall

    P

    , и другие.

    Колоректальный рак, связанный с зубчатой ​​аденомой — распространенность, гистологические особенности и прогноз

    .

    Дж. Патол

    .

    2001

    ;

    193

    (

    3

    ):

    286

    294

    ,8

    Кочарник

    JM

    ,

    Шиовиц

    S

    ,

    Фиппс

    AI.

    Молекулярные фенотипы колоректального рака и потенциальные клинические применения

    .

    Гастроэнтерол Реп (Oxf)

    .

    2015

    ;

    3

    (

    4

    ):

    269

    276

    ,9

    Злобец

    I

    ,

    Биль

    MP

    ,

    Foerster

    A

    , и другие.

    Стратификация и прогностическая значимость молекулярной классификации колоректального рака Джасса

    .

    Передняя Oncol

    .

    2012

    ;

    2

    :

    7

    .10

    Phipps

    AI

    ,

    Лимбург

    PJ

    ,

    Барон

    JA

    , и другие.

    Связь между молекулярными подтипами колоректального рака и выживаемостью пациентов

    .

    Гастроэнтерология

    .

    2015

    ;

    148

    (

    1

    ):

    77

    87 e2

    .11

    Андерсон

    GL

    ,

    Лимачер

    М

    ,

    Ассаф

    АР

    , и другие.

    Эффекты конъюгированного конского эстрогена у женщин в постменопаузе, перенесших гистерэктомию: рандомизированное контролируемое исследование Инициативы по охране здоровья женщин

    .

    JAMA

    .

    2004

    ;

    291

    (

    14

    ):

    1701

    1712

    .12

    Calle

    EE

    ,

    Miracle-McMahill

    HL

    ,

    Thun

    MJ

    , и другие.

    Заместительная терапия эстрогенами и риск смертельного рака толстой кишки в проспективной когорте женщин в постменопаузе

    .

    J Национальный онкологический институт

    .

    1995

    ;

    87

    (

    7

    ):

    517

    523

    .13

    Фернандес

    E

    ,

    Ла Веккья

    C

    ,

    Брага

    C

    , и другие.

    Заместительная гормональная терапия и риск рака прямой и толстой кишки

    .

    Биомаркеры эпидемиологии рака Пред.

    .

    1998

    ;

    7

    (

    4

    ):

    329

    333

    .14

    Grodstein

    F

    ,

    Мартинес

    ME

    ,

    Platz

    EA

    , и другие.

    Использование гормонов в постменопаузе и риск развития колоректального рака и аденомы

    .

    Энн Интерн Мед.

    .

    1998

    ;

    128

    (

    9

    ):

    705

    712

    .15

    Grodstein

    F

    ,

    Ньюкомб

    PA

    ,

    Stampfer

    MJ.

    Гормональная терапия в постменопаузе и риск колоректального рака: обзор и метаанализ

    .

    Am J Med

    .

    1999

    ;

    106

    (

    5

    ):

    574

    582

    ,16

    Кэмпбелл

    PT

    ,

    Ньюкомб

    П

    ,

    Галлингер

    S

    , и другие.

    Экзогенные гормоны и риск колоректального рака в Канаде: ассоциации, стратифицированные клинически определенным семейным риском рака

    .

    Контроль причин рака

    .

    2007

    ;

    18

    (

    7

    ):

    723

    733

    .17

    Джонсон

    JR

    ,

    Лейси

    СП

    ,

    Лазович

    D

    , и другие.

    Гормональная терапия менопаузы и риск колоректального рака

    .

    Биомаркеры эпидемиологии рака Пред.

    .

    2009

    ;

    18

    (

    1

    ):

    196

    203

    .18

    Rennert

    G

    ,

    Rennert

    HS

    ,

    Пинчева

    М

    , и другие.

    Использование заместительной гормональной терапии и риск колоректального рака

    .

    Дж. Клин Онкол

    .

    2009

    ;

    27

    (

    27

    ):

    4542

    4547

    ,19

    Лин

    кДж

    ,

    Cheung

    WY

    ,

    Лай

    JY

    , и другие.

    Влияние эстрогеновой терапии по сравнению с комбинированной эстроген-прогестагенной терапией на риск колоректального рака

    .

    Инт Дж. Рак

    .

    2012

    ;

    130

    (

    2

    ):

    419

    430

    ,20

    Зеленый

    J

    ,

    Czanner

    G

    ,

    Ривз

    G

    , и другие.

    Менопаузальная гормональная терапия и риск рака желудочно-кишечного тракта: вложенное исследование случай-контроль в проспективной когорте и метаанализ

    .

    Инт Дж. Рак

    .

    2012

    ;

    130

    (

    10

    ):

    2387

    2396

    .21

    Ньюкомб

    PA

    ,

    Барон

    Дж

    ,

    Коттеркио

    M

    , и другие.

    Семейный реестр рака толстой кишки: международный ресурс для исследований генетической эпидемиологии рака толстой кишки

    .

    Биомаркеры эпидемиологии рака Пред.

    .

    2007

    ;

    16

    (

    11

    ):

    2331

    2343

    .22

    Лимсу

    D

    ,

    Фиркант

    RA

    ,

    Tillmans

    LS

    , и другие.

    Гормональная терапия в постменопаузе и риск колоректального рака по молекулярно определенным подтипам среди пожилых женщин

    .

    Кишечник

    .

    2012

    ;

    61

    (

    9

    ):

    1299

    1305

    ,23

    Лимбург

    PJ

    ,

    Лимсуй

    Д

    ,

    Фиркант

    RA

    , и другие.

    Гормональная терапия в постменопаузе и риск колоректального рака в связи с статусом соматической мутации KRAS среди пожилых женщин

    .

    Биомаркеры эпидемиологии рака Пред.

    .

    2012

    ;

    21

    (

    4

    ):

    681

    684

    .24

    Newcomb

    PA

    ,

    Чжэн

    Y

    ,

    Чиа

    VM

    , и другие.

    Использование эстрогена и прогестина, микросателлитная нестабильность и риск колоректального рака у женщин

    .

    Cancer Res

    .

    2007

    ;

    67

    (

    15

    ):

    7534

    7539

    .25

    Коттеркио

    M

    ,

    McKeown-Eyssen

    G

    ,

    Сазерленд

    H

    , и другие.

    Регистр семейного рака толстой кишки Онтарио: методы и показатели ответа в первый год

    .

    Хронический диск

    .

    2000

    ;

    21

    (

    2

    ):

    81

    86

    .26

    Winship

    I

    ,

    Win

    AK.

    Австралазийский семейный регистр колоректального рака

    .

    Med J Aust

    .

    2012

    ;

    197

    (

    9

    ):

    480

    481

    ,27

    Phipps

    AI

    ,

    Ньюкомб

    PA

    ,

    Гарсия-Альбенис

    X

    , и другие.

    Связь между локусами восприимчивости к колоректальному раку и временем выживания после диагностики колоректального рака

    .

    Гастроэнтерология

    .

    2012

    ;

    143

    (

    1

    ):

    51

    54.e4

    ,28

    Петерс

    U

    ,

    Цзяо

    S

    ,

    Шумахер

    FR

    , и другие.

    Идентификация локусов генетической предрасположенности к колоректальным опухолям с помощью полногеномного метаанализа

    .

    Гастроэнтерология

    .

    2013

    ;

    144

    (

    4

    ):

    799

    807.e24

    ,29

    Calle

    EE

    ,

    Родригес

    C

    ,

    Джейкобс

    EJ

    , и другие.

    Когорта по питанию, проведенное Американским онкологическим обществом по профилактике рака II: обоснование, дизайн исследования и исходные характеристики

    .

    Рак

    .

    2002

    ;

    94

    (

    9

    ):

    2490

    2501

    .30

    Бреннер

    H

    ,

    Чанг-Клод

    Дж

    ,

    Зайлер

    CM

    , и другие.

    Защита от колоректального рака после колоноскопии: популяционное исследование случай-контроль

    .

    Энн Интерн Мед.

    .

    2011

    ;

    154

    (

    1

    ):

    22

    30

    .31

    Амитай

    EL

    ,

    Карр

    PR

    ,

    Янсен

    L

    , и другие.

    Связь аспирина и нестероидных противовоспалительных препаратов с риском колоректального рака по молекулярным подтипам

    .

    J Национальный онкологический институт

    .

    2019

    ;

    111

    (

    5

    ):

    475

    483

    .32

    Slattery

    ML

    ,

    Гончар

    Дж

    ,

    Каан

    B

    , и другие.

    Энергетический баланс и рак толстой кишки — помимо физической активности

    .

    Cancer Res

    .

    1997

    ;

    57

    (

    1

    ):

    75

    80

    .33

    Риболи

    E

    ,

    Каакс

    р.

    Проект EPIC: обоснование и дизайн исследования. Европейское проспективное исследование рака и питания

    .

    Int J Epidemiol

    .

    1997

    ;

    26 (дополнение 1

    ):

    S6

    14

    .34

    Giles

    GG

    ,

    Английский

    DR.

    Мельбурнское совместное когортное исследование

    .

    IARC Sci Publ

    .

    2002

    ;

    156

    :

    69

    70

    .35

    Belanger

    CF

    ,

    Hennekens

    CH

    ,

    Роснер

    Б

    , и другие.

    Исследование здоровья медсестер

    .

    Am J Nurs

    .

    1978

    ;

    78

    (

    6

    ):

    1039

    1040

    .36

    Colditz

    GA

    ,

    Мэнсон

    JE

    ,

    Ханкинсон

    SE.

    Исследование здоровья медсестер: 20-летний вклад в понимание здоровья женщин

    .

    J Здоровье женщин

    .

    1997

    ;

    6

    (

    1

    ):

    49

    62

    .37

    Hallmans

    G

    ,

    Агрен

    А

    ,

    Йоханссон

    G

    , и другие.

    Сердечно-сосудистые заболевания и диабет в исследовании здоровья и болезней Северной Швеции Когортная оценка факторов риска и их взаимодействия

    .

    Scand J Public Health Suppl

    .

    2003

    ;

    31

    (

    61_suppl

    ):

    18

    24

    .38

    Colditz

    GA.

    Гормональная терапия менопаузы после рака груди

    .

    Рак молочной железы Res

    .

    2005

    ;

    7

    (

    4

    ):

    168

    170

    .39

    Hoffmeister

    M

    ,

    Raum

    E

    ,

    Крчил

    А

    , и другие.

    Нет данных об изменении риска колоректального рака, связанного с различными типами постменопаузальной гормональной терапии

    .

    Clin Pharmacol Ther

    .

    2009

    ;

    86

    (

    4

    ):

    416

    424

    .40

    Stampfer

    MJ

    ,

    Colditz

    GA

    ,

    Willett

    WC

    , и другие.

    Постменопаузальная эстрогеновая терапия и сердечно-сосудистые заболевания. Десятилетнее наблюдение по результатам исследования здоровья медсестер

    .

    N Engl J Med

    .

    1991

    ;

    325

    (

    11

    ):

    756

    762

    .41

    Боланд

    CR

    ,

    Тибодо

    SN

    ,

    Гамильтон

    SR

    , и другие.

    Семинар Национального института рака по микросателлитной нестабильности для выявления рака и семейной предрасположенности: разработка международных критериев для определения микросателлитной нестабильности при колоректальном раке

    .

    Cancer Res

    .

    1998

    ;

    58

    (

    22

    ):

    5248

    5257

    .42

    Eads

    CA

    ,

    Даненберг

    KD

    ,

    Каваками

    К

    , и другие.

    MethyLight: высокопроизводительный анализ для измерения метилирования ДНК

    .

    Nucleic Acids Res

    .

    2000

    ;

    28

    (

    8

    ):

    E32

    .43

    Dahlin

    AM

    ,

    Палмквист

    R

    ,

    Хенрикссон

    ML

    , и другие.

    Роль фенотипа метилатора CpG-островка в прогнозе колоректального рака зависит от статуса скрининга микросателлитной нестабильности

    .

    Clin Cancer Res

    .

    2010

    ;

    16

    (

    6

    ):

    1845

    1855

    .44

    Огино

    S

    ,

    Кавасаки

    т

    ,

    Киркнер

    GJ

    , и другие.

    Низкий фенотип метилатора CpG-островка (низкий уровень CIMP) при колоректальном раке: возможные ассоциации с мужским полом и мутациями KRAS

    .

    Дж Мол Диаг

    .

    2006

    ;

    8

    (

    5

    ):

    582

    588

    .45

    Английский

    DR

    ,

    Молодой

    JP

    ,

    Симпсон

    JA

    , и другие.

    Этническая принадлежность и риск развития колоректального рака с соматической мутацией BRAF V600E или фенотипом метилирующего островка CpG

    .

    Биомаркеры эпидемиологии рака Пред.

    .

    2008

    ;

    17

    (

    7

    ):

    1774

    1780

    .46

    Weisenberger

    DJ

    ,

    Siegmund

    KD

    ,

    Кампан

    М

    , и другие.

    Фенотип метилирования острова CpG лежит в основе спорадической микросателлитной нестабильности и тесно связан с мутацией BRAF при колоректальном раке

    .

    Нат Генет

    .

    2006

    ;

    38

    (

    7

    ):

    787

    793

    .47

    Weisenberger

    DJ

    ,

    Левин

    AJ

    ,

    Длинный

    TI

    , и другие.

    Связь фенотипа метилитора колоректального острова CpG с молекулярными особенностями, факторами риска и семейным анамнезом

    .

    Биомаркеры эпидемиологии рака Пред.

    .

    2015

    ;

    24

    (

    3

    ):

    512

    519

    .48

    Carr

    PR

    ,

    Янсен

    L

    ,

    Bienert

    S

    , и другие.

    Связь употребления красного и переработанного мяса с основными молекулярными патологическими признаками колоректального рака

    .

    Eur J Epidemiol

    .

    2017

    ;

    32

    (

    5

    ):

    409

    418

    .49

    Варт

    A

    ,

    Kloor

    M

    ,

    Ширмахер

    П

    , и другие.

    Генетика и эпигенетика аденокарциномы тонкой кишки: взаимодействие CIN, MSI и CIMP

    .

    Мод Pathol

    .

    2011

    ;

    24

    (

    4

    ):

    564

    570

    .50

    Самовиц

    WS

    ,

    Суини

    C

    ,

    Херрик

    Дж

    , и другие.

    Низкая выживаемость, связанная с мутацией BRAF V600E при микросателлитно-стабильном раке толстой кишки

    .

    Cancer Res

    .

    2005

    ;

    65

    (

    14

    ):

    6063

    6069

    .51

    Рашид

    A

    ,

    Шэнь

    L

    ,

    Моррис

    JS

    , и другие.

    Метилирование CpG-островков в колоректальных аденомах

    .

    Ам Дж. Патол

    .

    2001

    ;

    159

    (

    3

    ):

    1129

    1135

    .52

    Парк

    SJ

    ,

    Рашида

    А

    ,

    Ли

    JH

    , и другие.

    Частое метилирование CpG-островков в зубчатых аденомах толстой кишки

    .

    Ам Дж. Патол

    .

    2003

    ;

    162

    (

    3

    ):

    815

    822

    .53

    Fox

    J.

    Прикладной регрессионный анализ и обобщенные линейные модели

    . 3-е изд.

    Thousand Oaks, VA

    :

    SAGE Publications, Inc

    ;

    2016

    .54

    Слэттери

    ML

    ,

    Поттер

    JD

    ,

    Куртин

    К

    , и другие.

    Снижение эстрогенов и отмена эстрогенов увеличивают риск развития рака толстой кишки, положительного по микросателлитной нестабильности

    .

    Cancer Res

    .

    2001

    ;

    61

    (

    1

    ):

    126

    130

    .55

    Snover

    DC.

    Обновленная информация о зубчатом пути к колоректальной карциноме

    .

    Хум Патол

    .

    2011

    ;

    42

    (

    1

    ):

    1

    10

    .56

    Bettington

    M

    ,

    Ходунки

    N

    ,

    Clouston

    A

    , и другие.

    Зазубренный путь к колоректальной карциноме: современные концепции и проблемы

    .

    Гистопатология

    .

    2013

    ;

    62

    (

    3

    ):

    367

    386

    .57

    Vogelstein

    B

    ,

    Фирон

    ER

    ,

    Гамильтон

    SR

    , и другие.

    Генетические изменения при развитии колоректальной опухоли

    .

    N Engl J Med

    .

    1988

    ;

    319

    (

    9

    ):

    525

    532

    .58

    Бернетт-Хартман

    AN

    ,

    Ньюкомб

    PA

    ,

    Поттер

    JD

    , и другие.

    Геномные аберрации, встречающиеся в подмножествах зубчатых колоректальных поражений, но не в обычных аденомах

    .

    Cancer Res

    .

    2013

    ;

    73

    (

    9

    ):

    2863

    2872

    .59

    Groff

    RJ

    ,

    Наш

    R

    ,

    Анен

    DJ.

    Значение зубчатых полипов толстой кишки

    .

    Curr Gastroenterol Rep

    .

    2008

    ;

    10

    (

    5

    ):

    490

    498

    ,60

    Li

    SC

    ,

    Бургарт

    Л.

    Гистопатология зубчатой ​​аденомы, ее вариантов и дифференциация от обычных аденоматозных и гиперпластических полипов

    .

    Arch Pathol Lab Med

    .

    2007

    ;

    131

    (

    3

    ):

    440

    445

    .61

    Ямаути

    M

    ,

    Морикава

    T

    ,

    Кучиба

    А

    , и другие.

    Оценка молекулярных особенностей колоректального рака вдоль участков кишечника ставит под сомнение концепцию четкой дихотомии проксимального и дистального отделов толстой кишки

    .

    Кишечник

    .

    2012

    ;

    61

    (

    6

    ):

    847

    854

    ,62

    Ли

    GH

    ,

    Malietzis

    G

    ,

    Аскари

    А

    , и другие.

    Отличается ли правосторонний рак толстой кишки от левостороннего колоректального рака? Систематический обзор

    .

    евро J Surg Oncol

    .

    2015

    ;

    41

    (

    3

    ):

    300

    308

    .63

    Mowat

    AM

    ,

    Agace

    WW.

    Региональная специализация по кишечной иммунной системе

    .

    Нат Рев Иммунол

    .

    2014

    ;

    14

    (

    10

    ):

    667

    685

    .64

    Мерлано

    MC

    ,

    Granetto

    C

    ,

    Fea

    E

    , и другие.

    Неоднородность рака толстой кишки: от скамьи к постели

    .

    ESMO Открыть

    .

    2017

    ;

    2

    (

    3

    ):

    e000218

    .65

    Хупер

    LV

    ,

    Литтман

    DR

    ,

    Macpherson

    AJ.

    Взаимодействие между микробиотой и иммунной системой

    .

    Наука

    .

    2012

    ;

    336

    (

    6086

    ):

    1268

    1273

    .66

    Macfarlane

    GT

    ,

    Macfarlane

    LE.

    Получение, развитие и поддержание нормальной микробиоты кишечника

    .

    Dig Dis

    .

    2009

    ;

    27

    (

    1

    ):

    90

    98

    .67

    Iacopetta

    B.

    Есть две стороны колоректального рака?

    Инт Дж. Рак

    .

    2002

    ;

    101

    (

    5

    ):

    403

    408

    .68

    Герваз

    P

    ,

    Бухер

    П

    ,

    Morel

    P.

    Два рака толстой кишки — два рака: изменение парадигмы и клинические последствия

    .

    J Surg Oncol

    .

    2004

    ;

    88

    (

    4

    ):

    261

    266

    0,69

    Slattery

    ML

    ,

    Куртин

    К

    ,

    Вольф

    RK

    , и другие.

    Сравнение изменений соматической ДНК прямой и толстой кишки

    .

    Диск прямой кишки

    .

    2009

    ;

    52

    (

    7

    ):

    1304

    1311

    .70

    Minoo

    P

    ,

    Злобец

    I

    ,

    Петерсон

    M

    , и другие.

    Характеристика рака прямой, проксимальной и дистальной части толстой кишки на основе клинико-патологических, молекулярных и белковых профилей

    .

    Инт Дж. Онкол

    .

    2010

    ;

    37

    (

    3

    ):

    707

    718

    ,71

    Ang

    PW

    ,

    Loh

    M

    ,

    Liem

    N

    , и другие.

    Всестороннее профилирование метилирования ДНК при колоректальном раке выявляет подгруппы с отчетливыми клинико-патологическими и молекулярными особенностями

    .

    BMC Рак

    .

    2010

    ;

    10

    (

    1

    ):

    227

    ,72

    Prihartono

    N

    ,

    Палмер

    JR

    ,

    Луик

    С

    , и другие.

    Исследование случай-контроль использования добавок женских гормонов в постменопаузе в отношении риска рака толстой кишки

    .

    Биомаркеры эпидемиологии рака Пред.

    .

    2000

    ;

    9

    (

    4

    ):

    443

    447

    .73

    Барретт-Коннор

    E.

    Эстроген в постменопаузе и предвзятость профилактики

    .

    Энн Интерн Мед.

    .

    1991

    ;

    115

    (

    6

    ):

    455

    456

    .

    © Автор (ы) 2020. Опубликовано Oxford University Press.

    Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0/), которая разрешает неограниченное повторное использование, распространение и воспроизведение на любом носителе при условии, что оригинал работа правильно процитирована.

    S-EQUOL ПРЕДОТВРАЩАЕТ ПОТЕРЮ ПРОЧНОСТИ КОСТЕЙ ПРИ МОДЕЛИ ОСТЕОПОРОЗА КРЫС • JARLIFE

    J.A. Ю-Яхиро 1 , К.Б. Руфф 2 , Б.Г. Парки 1 , В.С. Синьков 1 , И. Мерченталер 3

    1. Отделение ортопедической хирургии, Мемориальный госпиталь MedStar Union, Балтимор, Мэриленд; 2. Функциональная анатомия и эволюция, Медицинская школа Джона Хопкинса, Балтимор, Мэриленд; 3. Эпидемиология и общественное здравоохранение и анатомия / нейробиология, Медицинский факультет Университета Мэриленда, Балтимор, Мэриленд.

    Автор, ответственный за переписку: Джанет А. Ю-Яхиро, доктор философии, Ортопедия Мемориала Союза МедСтар, Профессиональное здание Джонстона, # 400, 3333 Норт Калверт-Стрит, Балтимор, Мэриленд 21218, 001-410-554-6668; факс 001-410-261-8105; электронная почта: [email protected]


    Аннотация

    Предпосылки: изучить влияние S-эквола, селективного ß-агониста рецептора эстрогена, вырабатываемого у некоторых индивидуумов путем биотрансформации изофлавона сои даидзеина, на структуру костей, прочность костей и метаболизм у сверхэктомированных крыс.Дизайн: контролируемое исследование на животных. Участники: Всего 75 крыс-самок. Вмешательство: Животные были разделены на 5 групп: овариэктомированные (OVX), OVX + 17-бета-эстрадиолбензоат (EB), OVX + S-эквол (30 мг / кг), OVX + S-эквол (100 мг / кг) и ШАМ. Животные получали лекарственное средство или носитель в течение 60 дней. При умерщвлении иссекали правые бедра и позвонки (L3 и L4). Измерения: плотность костной ткани и структурные параметры измеряли с помощью pQCT. Были проведены механическое тестирование и количественная гистоморфометрия. Были измерены маркеры костного метаболизма и веса матки.Результаты: более высокая доза S-эквола сохранила механическую прочность кости. Прочность на сжатие позвонков, прочность на изгиб бедренной кости и толщина кортикального слоя бедренной кости не различались между группами S-эквол (100 мг / кг), SHAM и EB, и все они были значительно выше, чем в группах OVX и S-эквол (30 мг / кг). . Не было обнаружено различий в количестве остеокластов или минеральном составе костной ткани позвонков, а сывороточные маркеры костного метаболизма не соответствовали структуре различий в показателях силы. Масса матки в группе с более высокой дозой S-эквол была значительно ниже, чем в группах SHAM и EB.Выводы. Обработка крыс OVX S-экволом (100 мг / кг) приводила к сохранению прочности и объема позвоночной и бедренной костей, не отличающимся от такового у крыс SHAM или EB. Более высокая доза S-эквола вызывала меньшую стимуляцию матки, чем эндогенный или синтетический эстроген. Эти результаты предполагают, что S-эквол требует дальнейшего изучения в качестве возможной альтернативы заместительной терапии эстрогеном для лечения остеопороза.

    Ключевые слова: Механическая нагрузка, кость, маркеры метаболизма кости, гистоморфометрия кости.


    Введение

    Последствия остеопороза и связанных с ним остеопоротических переломов разрушительны как с медицинской, так и с экономической точки зрения. Сегодня только в США ежегодно происходит более 2 миллионов остеопоротических переломов, лечение которых обходится более чем в 17 миллиардов долларов в год. По оценкам, к 2025 году количество переломов увеличится на 50%, а стоимость лечения этих переломов превысит 25 миллиардов долларов в год (8). От 16% до 32% тех, кто страдает переломом бедра в США.С. погибают в течение первого года после перелома (4, 11). Многие из тех, кто выжил, нуждаются в вспомогательных приспособлениях для ходьбы и могут выполнять меньше самостоятельных повседневных дел по сравнению с тем, что было до перелома (27).

    Снижение выработки эстрогенов во время менопаузы связано с длительной потерей минеральной плотности костной ткани и увеличением частоты переломов. Несмотря на то, что они эффективны в предотвращении потери минеральной плотности костной ткани после менопаузы, некоторые из существующих антирезорбтивных агентов связаны с нежелательными побочными эффектами, включая повышенный риск рака яичников и матки (24).Гормон паращитовидной железы, анаболический агент, вызывает усиление моделирования и ремоделирования костей. Однако, по-видимому, наиболее благоприятные эффекты он оказывает в первые месяцы лечения, и такие эффекты, по-видимому, полностью исчезают после прекращения лечения, если после прекращения лечения не вводится дополнительный антирезорбтивный агент, такой как бисфосфонат (13). Было бы желательно определить другие средства для лечения остеопороза, возникающего в результате снижения выработки эстрогена.

    Ряд отчетов предполагает, что соя, изофлавоны, содержащиеся в сое, и рацемический эквол улучшают качество костей и предотвращают потерю минеральной плотности костей у животных и людей (12, 15, 19, 30, 35, 40), но исследования не дают окончательных выводов относительно его механизм действия.S-эквол — это изофлавон, продуцируемый бактериальной биотрансформацией даидзеина, изофлавона сои, у некоторых людей (32). S-энантиомер эквола, S-эквол, представляет собой биологически активный цефтин, который используется для лечения соединения, которое является лигандом рецептора эстрогена с сродством к ER α в 30 раз ниже, чем к ER β (рис. 1) (23). В контролируемых клинических исследованиях с участием женщин в постменопаузе потребление даидзеина было связано с улучшением минеральной плотности костной ткани (МПК) у тех субъектов, которые являются продуцентами эквола (3, 17, 32, 40).Пероральная биодоступность S-эквола высокая (82%) (33).

    Недавнее двойное слепое рандомизированное контролируемое исследование показало, что лечение S-эквол у женщин в постменопаузе, не продуцирующих S-эквол, привело к заметному подавлению резорбции кости и отсутствию снижения минеральной плотности кости (36). Ни одно исследование еще не оценивало клиническое влияние чистого S-эквола на механическую прочность кости или на структуру и формирование кости. Наша цель состояла в том, чтобы сравнить различные показатели качества и прочности костей у овариэктомированных (OVX) крыс, получавших лечение S-экволом или эстрогеном, и у крыс с ложной операцией.Мы предположили, что S-эквол будет поддерживать механическую прочность костей способом, сравнимым с эндогенным или синтетическим эстрогеном, и что измерения структуры, образования и резорбции кости, измеренные костными маркерами и количественной гистоморфометрией у крыс, получавших S-эквол, будут аналогичны тем, которые обнаруживаются при ложно прооперированном или леченном эстрогеном OVX у пациентов с диабетом. пн, 20.01.2014 — 18:36. если вы захотите получить больше крыс.

    Рисунок 1: Схема молекулы S-эквола

    Материалы и методы

    Материалы

    S-эквол (чистота, 98.8%) был получен от Girindus Solvay America, Inc. (Цинциннати, Огайо, США).

    Животная модель

    Мы получили разрешение комитета по уходу за животными и использованию на исследование от Комитета по уходу и использованию животных Университета Мэриленда. Семьдесят пять самок крыс в возрасте 60 дней были разделены на 5 групп по 15 животных в каждой: OVX, OVX с замещением эстрогена (17-бета-эстрадиолбензоат) 0,4 мг / кг (EB) (7), OVX с S-экволом (30 мг / кг) или (100 мг / кг) и фиктивный OVX (SHAM). S-эквол растворяли в ДМСО до определенной дозы с кунжутным маслом так, чтобы конечная концентрация ДМСО составляла 5%.Группам OVX и SHAM давали ДМСО / кунжутное масло. Количество носителя, даваемого каждой крысе, составляло 0,5 мл. Лечение началось в день операции. Животных лечили в течение 60 дней, получая ежедневные пероральные дозы лекарственного средства или носителя. Все дозировки корректировались с 3-недельными интервалами на основе средней массы тела в группе. Всех крыс кормили диетой без фитоэстрогенов (Teklad TD 2016, Harlan Laboratories, Индианаполис, Индиана) ad libitum. Когда крысам исполнилось 120 дней, их усыпили передозировкой CO2 в соответствии с рекомендациями Национального института здоровья.Были взяты правая бедренная кость, поясничный позвонок (L3 и L4) и матка каждого образца.

    Параметры конструкции

    Правые бедра и поясничные позвонки были очищены от мягких тканей и заморожены при -20 ° C. Структурные параметры этих костей, включая геометрию, массу и плотность, были измерены с помощью сканирования pQCT (Stratec Research, SA, Stratec Medizintechnik, Пфорцхайм, Германия) с использованием разрешение поперечного сечения 0,1 мм и толщина среза 1 мм. Сканы pQCT L3 были взяты на двух смежных срезах через центр тела, и свойства были усреднены по двум срезам.Пороговое значение 280 мг / см3 использовалось, чтобы отличить кортикальную и губчатую кость от воздуха и костного мозга. Минеральное содержание костной ткани (BMC) и минеральная плотность костной ткани (BMD) в двух срезах были определены и усреднены. Бедра сканировали на 45% от общей длины кости от дистального конца. Модуль переднезаднего (AP) сечения (показатель прочности на изгиб) бедренной кости определяли с помощью программного обеспечения Stratec.

    Механические испытания

    После сканирования pQCT позвонки L3 были фрезерованы на аксиальные срезы примерно 4 мм с параллельными краниальными и каудальными концами и с удалением задних элементов и отростков с использованием изометрии Бюлера и пилы для тонкой кости (MicroAire) соответственно.Биомеханическое тестирование проводили с использованием сервогидравлической силовой рамы MTS (Mini-bionix, MTS Systems, Inc.) в соответствии с ранее описанными протоколами (14, 22). Образцы позвонков испытывали на сжатие между параллельными пластинами до разрушения при скорости нагрузки 2 мм / мин. Бедренные кости были испытаны при трехточечном изгибе с центральной точкой нагрузки, расположенной в том же месте сечения 45%, что и для измерений pQCT, и образцы нагружали до отказа со скоростью 2 мм / мин. Бедренная кость была ориентирована на переднюю поверхность, чтобы сначала попасть в контакт с точкой нагрузки сверху.

    Поскольку механические параметры наиболее важны, когда выражаются относительно размера тела (31), все данные о механических и структурных параметрах, за исключением плотности, были разделены на массу тела (граммы) перед статистическим анализом. Измерения BMC позвонков и пиковая сжимающая нагрузка были разделены на массу тела (граммы), а модуль упругости переднего отдела бедренной кости и пиковая сгибающая нагрузка были разделены на массу тела, умноженную на длину кости.

    Костные маркеры

    При умерщвлении образцы сыворотки собирали, обрабатывали и хранили при -80 ° C.Во всех группах определяли концентрацию остеокальцина и С-концевого телопептида. Оба маркера измеряли в сыворотке с помощью иммуноферментного анализа (ELISA) с использованием наборов, производимых Nordic Bioscience Diagnostics. Все образцы анализировали в двух экземплярах, и во всех анализах использовали контроли.

    Костная гистоморфометрия

    Не декальцинированные срезы позвонков L4 (губчатая кость) и середины диафиза бедра (кортикальная кость, 45% общей длины кости от дистального конца бедренной кости) были обезвожены путем последовательного помещения их в 5 контейнеров с увеличивающейся концентрацией этанола до 100% этанола. на 24 ч.Затем их заключали в метилметакрилат, делали срезы, устанавливали на предметное стекло и окрашивали с использованием красителей Мейсона-Голднера и ВонКосса (18). Количественные гистоморфометрические измерения костной структуры и резорбции определяли с использованием системы анализа изображений Bioquant (Bioquant Image Analysis System Corp., Нэшвилл, Теннесси) в соответствии с рекомендациями производителя. Вся кость, присутствующая в одном срезе, была проанализирована на кломид. Номера остеокластов были получены из позвоночной кости.

    Статистический анализ

    Статистический анализ данных выполняли с использованием однофакторного дисперсионного анализа с попарными апостериорными сравнениями по Шеффе, если тест ANOVA давал значимые результаты.Значение p p ≤ 0,05 было принято как значимое. Данные параметров костной ткани были нормализованы на основе массы тела, чтобы избежать возможной систематической ошибки, связанной с влиянием увеличения веса на кости (1, 6, 34, 38).

    Результаты

    Масса тела

    После 60 дней лечения группа OVX имела значительно более высокую среднюю массу тела (среднее ± стандартное отклонение) 300 ± 8 г по сравнению с 245 ± 11 г в группе SHAM (p = 0,001). Группы EB, S-эквол (30 мг / кг) и S-эквол (100 мг / кг) имели значительно более низкие средние массы тела 244 ± 14, 249 ± 28 и 255 ± 14 г, соответственно, по сравнению с группами OVX. группа (p = 0.01). Увеличение веса, связанное с овариэктомией, способствовало нормализации данных на основе веса, как описано выше.

    Минеральный состав костей

    Скорректированный BMC был значительно ниже в позвонках OVX и обеих группах S-equol по сравнению с группой SHAM (Таблица 1). Скорректированный BMC в группе EB существенно не отличался от такового в группах OVX или SHAM. BMD позвонков была значительно ниже в группе OVX по сравнению с группами SHAM и EB; никакие другие групповые различия не достигли значимости.

    Таблица 1: Скорректированные механические свойства позвонков и бедер

    Данные представлены как среднее ± стандартное отклонение. AP, переднезадний; BMC, минеральный состав кости; МПК, минеральная плотность костной ткани. Значения P: однофакторный дисперсионный анализ при показанном значении p, за которым следуют апостериорные сравнения Шеффа, значимые при p <0,05.

    Механические свойства костей

    Пиковая нагрузка на позвоночник с поправкой на массу тела была значительно ниже в группах OVX и более низкой дозы S-эквола (30 мг / кг), чем в группах SHAM или EB (последняя только с S-экволом 30 мг / кг) (Таблица 1) .Группы с более высокими дозами S-эквола (100 мг / кг), EB и SHAM не различались по пиковой нагрузке на позвоночник. В бедренной кости модуль упругости переднего отдела и пиковая изгибающая нагрузка с поправкой на массу тела и длину бедренной кости были значительно ниже в группах OVX и с более низкой дозой S-эквол (30 мг / кг), чем в группах http://accutanegeneric-reviews.com/ в SHAM. или группы EB. Группа с более высокой дозой S-эквола (100 мг / кг) имела значительно более высокие характеристики прочности бедренной кости, чем группы с OVX или с более низкой дозой S-эквола, и существенно не отличалась от групп SHAM или EB (Таблица 1).

    Костный метаболизм

    Концентрации остеокальцина и С-телопептида в группе SHAM находились в пределах диапазона, описанного производителем как нормальный. Межисследовательская вариабельность для обоих анализов была менее 2%. Группа SHAM имела значительно более низкие уровни C-телопептида, чем все другие группы, что указывает на меньший обмен костной ткани, чем в других группах (Таблица 2). Уровни остеокальцина были значительно ниже в группе EB, чем во всех других группах. Группа с более высокой дозой S-эквола (100 мг / кг) имела 4 балла.Уровень остеокальцина в 5 раз выше, чем в группе EB.

    Таблица 2: Сывороточные маркеры костного метаболизма

    Данные представлены как среднее ± стандартное отклонение. Значения P: однофакторный дисперсионный анализ при показанном значении p, за которым следуют апостериорные сравнения Шеффа, значимые при p <0,05.

    Гистоморфометрия

    Группа с более высокой дозой S-эквола (100 мг / кг) показала скорректированный по весу (разделенный на вес в граммах) объем бедренной и позвоночной кости и толщину кортикального слоя бедренной кости, не отличающиеся от таковых у крыс, прооперированных SHAM или получавших эстроген, в то время как Группы OVX и S-эквол с более низкой дозой были ниже по этим параметрам (Таблица 3).Срезы позвонков не показали различий в толщине трабекул или количестве остеокластов на квадратный миллиметр поверхности трабекулярной кости между группами SHAM, OVX, EB и S-эквол.

    Таблица 3: Результаты гистоморфометрии

    значений P: односторонний дисперсионный анализ при показанном значении P, за которым следуют апостериорные онлайн-сравнения Шеффа с помощью zoloft, значимые при p <0,05.

    Утеротрофическая активность

    Масса матки во всех группах была достоверно больше, чем в группе OVX при p = 0.001 уровень (таблица 4). Масса матки в обеих группах S-эквол была значительно ниже, чем в группах SHAM и EB (p = 0,001).

    Таблица 4: Результаты гистоморфометрии

    Данные представлены как среднее ± стандартное отклонение. Значения P: односторонний дисперсионный анализ при показанном значении p с последующими апостериорными сравнениями по Шеффе.

    Не скорректированные данные

    Нескорректированные данные показаны в таблице 5.

    Таблица 5: Результаты гистоморфометрии

    Данные представлены как среднее ± стандартное отклонение. BMC, минеральный состав кости; AP, переднезадний.

    Обсуждение

    Лечение более высокими дозами S-эквол предотвратило вызванную овариэктомией потерю прочности как бедра, так и позвоночника. Группа OVX имела прочность бедренного изгиба примерно на 20% ниже, чем в группе SHAM, но прочность бедренного изгиба у крыс OVX, получавших 100 мг S-эквола на кг, не отличалась от таковой в эндогенном (SHAM) или синтетическом (EB ) группы эстрогенов. Этот эффект на прочность костей был еще более заметен в позвонках, где пиковая сжимающая нагрузка позвонков у крыс OVX при умерщвлении была лишь немногим более половины от контрольной интактной (SHAM), тогда как в группе с более высокими дозами S-эквол и SHAM группы различались незначительно.Вес матки в текущем исследовании был выше у крыс, получавших 100 мг S-эквола на кг, чем в группе OVX, но вес матки в обеих группах S-эквол был значительно ниже, чем в группах SHAM и EB. S-эквол не влиял на минеральную плотность костной ткани или активность остеокластов или остеобластов, что измерялось уровнями сывороточного остеокальцина и С-телопептида или гистоморфометрическим определением количества остеокластов. Измерения силы, проведенные в этом исследовании, не могут быть воспроизведены у женщин, но некоторые исследователи предполагают, что недавно доступные неинвазивные измерения геометрии кости могут быть хорошими предикторами прочности кости (5).

    Стимуляция матки обеими дозами S-эквола была значительно выше

    , чем в группе OVX, но был значительно ниже, чем в группах эндогенного или синтетического эстрогена. Хотя стимуляция матки действительно происходила, значительно меньшая стимуляция матки с помощью S-эквола по сравнению с эстрогеном может быть преимуществом лечения S-экволом. S-эквол имеет сродство к ER α в 30 раз ниже, чем к ER ß (23). S-эквол может иметь более благоприятный профиль безопасности, чем эстрогены, которые в равной степени связываются с ER α и ER ß, такие как эстрадиол (23).Аффинность связывания S-эквола с ERβ в 1000 раз ниже, чем у эстрадиола (23). Заместительная терапия эстрогенами при постменопаузальном остеопорозе ограничена из-за нежелательной стимуляции рецепторов эстрогена на внескелетных участках, таких как грудь, и возможном повышенном риске рака груди (29).

    Селективные модуляторы рецепторов эстрогена (SERM) были разработаны для селективной стимуляции только рецепторов эстрогена тканеспецифическим образом с положительным эффектом, и некоторые из них коммерчески доступны.Считается, что они действуют, вызывая тканеспецифические конформационные изменения в рецепторе эстрогена, которые изменяют сродство рецептора эстрогена к его лиганду (20). S-эквол, фитоэстроген на основе сои, может работать аналогично SERM, связываясь с ER. Однако остается загадкой, что в этом исследовании S-эквол, в первую очередь агонист ER ß, оказывал влияние на кость, которая считается в первую очередь мишенью ER α (26). Это открытие предполагает, что S-equol использует другие, но неизвестные, возможно, ER-независимые механизмы для защиты кости в гипоэстрогенных условиях.Значительно более низкий эффект S-эквола по сравнению с эстрадиолом на матку, еще одну мишень, в первую очередь ER α (26), также предполагает, что механизмы ER не полностью объясняют действие S-эквола. Хотя рецепторы ER α и ER β присутствуют в тканях матки и молочной железы, агонисты ER β сами по себе, по-видимому, мало влияют на эти ткани (26). Напротив, рацемический эквол, коммерчески доступная форма эквола, которая содержит 50% S-эквола и 50% R-эквола, продемонстрировала благоприятное воздействие на кости (12, 16, 30, 35), но имеет сродство к ER на 25% выше. α по сравнению с ERβ и был связан со стимуляцией эстрогеном внескелетных участков (23).

    Данные с поправкой на вес были использованы для расчетов, касающихся влияния лечения на структурные изменения кости. В многочисленных клинических исследованиях использовалась нормализация на основе индекса массы тела или веса тела, чтобы избежать систематической ошибки, когда больший размер тела оказывал бы независимое влияние на кости (1, 6, 34, 38). Доклинические исследования также нормализовали данные, основанные на массе тела, где изучаются изменения костей (16, 35). Смешивающий эффект большего размера можно увидеть в наших нескорректированных исходных данных для пиковой нагрузки, где пиковая нагрузка на бедренную кость в группе эстрогена была значительно выше, чем в группе, оперированной SHAM.Когда данные были скорректированы с учетом веса, пиковая нагрузка в группе эстрогена существенно не отличалась от таковой в группе, оперированной SHAM. Мы предоставили необработанные данные для справки, но мы проанализировали скорректированные данные.

    Наши данные о более высокой прочности позвонков на сжатие и изгиб бедра при лечении S-equol согласуются с предыдущими отчетами с использованием моделей на животных. Sehmisch et al. (30) сообщили о более высокой прочности позвонков на сжатие, Tezval et al. (35) обнаружили более высокую прочность на разрыв вертела, а Mathey et al.(19) сообщили о более высокой нагрузке на бедренную кость у крыс, получавших рацион, содержащий рацемический эквол в течение 5 недель, по сравнению с крысами OVX, получавшими диету без сои в течение того же периода времени. Влияние лечения на другие параметры, включая BMC и BMD, менее стойкое. В текущем исследовании ни одна доза S-эквола не оказала благоприятного воздействия на BMC позвонков (с поправкой на размер тела) или на BMD, измеренную с помощью pQCT. Rachon (28) лечил крыс рацемическим экволом в течение 6 недель и также не обнаружил улучшения МПК голени или поясничного отдела позвоночника по данным КТ.Напротив, Kim et al. (15) и Fujioka et al. (12) на мышиной модели и Mathey et al. [19] и Tsuang et al. (37) на модели на крысах обнаружили значительное увеличение МПК бедренной кости, поясничного отдела позвоночника или всего тела по сравнению с контрольной группой OVX после лечения рацемическим экволом или изофлавонами сои.

    Объем бедренной и позвоночной кости с поправкой на вес и толщина кортикального слоя бедра у крыс, получавших более высокую дозу S-эквол в текущем исследовании, не отличались от группы, получавшей SHAM и эстроген, и эти параметры во всех трех группах были значительно выше, чем в элементах управления OVX.Tezval et al. (35) также обнаружили, что крысы, получавшие рацемический эквол, имели значительно более высокую площадь трабекул и связность по сравнению с группой OVX, но не было разницы в количестве остеокластов между группами. Напротив, Fujoika et al. (12) обнаружили значительно меньше остеокластов у крыс, получавших рацемический эквол, по сравнению с крысами OVX.

    Минеральная плотность кости и все факторы, включая качество кости, такие как геометрия кости, микроархитектура кости, качество коллагена и скорость обновления костной ткани, являются важными факторами, определяющими, насколько хорошо скелет может противостоять переломам (2, 9, 10) .Самый важный фактор или комбинация факторов для сохранения кости еще не определен, и исследования показали, что существующие методы лечения остеопороза нацелены на некоторые, но не на все эти факторы (25). Текущие данные показывают, что S-equol может быть многообещающим в своей способности влиять, по крайней мере, на некоторые из этих функционально важных параметров.

    Наша методология позволила идентифицировать ключевые данные, но окрашивание µCT и TRAP дало бы дополнительную информацию о прочности кости, поверхности и количестве остеокластов.Кроме того, в этом исследовании мы были ограничены использованием 60-дневных крыс. В других исследованиях в качестве моделей остеопороза у крыс использовали более старых крыс, но некоторые исследователи использовали крыс примерно того же возраста, что и наши, для аналогичных моделей (21, 39).

    Выводы

    В заключение, обработка крыс OVX S-экволом (100 мг / кг) привела к прочности и объему костной ткани позвонков и бедренной кости, не отличающимся от таковых у крыс, подвергнутых ложной операции или получавших эстроген, без изменения плотности костей.S-эквол в обеих дозах вызывал меньшую стимуляцию матки, чем эндогенный или синтетический эстроген.

    Эти результаты предполагают, что S-эквол требует дальнейшего изучения в качестве возможной альтернативы заместительной терапии эстрогеном для лечения остеопороза.

    Благодарности: Исследование финансировалось в рамках исследовательского контракта с Ausio Pharmaceuticals. Финансирующая организация не играла никакой другой роли в разработке, проведении или отчетности по исследованию. Авторы имели полный доступ ко всем данным, выполняли все анализы и интерпретировали все данные независимо от финансирующей организации.Мы с благодарностью благодарим Ричарда Джексона и Ричарда Швена из Ausio Pharmaceuticals за пожертвование чистого S-эквола и за информацию о дозировках, способе введения и продолжительности лечения. Мы благодарны Sione Fanua, M.S., за квалифицированный уход за экспериментальными животными и помощь в хирургии, Jeff Yahiro за гистоморфометрию костей и Lyn Camire, MA, ELS, из MedStar Union Memorial Orthopaedics за помощь редактора.

    Раскрытие информации: Исследование финансировалось Ausio Pharmaceuticals.Финансирующая организация не играла никакой другой роли в разработке, проведении или отчетности по исследованию.

    Конфликт интересов: Авторы сообщают об отсутствии конфликта интересов, связанного с данным исследованием.

    Этические стандарты: Эта рукопись соответствует положениям журнала о публикационной этике.

    Список литературы

    1. Alele JD, Kamen DL, Hunt KJ, Ramsey-Goldman R. Геометрия костей у женщин с СКВ и без нее. Журнал J Bone Miner Res 2011; 26: 2719-2726.

    2. Амманн П., Риццоли Р. Прочность костей и ее определяющие факторы. Osteoporos Int 2003; 14 Приложение 3: S13-S18.

    3. Аткинсон К., Франкенфельд К.Л., Лампе Дж. В.. Бактериальный метаболизм соевого изофлавона даидзеина в кишечнике: значение для здоровья человека. Exp Biol Med (Maywood) 2005; 230: 155-170.

    4. Bass E, French DD, Bradham DD, Rubenstein LZ. Коэффициенты смертности пожилых ветеранов от переломов шейки бедра с поправкой на риск. Энн Эпидемиол 2007; 17: 514-519.

    5. Beck TJ, Kohlmeier LA, Petit MA, Wu G, LeBoff MS, Cauley JA, Nicholas S, Chen Z.Неясности в связи между упражнениями и бедренной костью у женщин в постменопаузе. Med Sci Sports Exerc 2011; 43: 80-89.

    6. Бивенер А.А., Бертрам Дж. Э. Структурная реакция растущей кости на упражнения и неиспользование. J Appl Physiol 1994; 76: 946-955.

    7. Боттнер М., Кристоффель Дж., Вуттке В. Влияние длительного лечения 8-пренилнарингенином и пероральным эстрадиолом на ось GH-IGF-1 и липидный метаболизм у крыс. Дж. Эндокринол 2008; 198: 395-401.

    8. Бердж Р., Доусон-Хьюз Б., Соломон Д.Х., Вонг Дж. Б., Кинг А., Тостесон А.Заболеваемость и экономическое бремя переломов, связанных с остеопорозом, в США, 2005-2025 гг. Журнал J Bone Miner Res 2007; 22: 465-475.

    9. Chavassieux P, Seeman E, Delmas PD. Понимание материальной и структурной основы хрупкости костей в результате заболеваний, связанных с переломами: как болезни, влияющие на детерминанты биомеханических свойств кости. Endocr Ред. 2007; 28: 151-164.

    10. Кларк Б. Анатомия и физиология нормальной кости. Clin J Am Soc Nephrol 3 Дополнение 2008; 3: S131-S139.

    11. Deakin DE, Boulton C, Moran CG. Смертность и причины смерти пациентов с изолированными переломами конечностей и таза. Травма 2007; 38: 312-317.

    12. Fujioka M, Uehara M, Wu J, Adlercreutz H, Suzuki K, Kanazawa K, Takeda K, Yamada K, Ishimi Y. Equol, метаболит даидзеина, ингибирует потерю костной массы у мышей с удаленными яичниками. J Nutr 2004; 134: 2627.

    13. Галлахер С.Дж., Диксон Т. Влияние лечения постменопаузального остеопороза (бисфосфонаты, паратиреоидный гормон, стронция ранелат и деносумаб) на качество костей: систематический обзор.Calcif Tissue Int 2010; 87: 469-484.

    14. Gerharz EW, Mosekilde L, Thomsen JS, Gasser JA, Moniz C, Barth PJ, Ransley PG, Woodhouse CR (2003) Влияние энтероцистопластики на прочность костей оценивается на четырех различных участках скелета на модели крысы. Кость 2003; 33: 549-556.

    15. Ким Д.У., Ю К.Й., Ли Ю.Б., Ли К.Х., Сон Х.С., Ли С.Дж., Чо К.Х., Шин Ю.К., Хван И.К., Вон М.Х., Ким Д.У. Изофлавоны сои смягчают долговременную потерю бедренной и поясничной позвонков у мышей среднего возраста, подвергшихся овариэктомии.J Med Food 2009; 12: 536-541.

    16. Kolios L, Sehmisch S, Daub F, Rack T, Tezval M, Stuermer KM, Stuermer EK. Equol, но не генистеин, улучшает заживление раннего метафизарного перелома у остеопорозных крыс. Planta Med 2009; 75: 459-465.

    17. Lydeking-Olsen E, Beck-Jensen JE, Setchell KD, Holm-Jensen T. Соевое молоко или прогестерон для предотвращения потери костной массы — двухлетнее рандомизированное плацебо-контролируемое исследование. Eur J Nutr 2004; 43: 246-257.

    18. Malluche HH, Faugere MC. Оценка гистологии минерализованной кости.В: Malluche HH, Faugere MC (eds) Atlas of Mineralized Bone Histology, Karger, Basel, Switzerland, 2006; стр. 37-48

    19. Mathey J, Mardon J, Fokialakis N, Puel C, Kati-Coulibaly S, Mitakou S, netau- Pelissero C, Lamothe V, Davicco MJ, Lebecque P, Horcajada MN, Coxam V. Модуляция биодоступности изофлавонов сои и последующее влияние на здоровье костей у овариэктомированных крыс: случай для эквол. Остеопорос Инт 2007; 18: 671–679.

    20. Макдоннелл Д.П., Клемм Д.Л., Герман Т., Гольдман М.Э., Пайк Дж.Анализ функции рецепторов эстрогенов in vitro позволяет выявить три различных класса антиэстрогенов. Мол эндокринол 1995; 9: 659-669.

    21. Miao Q, Li JG, Miao S, Hu N, Zhang J, Zhang S, Xie YH, Wang JB, Wang SW. Костно-защитный эффект генистеина на животной модели двусторонней овариэктомии: роль фитоэстрогенов и PTH / PTHR1 против постменопаузального остеопороза. Int J Mol Sci 2012; 13: 56-70.

    22. Mosekilde L, Thomsen JS, Orhii PB, McCarter RJ, Mejia W., Kalu DN. Дополнительный эффект произвольных упражнений и лечения гормоном роста на прочность костей, оцененный на четырех различных участках скелета на модели старых крыс.Bone accutane reviews 1999; 24: 71-80.

    23. Muthyala RS, Ju YH, Sheng S, Williams LD, Doerge DR, Katzenellenbogen BS, Helferich WG, Katzenellenbogen JA. Эквол, природный эстрогенный метаболит изофлавонов сои: удобное получение и разделение R- и S-экволов, а также их различное связывание и биологическая активность через альфа- и бета-рецепторы эстрогена. Bioorg Med Chem 2004; 12: 1559-1567.

    24. Невес Э. Кастро М. Ассоциация рака яичников и матки с гормональным лечением в постменопаузе.Clin Obstet Gynecol 2008; 51: 607-617.

    25. Никандер Р., Сиванен Х., Хейнонен А., Дали Р.М., Ууси-Раси К., Каннус П. Целевые упражнения против остеопороза: систематический обзор и мета-анализ для оптимизации прочности костей на протяжении всей жизни. BMC Med 2010; 8: 47.

    26. Nilsson S, Gustafsson JA. Рецепторы эстрогена: терапия, направленная на подтипы рецепторов. Clin Pharmacol Ther 2011; 89: 44-55.

    27. Управление оценки технологий. Исходы перелома шейки бедра у людей в возрасте 50 лет и старше — справочная статья, OTA-BP-H-120, 1994.

    28. Rachon D, Seidlova-Wuttke D, Vortherms T., Wuttke W. Влияние диетического эквола на вызванную овариэктомией потерю костной массы у крыс Sprague-Dawley. Maturitas 2007; 58: 308-315.

    29. Rossouw JE, Anderson GL, Prentice RL, LaCroix AZ, Kooperberg C, Stefanick ML, Jackson RD, Beresford SA, Howard BV, Johnson KC, Kotchen JM, Ockene J. Риски и преимущества эстрогена и прогестина у здоровых женщин в постменопаузе : основные результаты рандомизированного контролируемого исследования Инициативы по охране здоровья женщин.JAMA 2002; 288: 321-333.

    30. Сехмиш С., Эррен М., Колиос Л., Тезвал М., Сейдлова-Вуттке Д., Вуттке В., Штюрмер К.М., Штюрмер Е.К. Влияние изофлавонов эквол и генистеина на качество костей на модели остеопении у крыс. Phytother Res 24 Suppl 2010; 2: S168- S174.

    31. Селкер Ф., Картер ДР. Масштабирование прочности на излом длинных костей в зависимости от массы животных. J. Biomech 1989; 22: 1175-1183.

    32. Сетчелл К.Д., Клеричи С., Лефарт Э.Д., Коул С.Дж., Хинан С., Кастеллани Д., Вулф Б.Е., Нечемиас-Циммер Л., Браун Н.М., Лунд Т.Д., Ханда Р.Дж., Хеуби Дж.Э.S-эквол, мощный лиганд бета-рецептора эстрогена, представляет собой исключительную энантиомерную форму метаболита изофлавона сои, продуцируемого бактериальной флорой кишечника человека. Ам Дж. Клин Нутр 2005; 81: 1072-1079.

    33. Сетчелл К.Д., Чжао X, Шоаф С.Е., Рагланд К. Фармакокинетика S-эквола, вводимого в виде таблеток SE5-OH здоровым женщинам в постменопаузе. J Nutr 2009; 139: 2037-2043.

    34. Szulc P, Boutroy S, Vilayphiou N, Chaitou A, Delmas PD, Chapurlat R. Поперечный анализ связи между хрупкими переломами и микроархитектурой костей у пожилых мужчин: исследование STRAMBO.Журнал J Bone Miner Res 2011; 26: 1358-1367.

    35. Тезвал М., Сехмиш С., Сейдлова-Вуттке Д., Стойка Т, Колиос Л., Вуттке В., Штюрмер К.М., Штюрмер Е.К. Изменения гистоморфометрических и биомеханических свойств проксимального отдела бедренной кости крыс, подвергнутых овариэктомии, после лечения фитоэстрогенами генистеином и экволом. Planta Med 2010; 76: 235-240.

    36. Tousen Y, Ezaki J, Fujii Y, Ueno T., Nishimuta M, Ishimi Y. Натуральный S-эквол снижает резорбцию костной ткани у японских женщин в постменопаузе, не продуцирующих Equol: пилотное рандомизированное плацебо-контролируемое исследование.Менопауза 18: 563-574.

    37. Цуанг Й.Х., Чен Л.Т., Чианг С.Дж., Ву Л.К., Чанг Ю.Ф., Чен П.Й., Сунь Д.С., Ван СС. Изофлавоны предотвращают потерю костной массы после овариэктомии у молодых взрослых крыс. J Orthop Surg Res 2008; 3:12.

    38. Уокер, доктор медицины, Лю Х.С., Стейн Э, Чжоу Б., Безати Э, МакМахон Д. Д., Удески Дж., Лю Дж., Шейн Э, Го XE, Билезикян Дж. П. Различия в микроархитектуре костей у американок китайского происхождения и белых женщин в постменопаузе. Журнал J Bone Miner Res 2011; 26: 1392-1398.

    39. Ван Дж, Шан Ф, Мэй Кью, Ван Дж, Чжан Р., Ван С.NO-донорское пролекарство генистеина снижает потерю костной массы у крыс с удаленными яичниками. Swiss Med Wkly 2008; 138: 602-607.

    40. Wu J, Oka J, Ezaki J, Ohtomo T, Ueno T., Uchiyama S, Toda T, Uehara M, Ishimi Y. Возможная роль экволетического статуса во влиянии изофлавона на костную и жировую массу у японских женщин в постменопаузе: двойное слепое рандомизированное контролируемое исследование. Менопауза 2007; 14: 866-874.

    Длительная депривация гормонов яичников изменяет эффекты 17β-эстрадиола на экспрессию микроРНК в гипоталамусе пожилых самок крыс

    ВВЕДЕНИЕ

    Средняя продолжительность жизни увеличилась за последнее столетие из-за улучшения условий жизни и медицинских достижений [1].В частности, женщины живут дольше, но возраст менопаузы остается постоянным и составляет примерно 50 лет. Это приводит к тому, что большинство женщин живут почти треть своей жизни без высоких уровней циркулирующих эстрогенов. Факторы риска для многих заболеваний, таких как когнитивные расстройства и расстройства настроения, увеличение у женщин после менопаузы [2, 3, 4], и эти факторы риска коррелируют с резким снижением циркулирующих уровней эстрогенов. Гормональная терапия (ГТ) часто назначается женщинам для смягчения многих неблагоприятных симптомов, связанных с менопаузой, в основном на основании данных, полученных на моделях на животных, демонстрирующих, что эстрогены обладают анксиолитическим действием и повышают когнитивные функции [5, 6, 7, 8, 9, 10] .Однако данные исследований с участием женщин в постменопаузе менее убедительны в отношении эффективности ГТ. Например, результаты крупномасштабного клинического исследования (Инициатива по охране здоровья женщин (WHI)) показали, что существует временное несоответствие в полезной эффективности ГТ [3, 4, 11, 12, 13, 14, 15, 16, 17 ]. Благоприятные эффекты во многом зависели от продолжительности периода времени после наступления менопаузы, в течение которого женщины получали ГТ, причем более молодые женщины получали наибольшую пользу. Последующие исследования с тех пор показали, что выбор времени ГТ имеет решающее значение как для получения максимальной пользы, так и для минимального вредного воздействия [11, 12, 13, 14, 15, 16].Однако молекулярные механизмы, лежащие в основе этих возрастных эффектов эстрогенов, неизвестны.

    Эстрогены регулируют транскрипцию гена в первую очередь посредством связывания с рецепторами эстрогена (ER), которые затем действуют как факторы транскрипции на промоторах генов. Однако также было показано, что эстрогены регулируют экспрессию генов на посттранскрипционном уровне через микроРНК (миРНК). miRNAs представляют собой класс небольших некодирующих РНК, которые регулируют экспрессию генов посредством репрессии трансляции целевых мРНК [18, 19], тем самым уменьшая белковые продукты этих генов.Канонический путь биогенеза miRNA выявляет несколько потенциальных регуляторных точек для эстрогенов. Во-первых, миРНК транскрибируются из генома, что повышает вероятность того, что рецепторы эстрогена опосредуют транскрипцию миРНК. Во-вторых, миРНК регулируются посттранскрипционно с помощью ряда ферментов РНКазы III, которые последовательно расщепляют первичный транскрипт (pri-miRNA) на более короткие фрагменты (т.е. пре-miRNA), и эти ферменты действуют вместе с несколькими кофакторными белками, некоторыми из которых являются которые регулируются эстрогенами [20, 21, 22, 23, 24, 25, 26, 27].Наконец, зрелый дуплекс 22nt miRNA диссоциирует таким образом, что одна цепь (направляющая цепь) загружается на белок аргонавта (AGO), тем самым образуя РНК-индуцированный комплекс сайленсинга (miRISC). Направляющая цепь в значительной степени защищена от деградации из-за ее ассоциации с целевой мРНК и AGO, однако цепь-пассажир обычно деградирует. Несколько исследований показали, что миРНК подвержены посттранскрипционным модификациям, которые могут влиять на их стабильность. Например, домен 4, связанный с поли (A) полимеразой (PAPD4), представляет собой нуклеотидилтрансферазу, которая аденилирует 3′-конец miRNAs [28, 29]; эта модификация miRNA может увеличивать ее стабильность и изменять ее способность связываться с комплексом RISC [28, 29].В конечном итоге миРНК разрушаются по крайней мере одной известной экзонуклеазой, 5′-3′-экзорибонуклеазой 2 (XRN2) [30]. Насколько нам известно, на сегодняшний день не было исследований, демонстрирующих, регулируют ли эстрогены какие-либо белки, которые участвуют в путях стабилизации miRNA.

    В головном мозге miRNAs обнаруживают паттерн экспрессии, специфичный как для возраста, так и для региона мозга, указывая тем самым, что они играют критическую роль в нормальной функции мозга [31, 32, 33, 34, 35, 36, 37]. Действительно, предыдущие исследования продемонстрировали, что miRNAs являются критическими для развития нейронов и синаптической пластичности, а также участвуют в регуляции аффективного поведения [38, 39, 40, 41, 42, 43, 44, 45].Ранее наша лаборатория продемонстрировала, что основной циркулирующий эстроген, 17β-эстрадиол (E 2 ), регулирует miRNAs в зависимости от возраста и области мозга у самок крыс, предполагая, что будет иметь место дифференциальная трансляция мРНК в этих областях мозга при различный возраст из-за E 2 зависимой регуляции miRNA [46]. E 2 оказывает свое действие через два рецептора эстрогена, ERα и ERβ. ERα и ERβ демонстрируют паттерны экспрессии, специфичные для области мозга, а также обладают дихотомическим действием на функцию мозга [47, 48].Кроме того, оба рецептора, как было показано, регулируют экспрессию miRNA in vitro , однако неизвестно, необходимы ли один или оба рецептора для опосредования индуцированной E 2 экспрессии miRNA в головном мозге [49, 50].

    Мы предполагаем, что существует биологический переключатель в действиях эстрогенов, который происходит одновременно с возрастом и продолжительностью времени после истощения гормонов яичников, и мы предполагаем, что возрастная регуляция miRNAs может быть молекулярной основой для этого переключения.Наша предыдущая работа показала, что E 2 дифференциально регулирует экспрессию miRNA в мозге молодых (3 мес.) По сравнению с самками старых (18 мес.) Крыс. В этом текущем исследовании мы расширили эти наблюдения, изучив, изменяют ли более длительные периоды депривации E 2 у старых самок крыс E 2 -зависимую регуляцию miRNAs, которую мы ранее наблюдали в головном мозге. В этой парадигме самкам крыс Fisher 344 (возраст 18 мес.) Была сделана овариэктомия (OVX), а затем была проведена острая обработка E 2 через 1, 4, 8 или 12 недель после OVX.Кроме того, у нас была группа самок крыс с интактными яичниками, которых умерщвляли в том же возрасте, что и леченых животных. Мы проанализировали экспрессию наших ранее идентифицированных E 2 регулируемых зрелых миРНК, а также их промежуточных продуктов биосинтеза (pri-miRNA, pre-miRNA) в гипоталамусе. Кроме того, мы количественно оценили экспрессию нескольких белков процессинга miRNA, включая drosha, критическую область 8 синдрома ДиДжорджи (DGCR8), экспортин-5 (XPO5), dicer, AGO2, XRN2 и PAPD4.Наконец, мы определили, какой ER опосредует индуцированное E 2 увеличение экспрессии miRNA, наблюдаемое через 1 неделю. пост-OVX в головном мозге пожилой женщины. В совокупности наши результаты показывают, что длительная депривация гормонов яичников заметно изменяет регуляцию зрелых миРНК E 2 в гипоталамусе пожилой женщины, предполагая, что есть сдвиг в том, как мозг реагирует на повторное введение E 2 после продолжительных периодов. гормональной депривации яичников.

    РЕЗУЛЬТАТЫ

    Эксперимент 1: Экспрессия E

    2 -зависимых зрелых миРНК в гипоталамусе интактных яичников животных изменяется с возрастом

    Наши предыдущие исследования показали, что E 2 регулирует субпопуляцию зрелых миРНК (let-7i, miR-7a, miR-9, miR-9–3p, miR-125, miR-181a и miR-495) в зависимости от возраста и региона мозга [46].Здесь мы наблюдали, что экспрессия зрелых миРНК у интактных яичников животных в разном пожилом возрасте отличалась как от OVX-носителя, так и от обработанных OVX-E 2 животных, что позволяет предположить, что факторы яичников, отличные от E 2 , также регулируют зрелую миРНК. экспрессия у старых самок крыс. Примечательно, что уровни циркулирующего E 2 были эквивалентны между интактными яичниками и животными, получавшими OVX + veh (фиг. 1). Апостериорный анализ выявил статистически различный профиль экспрессии через одну неделю после OVX (т.е.е. 18 мес. old) для miR-9, miR-125a, miR-181a и miR-495 у интактных яичников животных по сравнению с животными, получавшими OVX + veh. Кроме того, наблюдалась статистически значимая разница в экспрессии зрелых miR-7a, miR-9a-3p и miR-181a между интактными яичниками и животными, получавшими OVX + veh, в более поздние моменты времени (например, 19, 20 и 21 месяц). . В частности, уровни let-7i: не изменялись во все моменты времени у животных, у которых яичники были интактными (фиг. 2a), однако наблюдалось устойчивое увеличение let-7i с течением времени у животных, получавших OVX + veh (фиг. 2a).miR-7a: Напротив, экспрессия miR-7a была сходной между интактными яичниками и животными, получавшими OVX + veh, в момент времени в одну неделю (= 18 мес.). Уровни продолжали увеличиваться с возрастом у интактных яичников животных, но этот результат не наблюдался ни в одной из групп OVX (рис. 2b). miR-9: Подобно let-7i, мы не наблюдали изменений в экспрессии miR-9 во все моменты времени у интактных животных с яичниками (рис. 2c), но со временем наблюдалось значительное увеличение у животных OVX + veh. miR-9-3p: Интересно, что miR-9-3p была сходной во всех группах через неделю после OVX (т.е.е. 18 мес., Фигура 3d), но экспрессия miR-9-3p значительно увеличилась через 19 мес. в группах интактных яичников, и это увеличение не было очевидным в группах OVX до 20 мес. (8 недель после OVX) и 21 мес. (12 недель после OVX). miR-125a: интактные яичники животных имели значительно более высокие уровни экспрессии miR-125a к 18 мес. и 19 мес. временные точки, однако все группы были похожи через 20 и 21 мес. (Рисунок 2e). miR-181a: интактные яичники животных имели значительно более высокие уровни экспрессии miR-181a через 18 месяцев.old по сравнению с группами OVX + veh и OVX + E 2 (рисунок 2f). Эти уровни экспрессии снижались с возрастом, тогда как у животных OVX наблюдалась противоположная тенденция, и экспрессия miR-181a была значительно выше в обеих группах OVX по сравнению с интактными яичниками к 21 месяцу. возраста (рисунок 2g). miR-495: интактные животные в яичниках имели стабильно более высокие уровни экспрессии зрелой miR-495 во всех возрастах по сравнению с животными OVX, хотя группы OVX + veh и OVX + E 2 показали значительное увеличение через 8 и 12 недель после OVX ( 20 и 21 мес.). Взятые вместе, эти данные подчеркивают важность факторов яичников, отличных от E 2 , в регуляции экспрессии зрелой miRNA в головном мозге пожилых женщин.

    Рисунок 1: Схема парадигмы депривации гормонов яичников. а. Схематическое изображение экспериментальной парадигмы на животных. Самки крыс Fischer 344 были получены в возрасте 18 месяцев и подвергнуты овариэктомии. Крысам вводили подкожную инъекцию один раз в день в течение 3 дней, 1, 4, 8 или 12 недель после OVX ( N = 6 / возраст / лечение). г. E 2 концентрации в плазме, определенные методом ELISA из образцов крови, взятых через 24 часа после последней инъекции E 2 . Данные отображаются в виде среднего значения ± стандартная ошибка среднего пг / мл.

    Рисунок 2: E 2 регуляция экспрессии зрелой miRNA в гипоталамусе после увеличения продолжительности депривации гормонов яичников. a – g. Экспрессию зрелой miRNA анализировали с помощью qRT-PCR в реальном времени и отображали как среднее ± SEM кратное изменение по сравнению с 18-месячными интактными яичниками животных ( N = 6 / возраст / лечение).Знак * обозначает статистически значимый эффект лечения в течение определенного периода времени.

    Рисунок 3: E 2 регуляция экспрессии первичной миРНК в гипоталамусе после увеличения продолжительности депривации гормонов яичников. a – i. Первичную экспрессию miRNA анализировали с помощью кПЦР в реальном времени и отображали как среднее ± SEM кратное изменение по сравнению с животными, получавшими носитель в течение 1 недели ( N = 6 / возраст / лечение). Знак * обозначает статистически значимый эффект лечения в течение определенного периода времени.Различные символы (#,%) обозначают статистически значимую разницу между временными точками в группе лечения.

    Эксперимент 2: Обработка E

    2 не способна регулировать экспрессию зрелой miRNA после продолжительных периодов депривации гормонов яичников

    Для дальнейшего исследования эффектов E 2 -опосредованной регуляции этих зрелых miRNA мы разработали парадигму животных, чтобы непосредственно проверить гипотезу времени на старых самках крыс. Возраст крыс (18 мес., что эквивалентно 55 годам у человека) были подвергнуты овариэктомии (OVX) для моделирования хирургически индуцированной менопаузы и устранения источника всех гормонов яичников. Чтобы специфически изолировать эффекты E 2 от всех других гормонов яичников, животных OVX лечили однократным введением E 2 или контролем носителя в течение различных периодов времени после OVX: 1, 4, 8 или 12 недель ( Рисунок 1а). Наши результаты показали, что существует статистически значимая взаимосвязь между лечением и продолжительностью гормональной депривации яичников (Таблица 1).Наиболее поразительным было то, что обработка E 2 значительно регулировала экспрессию этих miRNA только в один момент времени (то есть через одну неделю после OVX) и не оказывала никакого эффекта после длительных периодов депривации гормонов яичников. В частности, обработка E 2 значительно регулирует экспрессию зрелых miR-7a, miR-9, miR-9-3p и miR-181a через 1 неделю после OVX, что согласуется с нашими ранее опубликованными данными [46]. , но не в любой другой момент времени (рис. 2a – 2d, 2f), демонстрируя явный временной эффект.Интересно, что обработка E 2 также увеличивала экспрессию miR-9-3p по сравнению с интактными животными, но не с животными, обработанными OVX + veh (фиг. 2d).

    Таблица 1: Двухфакторный дисперсионный анализ экспрессии зрелой миРНК в гипоталамусе

    НЕТ

    -3p

    Эксперимент. Уровни экспрессии зрелой miRNA не соответствуют экспрессии их первичной (pri-) и предшественницы (pre-) форм
    Влияние обработки E
    2 на уровни экспрессии первичной miRNA (pri-miR) в гипоталамусе при различной длине депривация гормона яичников

    Данные этих начальных экспериментов согласуются с нашими ранее опубликованными открытиями и продемонстрировали, что E 2 регулирует экспрессию зрелой miRNA после краткосрочного, но не долгосрочного, OVX.Чтобы определить уровень пути биосинтеза miRNA, который действует E 2 , мы затем проанализировали экспрессию первичных (pri-miR) и предшественников (pre-miR) транскриптов miRNA. Двусторонний анализ ANOVA показал, что не было значительного взаимодействия между лечением и возрастом для при- или преформ этих miRNA, в отличие от результатов, которые мы наблюдали для зрелых miRNA. Более того, анализ лечения в пределах одной временной точки показал, что E 2 , как правило, не влиял на транскрипцию большинства при-миРНК в любой момент времени (фиг. 3).Однако было несколько исключений. В частности, сравнение лечения в определенный момент времени показало, что E 2 значительно увеличивал экспрессию первичного транскрипта miRNA let-7i через одну неделю после OVX, но не в любой другой момент времени (рис. 3a, серая линия *). Также важно отметить, что две зрелые miRNA, miR-7a и miR-9, транскрибируются с нескольких хромосом, что обеспечивает уникальную регуляцию биогенеза в каждом локусе. Поэтому мы разработали праймеры, соответствующие отдельным первичным последовательностям на каждой хромосоме для miR-7a и miR-9, чтобы учесть возможные различия между зрелыми продуктами miRNA, происходящими из разных хромосом.Интересно, что эти данные выявили переключение в регуляции E 2 каждой хромосомы в зависимости от возраста после OVX. В частности, E 2 увеличивал pri-miR-7a, транскрибируемый с хромосомы 1 через 4 недели после OVX, но не в другие моменты времени (рис. 3b, pri-miR-7a-1, серая линия, *). Между тем, E 2 значительно увеличивал pri-miR-7a, транскрибируемую с хромосомы 17 через 1 неделю после OVX (фиг. 3c, pri-miR-7a-2, серая линия, *). Эти данные предполагают, что зрелый продукт miR-7a произошел из разных хромосом в зависимости от момента времени.Интересно, однако, что наши данные показали значительное увеличение зрелой miR-7a только в 1-недельную временную точку, что указывает на хромосому 17 как на потенциально более важную, чем хромосома 1 для E 2 -регулируемой экспрессии зрелой miR-7a. Также важно отметить, что miR-9 (направляющая цепь) и miR-9-3p (пассажирская цепь) происходят из одних и тех же первичных транскриптов и транскриптов-предшественников, которые расположены в двух разных локусах на хромосоме 1 (pri-miR-9 -1, pri-miR-9-2) и один локус на хромосоме 2 (pri-miR-9-3).Наши ранее опубликованные данные, а также воспроизведенные здесь в эксперименте 2, показали, что E 2 в значительной степени регулирует как направляющие, так и пассажирские цепи зрелой miR-9 [46]. На рис. 3d-3f показаны результаты для pri-miR-9. Анализ первичной экспрессии miR-9 показал, что обработка E 2 значительно увеличивала pri-mir-9-1 и pri-mir-9-2 через 1 неделю после OVX, а также pri-mir-9-2 на Через 4 недели после OVX (рис. 3d, 3e, серая линия, *). В отличие от этого, E 2 не влиял на уровни экспрессии pri-mir-9-3 в любой момент времени (рис. 3f, серая линия *).Наконец, E 2 не оказывал эффекта на pri-miR-181a или pri-miR-495 в любой момент времени (фиг. 3h, 3i).

    Влияние носителя OVX + на уровни экспрессии первичной миРНК (pri-miR) в гипоталамусе после разной длины OVX

    Однофакторный анализ ANOVA по временным точкам депривации показал, что pri-mir-7a-2, pri-mir- 9-1, pri-mir-125a, pri-mir-181a и pri-mir-495 были значительно изменены одним только OVX, и в целом они все уменьшались с возрастом (фиг. 3, черная линия, #).В частности, уровни экспрессии pri-mir-9-1 (фигура 3d, черная линия, #) были значительно снижены через 8 недель после OVX, в то время как экспрессия pri-mir-125a снизилась через 12 недель после OVX (фигура 3g, черная линия , #). Кроме того, оба первичных транскрипта для miR-181a и miR-495 были значительно снижены через 4, 8 и 12 недель после OVX (рис. 3h-3i, черная линия, #). Единственным исключением был pri-mir-7a-2, который значительно снизился через 4 недели, но затем увеличился через 8 недель после OVX (рис. 3c, черная линия, #).

    Влияние лечения OVX + veh и OVX + E
    2 на уровни экспрессии предшественников miRNA (pre-miR) в гипоталамусе

    Двухфакторный анализ ANOVA показал, что не было значительного взаимодействия между возрастом и лечением для любого из miRNAs-предшественники, что снова указывает на независимость этих двух факторов. Затем статистический анализ в каждой отдельной временной точке продемонстрировал, что обработка E 2 значительно изменила уровни экспрессии 3 из 7 протестированных пре-miRNA по сравнению с контролями, обработанными носителем (фигура 4, серая линия *).Интересно, что лечение E 2 значительно увеличивало экспрессию pre-miR-7a-2 как через 1, так и через 12 недель после OVX, но не влияло на pre-miR-7a-1 в любой момент времени (рис. 4b, 4c. , серая линия, *). Эти результаты резко контрастируют с тем, что наблюдалось с первичными транскриптами тех же самых miRNAs (см. Figure 3b, 3c), предполагая, что E 2 действует по-разному на многих уровнях пути биогенеза miRNA. Сходным образом эффекты обработки E 2 были поразительно разными для pre-miR-9 (Figure 4d) по сравнению с его эффектами на первичную форму (pri-miR-9; see Figure 3d-3f).В частности, E 2 значительно снижал экспрессию pre-mir-9 через 1 неделю после OVX, но затем значительно увеличивал ее экспрессию через 12 недель после OVX (фиг. 4d, серая линия *). В то время как первичный транскрипт miR-9 транскрибируется из трех разных локусов (следовательно, pri-miR-9-1, pri-miR-9-2 и pri-miR-9-3), шпильки-предшественники, генерируемые из каждого первичного локуса. транскрипты слишком похожи, чтобы их можно было различить с помощью qRT-PCR. Следовательно, возможно, что в каждой форме предшественника были компенсирующие изменения, которые могли затмить окончательные результаты.Интересно, что E 2 полностью устраняет резкое возрастное увеличение pre-miR-181a, наблюдаемое через 4 недели после OVX (Рисунок 4f, серая линия, *). Эти результаты были неожиданными, учитывая индуцированное E 2 увеличение уровней экспрессии как зрелой, так и pri-miR-181a в различные моменты времени (см. Фигуры 2f и 3h). Наконец, не было никаких эффектов только OVX на уровни экспрессии для любой из протестированных микроРНК-предшественников (рисунок 4, черные линии).

    Рисунок 4: E 2 регуляция экспрессии предшественника miRNA в гипоталамусе после увеличения продолжительности депривации гормона яичников. a – g. Экспрессию предшественника miRNA анализировали с помощью кПЦР в реальном времени и отображали как среднее ± SEM кратное изменение по сравнению с животными, получавшими носитель в течение 1 недели ( N = 6 / возраст / лечение). Знак * обозначает статистически значимый эффект E 2 по сравнению с животными, которым вводили носитель, в определенный момент времени.

    Эксперимент 2: E

    2 и возрастные изменения экспрессии зрелой miRNA не объясняются сопутствующими изменениями в мРНК или уровнях белка ключевых компонентов, участвующих в биогенезе miRNA

    Наши данные показывают, что E 2 регулирует экспрессию miRNA на различных уровнях пути биосинтеза miRNA, что повышает вероятность того, что E 2 может регулировать транскрипцию (мРНК) и / или уровни белка критических компонентов, необходимых для биосинтеза miRNA.Поэтому мы проанализировали экспрессию мРНК ядерных белков drosha и DGCR8 (ключевых компонентов микропроцессорного комплекса), а также цитоплазматических белков dicer, AGO2, XPO5, XRN2 и PAPD4 в гипоталамусе животных, подвергшихся нашей парадигме депривации гормона яичников. (Рисунок 5). Статистический анализ показал, что существует значимое взаимодействие лечения и возраста на уровнях экспрессии мРНК дроши, но не какого-либо из других протестированных генов ( F (3,38) = 3,762, p = 0.019). В частности, апостериорный анализ показал, что обработка E 2 увеличивала экспрессию мРНК дроши через 8 недель после OVX (фиг. 5a). Статистический анализ в каждой временной точке показал, что обработка E 2 также увеличивала уровни экспрессии мРНК DGCR8, dicer и AGO2 через 8 недель после OVX (фиг. 5b-5d). Напротив, обработка E 2 значительно снизила XPO5 через 1 неделю после OVX (фиг. 5e). Мы не наблюдали каких-либо значительных изменений в экспрессии мРНК XRN2 и PAPD4 между группами лечения в любой момент времени (рис. 5f, 5g, серая линия).Более того, мы не наблюдали изменений из-за одного только OVX в экспрессии мРНК этих генов (черные линии).

    Фигура 5: экспрессия мРНК компонентов биогенеза miRNA в гипоталамусе после увеличения продолжительности депривации гормонов яичников. a – g. Экспрессию мРНК анализировали с помощью кПЦР в реальном времени и отображали как среднее ± SEM кратное изменение по сравнению с животными, получавшими носитель в течение 1 недели ( N = 6 / возраст / лечение). Знак * обозначает статистически значимый эффект лечения в течение определенного периода времени.

    Затем мы сравнили уровни мРНК дроши, DGCR8, dicer, AGO2 и XPO5 с уровнями их транслированного белка у тех же животных (рисунки 6, 7). Интересно, что не было статистически значимого эффекта лечения или OVX на уровни белка любого из этих генов, несмотря на наблюдаемые нами статистически значимые изменения уровней мРНК. Эти данные предполагают, что опосредованные E 2 изменения уровней экспрессии зрелой miRNA не могут быть объяснены изменениями мРНК / белка в этих ключевых биосинтетических компонентах miRNA.

    Рисунок 6: Экспрессия белков компонентов биогенеза miRNA в гипоталамусе после увеличения продолжительности лишения гормона яичников. a – d. Экспрессию белка анализировали с помощью вестерн-блоттинга. 60 мкг общего белка для каждого образца наносили на 4–10% полиакриламидный гель. Блоты инкубировали с указанными антителами и визуализировали на Bio-Rad Chemidoc. Показаны репрезентативные блоты ( N = 3 / лечение / возрастная группа).

    Рисунок 7: Экспрессия белков компонентов биогенеза miRNA в гипоталамусе после увеличения продолжительности лишения гормона яичников. a – d. Количественная оценка вестерн-блоттинга, представленная на фигуре 7 ( N = 6 / лечение / возрастная группа). Данные представлены как среднее значение ± стандартная ошибка среднего по сравнению с животными, которым вводили носитель. Статистической значимости между группами лечения не наблюдалось.

    Эксперимент 3: ERβ опосредует эффекты E

    2 на экспрессию зрелой miRNA в гипоталамусе старых самок крыс через одну неделю после OVX

    Эффекты E 2 опосредуются в основном двумя рецепторами эстрогена, ERα и ERβ, и оба, как было показано, регулируют экспрессию miRNA в линиях раковых клеток [49, 50, 51].Чтобы определить, какой рецептор опосредует регуляцию экспрессии miRNA в стареющем женском мозге, мы сначала исследовали уровни экспрессии мРНК ERα и ERβ в нашей парадигме депривации гормонов яичников. Двусторонний анализ ANOVA выявил статистически значимое взаимодействие между лечением и периодом депривации для ERβ ( F (3,38) = 3,762, p = 0,014), но не ERα. Экспрессия мРНК ERβ была значительно снижена через 4, 8 и 12 недель после OVX у животных, которым вводили носитель, по сравнению с обработкой E 2 (фигура 8b, черная линия, #).Затем мы сделали овариэктомию у 344 самок крыс Fischer в возрасте 18 месяцев и через 1 неделю вводили либо E 2 , либо селективный агонист ERα (PPT) или ERβ (DPN). Затем мы измерили уровни экспрессии первичных, предшественников и зрелых miR для каждой из ранее идентифицированных нами E 2 регулируемых miRNA с помощью qRT-PCR (рисунок 9). Во-первых, мы проанализировали уровни экспрессии первичных транскриптов, которые продемонстрировали, что обработка как PPT, так и DPN значительно снижает экспрессию pri-miR-7a, pri-miR-125a, pri-miR-181a и pri-miR-495 по сравнению с либо носителю, либо животным, обработанным E 2 (фигура 9a).Эти результаты были неожиданными, учитывая, что никакого эффекта не наблюдалось при лечении только E 2 . Интересно, что экспрессия первичного транскрипта let-7i была единственной miRNA, которая значительно увеличивалась при лечении DPN и PPT (рис. 9a). Напротив, PPT значительно увеличивал экспрессию формы-предшественника miR-181a (pre-miR-181a), но не влиял на формы-предшественники для любой из других miRNA (рис. 9b). Точно так же DPN значительно увеличивал форму предшественника miR-495 (pre-miR-495), но не любого другого предшественника miRNA (фиг. 9b).Наконец, DPN, но не PPT, имитировал эффекты E 2 на уровни экспрессии зрелых let-7i и miR-7a, что согласуется с нашими более ранними наблюдениями после 1 недели депривации E 2 (рис. 9c). ).

    Фигура 8: экспрессия мРНК изоформ рецепторов эстрогена в гипоталамусе после увеличения продолжительности лишения гормонов яичников. а – б. Экспрессия мРНК ERα (a) и ERβ (b) была проанализирована с помощью qRT-PCR в реальном времени и отображена как среднее ± SEM-кратное изменение по сравнению с животными, получавшими носитель в течение 1 недели ( N = 6 / возраст / лечение.Знак * обозначает статистически значимый эффект лечения в течение определенного периода времени в группе лечения. Знак # обозначает статистически значимую разницу между временными точками в группе лечения.

    Фигура 9: Эффекты специфических агонистов ERα и ERβ на экспрессию зрелой miRNA в старом гипоталамусе после 1 недели депривации гормонов яичников. Pri-miRNA а, д. пре-миРНК b, e. и зрелая miRNA c, f, g. измеряли с помощью qRT-PCR у животных, которым вводили носитель, E 2 , DPN (агонист ERβ) или PPT (агонист ERα).Данные отображаются как среднее ± SEM-кратное изменение по сравнению с животными, обработанными носителем ( N = 6 / возраст / лечение). Знак * обозначает статистически значимый эффект E 2 по сравнению с животными, которым вводили носитель, в определенный момент времени.

    Эффекты PPT и DPN на miR-9 были особенно интересными. Наши ранее опубликованные наблюдения, а также реплицированные здесь данные продемонстрировали, что E 2 значительно увеличивал как направляющую (miR-9), так и пассажирскую (miR-9-3p) цепи зрелой miR-9 после 1 недели приема E 2. деприваций у старых животных.Однако как PPT, так и DPN значительно снижали формы pri-miR-9 и pre-miR-9 этой miRNA (рис. 9d, 9e). Примечательно, что E 2 имеет тенденцию увеличивать pri-miR-9 и уменьшать pre-miR-9, но ни один из этих эффектов не был статистически значимым. Наконец, E 2 , PPT и DPN все значительно увеличивали зрелые miR-9 и miR-9-3p, но DPN увеличивал каждый в большей степени (фиг. 9f, 9g).

    ОБСУЖДЕНИЕ

    Наша основная цель в этих исследованиях состояла в том, чтобы проверить эффективность лечения острой E 2 , вводимого в различные моменты времени после полной потери (через OVX) гормонов яичников, на экспрессию miRNA в головном мозге пожилой женщины.Результаты этого исследования продемонстрировали несколько новых открытий. Во-первых, обработка E 2 изменяла экспрессию зрелой miRNA в мозге старых животных после 1 недели депривации гормонов яичников, что повторяет наши ранее опубликованные результаты, но этот эффект был утрачен после более длительных периодов депривации гормонов яичников. Эти результаты согласуются с гипотезой времени, которая предполагает, что эффективность действия E 2 изменяется с возрастом и продолжительностью постменопаузы.Во-вторых, мы показали, что старение само по себе (т. Е. Интактные яичники животных) также во многих случаях оказывало значительное влияние на экспрессию зрелой miRNA, и это первые данные, описывающие уровни экспрессии miRNA в головном мозге животных в нескольких временных точках пожилого возраста. Удивительно, что интактные животные в яичниках показали другой профиль экспрессии miRNA, чем животные, получавшие OVX + носитель, что позволяет предположить, что эти miRNA, регулируемые E 2 , чувствительны к факторам яичников в дополнение к E 2 , однако, насколько нам известно, есть очень Мало что известно о регуляции miRNA в головном мозге другими факторами яичников.В-третьих, наши результаты показали, что обработка E 2 избирательно изменяет экспрессию первичных и предшественников транскриптов тех же самых miRNA, однако эти уровни экспрессии часто не соответствуют уровням их зрелых аналогов miRNA. Наша интерпретация этих данных состоит в том, что E 2 может действовать на нескольких уровнях по пути биосинтеза miRNA, и что E 2 , возможно, играет роль в стабилизации зрелых miRNAs. Наконец, используя селективные агонисты ER, мы продемонстрировали, что эффекты E 2 на экспрессию зрелой miRNA в гипоталамусе, вероятно, опосредуются в первую очередь через ERβ.Взятые вместе, эти результаты расширяют наши предыдущие результаты, предполагая возможный механизм отсутствия терапевтической эффективности ГТ у женщин в постменопаузе.

    Было показано, что старение изменяет профили экспрессии зрелой miRNA в различных тканях [34, 52, 53, 54, 55]. Наши данные (интактные яичники животных) также показали возрастные изменения экспрессии зрелой миРНК в гипоталамусе. Предыдущие исследования показали, что старение может по-разному регулировать отдельные группы miRNAs, предполагая, что miRNAs, которые мы тестировали в настоящем исследовании, могут быть частью большего сдвига в экспрессии miRNA в головном мозге.Механизм, с помощью которого старение изменяет экспрессию miRNA, в настоящее время не известен, хотя было показано, что старение может изменять посттранскрипционные модификации зрелых miRNAs, тем самым изменяя их стабильность [56]. Неожиданно у животных, которым вводили носитель OVX +, характер экспрессии миРНК при старении был иной, чем у интактных животных в яичниках, и эффекты были различными для каждой тестируемой миРНК. Важно отметить, что уровни циркулирующих E 2 не различались между носителем OVX + и интактными яичниками животных (рис. 1), что позволяет предположить, что факторы яичников, отличные от E 2 , вносят вклад в уровни экспрессии зрелой miRNA в головном мозге пожилой женщины.

    Наша предыдущая работа показала, что E 2 дифференциально регулирует экспрессию зрелых miRNAs в мозге молодых, по сравнению с пожилыми самками крыс [46]. Настоящее исследование расширяет эти результаты, фокусируясь только на старых животных, которым в разное время после OVX давали замену E 2 . В соответствии с нашими более ранними выводами, лечение E 2 значительно увеличивало 5 из 7 ранее идентифицированных зрелых miRNA только после короткого периода депривации гормонов яичников (т.е. одна неделя) у старых животных. Важно отметить, что эти текущие исследования изучали экспрессию зрелой miRNA только в гипоталамусе, тогда как наши предыдущие результаты были в основном получены из гиппокампа. Тем не менее, эти данные оставались совместимыми с нашими более ранними результатами в том, что, по-видимому, существуют специфические эффекты области мозга E 2 на экспрессию miRNA. Примечательно, что мы не наблюдали различий в экспрессии зрелой миРНК между E 2 — и животными, получавшими носитель, после более длительных периодов депривации гормонов яичников (т.е. 4, 8 и 12 недель). Эти результаты согласуются с концепцией гипотезы времени, которая предсказывает отсутствие эффективности E 2 после более длительных периодов депривации гормонов яичников. miRNA являются важными регуляторами трансляции мРНК и, как предполагается, влияют на экспрессию более 60% всех генов, кодирующих белок [57]. Значение этих результатов предполагает, что потеря E 2 -регулируемых miRNAs в постменопаузе может негативно влиять на множественные нижестоящие гены-мишени, хотя остается неясным, какие специфические нижестоящие гены-мишени регулируют эти конкретные miRNAs.

    Несмотря на критическую роль miRNAs во всех физиологических системах, мало что известно о тканеспецифической регуляции биосинтеза и процессинга miRNA. В целом, глобальный биогенез miRNA следует четко определенному пути, начиная с генерации длинного первичного транскрипта (pri-miR) и заканчивая одноцепочечным продуктом зрелой miRNA из 22 нуклеотидов [20, 21, 24, 25, 58]. Есть несколько шагов на этом пути, которые являются потенциальными точками, где может происходить уникальная тканевая и возрастная экспрессия отдельных miRNAs.Рецепторы эстрогенов действуют в первую очередь как факторы транскрипции на различных промоторах генов, поэтому наиболее вероятный сайт регуляции E 2 находится на уровне транскрипции первичной формы miRNA. В самом деле, др. Продемонстрировали, что E 2 регулирует несколько pri-miRs посредством канонических элементов ответа на эстроген (EREs) в моделях клеток рака груди [49, 50, 59]. Следовательно, мы затем измерили уровни экспрессии первичных (pri-miR) и предшественников (pre-miR) форм идентифицированных нами зрелых miRNA, регулируемых E 2 , в разное время после OVX.Наше предсказание заключалось в том, что уровни экспрессии этих первичных транскриптов будут соответствовать уровню экспрессии зрелого эффектора miRNA, однако это не то, что мы наблюдали. Фактически, наблюдались значительные расхождения между первичными, пре- и зрелыми формами для большинства протестированных микроРНК. Наблюдаемое несоответствие может быть результатом измененного процессинга этих miRNA. Посттранскрипционные модификации РНК, включая миРНК, являются общими и важными регуляторными механизмами, которые могут способствовать или ингибировать их процессинг [22, 28, 29, 60].Эти исследования предполагают, что не только экспрессия, но и изменения последовательности miRNA должны быть проанализированы, чтобы более полно понять их регуляцию и функцию. Мало что известно о временной регуляции событий биосинтеза miRNA, но эти результаты подтверждают, что E 2 может регулировать разные этапы пути в разное время. Это также демонстрирует ограничение наших исследований в том, что каждую микроРНК измеряли всего за один моментальный снимок времени после обработки E 2 (через 24 часа после последней инъекции).Тем не менее, тот факт, что E 2 регулирует все формы miRNA (первичные, предшественники или зрелые) в какой-то момент времени, указывает на то, что E 2 может также регулировать некоторые важные ключевые белки, участвующие в биогенезе и / или стабилизации miRNA. .

    Зрелые одноцепочечные молекулы miRNA в ассоциации с белком AGO составляют два основных компонента РНК-индуцированного комплекса сайленсинга [61]. Зрелая молекула miRNA образуется после того, как цитоплазматический фермент RNase III расщепляет pre-miR с образованием небольшой дуплексной структуры miRNA [20].Только одна цепь этого дуплекса (ведущая цепь) ассоциируется с AGO; другая цепь (цепь-пассажир) остается свободной, чтобы связываться с РНК и другими белками или разрушаться [62, 63, 64]. В отличие от этого описания образования miRNA, наши данные показали, что обработка E 2 не только увеличивала экспрессию зрелой miR-9 у пожилых женщин, но также увеличивала экспрессию пассажирской цепи miR-9a, miR-9-. 3p (текущее исследование и [46]). Поскольку обе цепи дуплекса miR-9 происходят после процессинга дайсером одной и той же молекулы-предшественника, эти результаты предоставляют убедительные доказательства того, что E 2 может регулировать экспрессию miRNA на уровне молекулярной стабилизации.Следовательно, чтобы определить, регулирует ли E 2 ключевые компоненты биогенеза или стабилизации miRNA, мы исследовали уровни их мРНК и белка в рамках нашей парадигмы депривации гормонов яичников. Мы наблюдали, что обработка E 2 значительно увеличивала мРНК дроша и дайсера через 8 недель после OVX, однако эти изменения не отражались изменениями уровней белка в тот же момент времени. Одна из возможностей заключается в том, что мы пропустили окно обнаружения, учитывая, что мы измеряли и мРНК, и белок только в один момент времени после обработки E 2 (через 24 часа после последней инъекции).Более того, уровни мРНК и белка для этих ферментов не обязательно отражают изменения ферментативной активности. Важно отметить, что ферментативные активности очень чувствительны к быстрым изменениям в связывании кофакторов и посттрансляционных модификациях [20, 22, 23, 58, 65], все из которых являются потенциальными мишенями для регуляции E 2 . В настоящее время нам неизвестны какие-либо ферментные тесты, разработанные для обнаружения активности дайсера или дроши в моделях клеточных линий или в тканях, что делает это очень важным направлением будущих исследований.В целом, не было никаких существенных изменений в экспрессии белка из-за возраста или лечения для любого из других протестированных компонентов биогенеза или стабилизации miRNA. Эти результаты согласуются с нашими и другими открытиями, показывающими, что E 2 и возраст регулируют только очень небольшую субпопуляцию miRNAs [46, 51]. Следовательно, E 2 регуляция главного белкового компонента в пути биогенеза miRNA является неожиданной, поскольку это д. Предсказать широкое влияние на гораздо большее количество miRNAs.

    Результаты исследований WHI побудили как фундаментальных, так и клинических ученых пересмотреть роль E 2 в стареющем мозге. Изменения в составе, количестве или структуре рецепторов эстрогена (ERα или ERβ) могут быть очевидным объяснением снижения эффективности E 2 с возрастом. Действительно, ранее опубликованные исследования показали, что экспрессия ERα и ERβ изменяется с возрастом в определенных ядрах гипоталамуса, хотя полученные результаты несколько противоречат друг другу в отношении ERβ [66, 67, 68].Наши данные показали, что было значительное снижение экспрессии мРНК ERβ через 4, 8 и 12 недель после OVX (что эквивалентно возрасту 19, 20 и 21 месяца, соответственно) у животных, которым вводили носитель. Однако лечение специфическим агонистом ERβ DPN было столь же эффективным, как лечение E 2 , в отношении экспрессии зрелой miRNA, и не наблюдалось изменений в экспрессии ERα, что позволяет предположить, что снижение доступности ER не является основным фактором отсутствия E 2. эффективность в пожилом женском мозге.Другая возможность состоит в том, что экспрессия полнофункциональных вариантов сплайсинга ERβ изменяется с возрастом. Например, ERβ2 имеет более низкую аффинность связывания E 2 по сравнению с ERβ дикого типа. ERβ2 также имеет различную транскрипционную эффективность, его экспрессия увеличивается с возрастом, и это коррелирует с усилением депрессивного поведения у старых самок крыс Sprague-Dawley [69, 70, 71]. Наши эксперименты были разработаны для обнаружения полноразмерного ERβ дикого типа, что должно включать обнаружение всех известных вариантов сплайсинга ERβ.Следовательно, наблюдаемые нами уровни экспрессии мРНК ERβ не будут различать относительные количества ERβ2 в разном возрасте, и увеличение этих вариантов сплайсинга рецепторов может снизить эффективность E 2 . Другое возможное объяснение снижения эффективности E 2 с течением времени может заключаться в том, что экспрессия и / или ассоциация корегуляторных белков ER изменяются с возрастом. Действительно, мы ранее продемонстрировали, что белковые комплексы, связанные с ERβ в головном мозге, изменяются с помощью E 2 в зависимости от возраста, несмотря на отсутствие связанных с возрастом изменений в экспрессии самих кофакторных белков [72].Эти данные указывают на то, что измененная экспрессия генов ER и / или кофакторов может не быть хорошими маркерами для оценки эффективности передачи сигналов E 2 .

    Хотя действия E 2 опосредуются в первую очередь через его два классических ядерных рецептора, ERα и ERβ, недавние доказательства причастности E 2 к регуляции функции клеток через множество других внутриклеточных сигнальных путей, некоторые из которых являются опосредовано мембраносвязанными рецепторами ER или G-белками.В этих исследованиях мы использовали простой подход, чтобы попытаться определить, опосредуют ли классические ERs регуляцию, индуцированную E 2 , экспрессии зрелой miRNA в старом мозге после короткого периода (1 неделя) депривации гормонов яичников. С этой целью мы воспользовались недавней разработкой специфических агонистов ERα и ERβ, PPT (пропилпиразол-триол) и DPN (диарилпропионитрил) соответственно. Было показано, что эти агонисты обладают высокой селективностью в отношении соответствующей формы рецептора при использовании в введенных нами дозах [73, 74].В целом, наши результаты показали, что индуцированная E 2 регуляция зрелых miRNAs после одной недели OVX опосредуется обоими рецепторами, хотя ERβ способен специфически регулировать let-7i и miR-7a независимо от ERα. Интересно, что были некоторые случаи, особенно на первичном (pri-miR) уровне, когда PPT и DPN были одинаково эффективны, а E 2 не оказывал видимого эффекта (см. Рисунок 9). Примечательно, что высокая селективность PPT и DPN в отношении их соответствующих рецепторов указывает на то, что они только связывают и активируют гомодимерные конфигурации рецепторов.Следовательно, возможно, что эффекты E 2 на miRNA опосредуются гетеродимерами ERα и ERβ. В самом деле, наши данные, демонстрирующие, что и DPN, и PPT регулируют уровни pri-miRNA, но не было очевидного эффекта E 2 на те же самые первичные транскрипты, подтверждают эту гипотезу. Кроме того, также возможно, что существуют изменения в гомо- и гетеродимерных образованиях, которые меняются с возрастом и / или продолжительными периодами депривации E 2 , что позволяет предположить, что эти селективные агонисты ER могут быть полезным терапевтическим инструментом для женщин в постменопаузе в определенном возрасте. .

    МАТЕРИАЛЫ И МЕТОДЫ

    Заявление об этике

    Все протоколы для животных были одобрены Комитетом по уходу за животными и их использованию в Университете Лойола в Чикаго, разрешение IACUC № 2009018. Операции проводились под анестезией парообразным изофлураном. После операции животных содержали поодиночке и вводили анальгетик ацетаминофен (122,7 мг / кг) в водопроводной воде в течение 3 дней. Были приняты все меры, чтобы свести к минимуму боль и страдания.

    Животные

    Эксперимент 1: самки крыс с интактными яичниками

    Fischer 344 крысы были получены от Charles River Laboratories (Уилмингтон, Массачусетс) в возрасте 18 месяцев ( N = 24).Животным разрешили акклиматизироваться в приюте в Лойоле в течение 7 дней после прибытия. Животных размещали по два в клетке, и им позволяли свободный доступ к стандартному корму для крыс и водопроводной воде. Их оставили нетронутыми до эвтаназии в возрасте 18, 19, 20 или 21 месяца.

    Эксперимент 2: Острое лечение носителем / E
    2 в разное время после овариэктомии (OVX) у старых самок крыс

    Самки Fischer 344 крысы были получены из колонии (Taconic) Национального института старения (NIA) через 18 месяцев ( N = 46) возраста.Животным разрешили акклиматизироваться в приюте в Лойоле в течение 7 дней после прибытия. Животных размещали по два в клетке, и им позволяли свободный доступ к стандартному корму для крыс и водопроводной воде. Животные были OVX в возрасте 18 месяцев после периода акклиматизации, а затем оставались нетронутыми в течение 1, 4, 8 или 12 недель ( N = 11–12 / возрастная группа) после OVX (рис. 1a). По истечении указанного времени животным делали подкожную инъекцию либо сафлорового масла (носитель; N = 5–6 / возрастная группа) или 2.5 мкг / кг 17β-эстрадиола (E 2 ; N = 6 / возрастная группа), растворенного в сафлоровом масле один раз в день в течение 3 дней подряд. Животных анестезировали, а затем умерщвляли путем быстрой декапитации через 24 часа после последней инъекции E 2 .

    Эксперимент 3: Неотложное лечение селективными агонистами рецепторов эстрогена через 1 неделю после OVX у старых самок крыс

    Крысы Fischer 344 были получены из Charles River Laboratories (Уилмингтон, Массачусетс) в возрасте 18 месяцев ( N = 14) .Животных размещали по два в клетке, и им позволяли свободный доступ к стандартному корму для крыс и водопроводной воде. Животным подвергали OVX в возрасте 18 месяцев после периода акклиматизации, оставляли в покое в течение 1 недели, а затем вводили подкожную инъекцию либо диарилпропионитрила (DPN, Tocris, 1,0 мг / кг, N = 7) или 4,4 ′, 4 » — (4-Пропил- [1 H ] -пиразол-1,3,5-триил) трис фенол (PPT, Tocris, 0,5 мг / кг, N = 7) один раз в день для 3 дня подряд. Ранее было показано, что эти дозы DPN и PPT оказывают физиологическое влияние на когнитивные функции [73, 74].

    Овариэктомия

    Животных глубоко анестезировали испаренным изофлуораном и делали двустороннюю овариэктомию (OVX), как описано ранее [72]. Вкратце, яичник и дистальный конец рога матки извлекали из полости тела через разрез длиной 1 см, сделанный через кожу и стенку тела. Рог матки зажимали гемостатом и лигировали проксимальнее зажима. Затем удаляли весь яичник и дистальный отдел рога матки. Животные содержались поодиночке и получали анальгетик ацетаминофен (122.7 мг / кг) в водопроводной воде в течение 3 дней после операции. В течение этого времени животных взвешивали один раз в день и измеряли потребление ими воды. После 3 дней обезболивания животные были размещены в двух помещениях с их предыдущим товарищем по клетке на время эксперимента.

    Сбор крови и обработка тканей

    Животных анестезировали испарением изофлуорана, а затем умерщвляли быстрой декапитацией через 24 часа после последней обработки. Кровь туловища собирали на льду в гепаринизированные круглодонные пробирки объемом 10 мл, центрифугировали при 4000 об / мин в течение 8 мин., а плазму хранили при -20 ° C до дальнейшей обработки. Мозг был быстро удален, сагиттально разрезан на льду на левое и правое полушария, и весь гипоталамус был микродиссектирован с правой стороны мозга. Гипоталамы помещали в отдельные микроцентрифужные пробирки, содержащие реагент для лизиса QIAzol (Qiagen, Inc., Germantown, MD) для последующей гомогенизации и экстракции РНК. Левую часть головного мозга быстро замораживали в 2-метилбутане, делали срезы размером 200 мкм на замораживающем микротоме, а весь гипоталамус (-0.От 26 до -4,52 относительно брегмы, согласно Paxinos and Watson, Rat Brain Atlas, четвертое издание), микродиссектировали с использованием инструмента для перфорации мозга Palkovit (1,0 мм, Stoelting, Inc., Wood Dale, IL). Тканевые штампы помещали в микроцентрифужную пробирку на сухом льду и хранили при -80 ° C.

    Концентрации 17β-эстрадиола в плазме

    Образцы плазмы сначала подверглись жидкостно-жидкостной экстракции с использованием диэтилового эфира для удаления мешающих соединений в плазме, как описано ранее [75].После экстракции диэтиловым эфиром образцы восстанавливали с использованием буфера для образцов, содержащегося в наборе 17β-эстрадиола для высокочувствительного ELISA (Enzo Life Sciences, каталожный № AD 901 174), который использовали для определения концентрации циркулирующих уровней E 2 . Поглощение измеряли на планшет-ридере BioTek (Winooski, VT) Synergy HT. Концентрации E 2 в циркулирующей плазме у животных E 2 и носителя составляли 56,68 (+/- 20,29) и 36,10 (+/- 9,70) пг / мл соответственно (рис. 1b).Эти уровни E 2 соответствовали физиологическим уровням, наблюдаемым во время позднего диэструса / раннего проэстра, и уровням, достигнутым у женщин в постменопаузе после ГТ [76]. % CV внутри и между анализами составлял 4,23 и 6,85 пг / мл соответственно.

    Выделение РНК

    Общую РНК выделяли из всего правого гипоталамуса с использованием набора miRNeasy Mini Kit (Qiagen, Inc., Germantown, MD) в соответствии с инструкциями производителя. Все образцы РНК были количественно определены и проанализированы на качество с использованием спектрофотометрии Nanodrop и визуализации РНК на 1.5% агарозный гель.

    Синтез кДНК предшественника и зрелой миРНК

    Общую РНК (1,0 мкг) использовали для обратной транскрипции миРНК с использованием набора для синтеза кДНК микроРНК NCode ™ VILO ™ (Life Technologies, Карлсбад, Калифорния) для анализа экспрессии зрелой миРНК. Для анализа первичной и предшественницы miRNA мы использовали метод обратной транскрипции, специфичный для miRNA, описанный ранее [77]. Вкратце, 2,0 мкг общей РНК добавляли к 1,5 мкл смеси праймеров, содержащей 10 мкМ антисмысловых праймеров (дополнительная таблица S1).Реакционную смесь инкубировали при 80 ° C в течение 5 минут, 60 ° C в течение 5 минут и затем, наконец, давали остыть до комнатной температуры. Затем добавляли реагенты из системы ThermoScript ™ RT-PCR (Life Technologies, Карлсбад, Калифорния) до конечного объема 20 мкл. Реакции инкубировали при 60 ° C в течение 45 минут и затем при 85 ° C в течение 5 минут. К каждой реакции добавляли 1,0 мкл РНКазы H, а затем инкубировали при 37 ° C в течение 20 минут.

    Синтез кДНК матричной РНК (мРНК)

    Общая РНК (2.0 мкг) подвергали обратной транскрипции с использованием набора для обратной транскриптазы кДНК высокой емкости (Applied Biosystems, Foster City, CA).

    Количественная qRT-PCR в реальном времени

    miRNA и mRNA qRT-PCR выполняли с Fast Start Universal SYBR Green Master Mix (Roche-Genentech, Сан-Франциско, Калифорния) на Eppendorf Realplex4. Прямые праймеры для конкретных зрелых миРНК были сконструированы, как описано в руководстве по набору для синтеза первой цепи кДНК Ncode ™ miRNA (Life Technologies, Карлсбад, Калифорния), и с использованием miRBase 18 в качестве ссылки на последовательность (дополнительная таблица S1).Первичные праймеры и праймеры-предшественники miRNA были сконструированы, как описано ранее (дополнительная таблица S1) [77]. Праймеры для мРНК были получены из ранее опубликованных исследований [27, 78] (дополнительная таблица S2). 18s рРНК и HPRT использовали в качестве контроля загрузки и для нормализации данных для анализа на miRNA и мРНК qRT-PCR соответственно. Для микроРНК qRT-PCR использовали следующую программу: 1) 95 ° C в течение 10 минут, 2) 95 ° C в течение 20 секунд, 3) 59 ° C в течение 20 секунд, 4) 72 ° C в течение 12 секунд и кривая плавления анализ (дополнительная таблица S1).Для мРНК qRT-PCR была использована следующая программа: 1) 95 ° C в течение 10 минут, 2) 95 ° C в течение 30 секунд, 3) 59 ° C в течение 30 секунд, 4) 72 ° C в течение 30 секунд и кривая плавления анализ (дополнительная таблица S2). Экспрессию мРНК ERβ анализировали с использованием анализа экспрессии генов Taqman (Rn01527840_m1) с пользовательским зондом FAM для ERβ (CAAGAAAATCCCTGGCTTTGTGGAG) (дополнительная таблица S2). Для Taqman RT-PCR использовали следующую программу: 1) 95 ° C в течение 10 минут, 2) 95 ° C в течение 15 секунд и 3) 60 ° C в течение 60 секунд. Экспрессию miRNA и мРНК анализировали с использованием метода ΔΔCt, как описано ранее [79].

    Вестерн-блоттинг

    Лизат белка из участков гипоталамической ткани выделяли с использованием реагента T-PER (Thermo Scientific, Waltham, MA). Вкратце, тканевые штампы гомогенизировали в 500 мкл реагента T-PER с 1x коктейлем cOmplete mini-EDTA-free ингибиторов протеазы (Roche-Genentech, Сан-Франциско, Калифорния) с помощью моторизованного ступки. Лизат ткани центрифугировали при 10000 × g в течение 5 минут, и супернатант собирали в отдельную пробирку для микроцентрифугирования. Затем образцы белка концентрировали с использованием экстракции метанол-хлороформ, как описано ранее [80].Общий лизат белка (60 мкг) растворяли и кипятили при 95 ° C в течение 5 минут в 1x восстанавливающем буфере для образцов (Thermo Scientific, Waltham, MA). Пробы белков разделяли на градиентном (4–10%) полиакриламидном геле при 90 В в течение 20 минут и затем при 120 В в течение 60 минут с использованием системы Bio-Rad Mini-Protean 3. Затем разделенные белки переносили на мембраны PVDF Immobilon-P (Millipore, Billerica, MA) при 100 В в течение двух часов. Мембраны блокировали 5% BSA с 1x TBST (0,1% твин) в течение 1 часа. Затем мембраны инкубировали с указанным первичным антителом в течение ночи при постоянном встряхивании при 4 ° C (дополнительная таблица S3).Первичное антитело удаляли, и мембраны трижды промывали 1x TBST (0,1% твин). Затем мембраны инкубировали с козьим вторичным антителом против HRP кролика 1: 5000 (Santa Cruz Biotechnology, Даллас, Техас) в 5% BSA с 1x TBST (0,1% твин) в течение двух часов при встряхивании при комнатной температуре. Затем мембраны трижды промывали 1x TBST (0,1% твин) и затем проявляли с использованием хемилюминесцентного субстрата Super Signal West Pico (Thermo Scientific, Waltham, MA). Блоты визуализировали с помощью станций Bio-Rad Chemi-doc.Денситометрический анализ выполняли с использованием программного обеспечения Image Lab (Bio-Rad Laboratories, Des Plaines, IL). Затем мембраны удаляли с использованием мягкого буфера для очистки (Abcam, Кембридж, Англия) и повторно подвергали блоттингу другим первичным антителом. Экспрессию бета-актина использовали в качестве контроля загрузки и для нормализации данных для анализа.

    Статистика

    Экспрессия miRNA и мРНК в парадигме депривации гормонов яичников была проанализирована с помощью двухфакторного дисперсионного анализа с возрастом и лечением в качестве факторов.После значительного взаимодействия между возрастом и лечением был проведен апостериорный тест Тьюки для определения статистически значимых различий ( p <0,05) между группами. Отдельный апостериорный тест Тьюки был проведен в группах, которые показали статистически значимый основной эффект возраста и / или лечения. Когда не наблюдалось значительного взаимодействия, два фактора считались независимыми, и для анализа между курсами лечения в пределах одной временной точки использовались тесты Стьюдента T .Для определения значимых различий E 2 , DPN и PPT использовали однофакторный дисперсионный анализ ANOVA с лечением в качестве основного фактора, за которым следует posthoc-тест Тьюки. Все данные представлены как среднее ± стандартная ошибка среднего. Статистическая значимость была отмечена, когда p <0,05.

    БЛАГОДАРНОСТЬ И ФИНАНСИРОВАНИЕ

    Поддержка этой работы была предоставлена ​​NIH R01AG033605.

    КОНФЛИКТ ИНТЕРЕСОВ

    Авторы заявляют об отсутствии конфликта интересов

    ССЫЛКИ

    1.Ариас Э. Таблицы дожития в Соединенных Штатах, 2010 г. Национальные статистические отчеты: Центры по контролю и профилактике заболеваний, Национальный центр статистики здравоохранения, Национальная система статистики естественного движения населения. 2014; 63: 1–63.

    2. Коленда К.С., Лего С., Рапп С.Р., Дебон М.В., Хоган П., Уоллес Р., Херши Л., Окен Дж., Уитмер Р., Филлипс Л.С., Сарто Г.Э. Психиатрические расстройства и когнитивная дисфункция у пожилых женщин в постменопаузе: результаты исследования памяти Women’s Health Initiative. Am J Geriatr Psychiatry.2010; 18: 177–186.

    3. Говеас Дж. С., Эспеланд М. А., Хоган П., Дотсон В., Тарима С., Кокер Л. Х., Окен Дж., Бруннер Р., Вудс Н. Ф., Вассертхейл-Смоллер С., Котчен Дж. М., Резник С. Депрессивные симптомы, объемы мозга и субклинические цереброваскулярные процессы. Заболевания у женщин в постменопаузе: исследование МРТ «Инициатива по охране здоровья женщин». J влияет на Disord. 2011; 132: 275–284.

    4. Говеас Дж. С., Эспеланд М. А., Хоган П. Е., Тиндл Н. А., Ши Р. А., Котчен Дж. М., Робинсон Дж. Г., Барнс Д. Е., Резник С. М.. Депрессивные симптомы и продольные изменения познания: исследование когнитивного старения в рамках инициативы по охране здоровья женщин.J Geriatr Psychiatry Neurol. 2014; 27: 94–102.

    5. Фернандес С.М., Льюис М.К., Печенино А.С., Харбургер Л.Л., Орр П.Т., Грезак Дж.Э., Шафе Г.Е., Фрик К.М. Индуцированное эстрадиолом усиление консолидации объектной памяти включает активацию киназ, регулируемую внеклеточными сигналами гиппокампа, и мембраносвязанных рецепторов эстрогена. J Neurosci. 2008; 28: 8660–8667.

    6. Феррини М., Лима А., Де Никола А.Ф. Эстрадиол отменяет аутологическую регуляцию глюкокортикоидных рецепторов в головном мозге. Life Sci.1995; 57: 2403–2412.

    7. Хан Х, Энлле К.К., Бин Л.А., Рани А., Семпл-Роуленд С.Л., Кумар А., Фостер Т.К. Роль рецепторов эстрогена альфа и бета в сохранении функции гиппокампа во время старения. J Neurosci. 2013; 33: 2671–2683.

    8. Лю Ф, Дэй М., Мунис Л.С., Битран Д., Ариас Р., Ревилья-Санчес Р., Грауэр С., Чжан Дж., Келли С., Пулито В., Сунг А., Мервис Р.Ф., Наварра Р. и др. Активация рецептора эстрогена-бета регулирует синаптическую пластичность гиппокампа и улучшает память. Nat Neurosci.2008; 11: 334–343.

    9. Яо Дж., Гамильтон Р.Т., Каденас Э., Бринтон Р.Д. Снижение биоэнергетики митохондрий и переход к кетогенному профилю в мозге во время репродуктивного старения. Biochim Biophys Acta. 2010; 1800: 1121–1126.

    10. Чжан К.Г., Раз Л., Ван Р., Хан Д., Де Севилья Л., Ян Ф., Вадламуди Р.К., Бранн Д.В. Эстроген ослабляет ишемическое окислительное повреждение через альфа-опосредованное ингибирование активации НАДФН-оксидазы рецептором эстрогена. J Neurosci. 2009; 29: 13823–13836.

    11.Espeland MA, Brunner RL, Hogan PE, Rapp SR, Coker LH, Legault C, Granek I, Resnick SM. Долгосрочные эффекты терапии конъюгированными эстрогенами лошадей на доменно-специфическую когнитивную функцию: результаты исследования продления когнитивного старения, проведенного в рамках инициативы Women’s Health Initiative. J Am Geriatr Soc. 2010; 58: 1263–1271.

    12. Espeland MA, Rapp SR, Shumaker SA, Brunner R, Manson JE, Sherwin BB, Hsia J, Margolis KL, Hogan PE, Wallace R, Dailey M, Freeman R, Hays J. Конъюгированные конские эстрогены и глобальная когнитивная функция у женщин в постменопаузе: Исследование памяти Инициативы по охране здоровья женщин.Джама. 2004; 291: 2959–2968.

    13. Goveas JS, Espeland MA, Woods NF, Wassertheil-Smoller S, Kotchen JM. Симптомы депрессии и частота легких когнитивных нарушений и вероятного слабоумия у пожилых женщин: исследование памяти инициативы по охране здоровья женщин. J Am Geriatr Soc. 2011; 59: 57–66.

    14. Мэнсон Дж. Э., Хлебовски Р. Т., Стефаник М. Л., Арагаки А. К., Россоу Дж. Э., Прентис Р. Л., Андерсон Дж., Ховард Б. В., Томсон Калифорния, Лакруа, Аризона, Вактавски-Венде Дж., Джексон Р. Д., Лимахер М. и др. Гормональная терапия в период менопаузы и результаты для здоровья на этапах вмешательства и после завершения рандомизированных исследований Инициативы по охране здоровья женщин.Джама. 2013; 310: 1353–1368.

    15. Прентис Р.Л., Мэнсон Дж. Э., Лангер Р. Д., Андерсон Г. Л., Петтингер М., Джексон Р. Д., Джонсон К. К., Куллер Л. Х., Лейн Д. С., Вактавски-Венде Дж., Бржиски Р., Эллисон М., Оккене Дж. И др. Преимущества и риски гормональной терапии в постменопаузе, если ее начинают вскоре после менопаузы. Am J Epidemiol. 2009; 170: 12–23.

    16. Шумакер С.А., Лего С., Куллер Л., Рапп С.Р., Тал Л., Лейн Д.С., Филлит Х., Стефаник М.Л., Хендрикс С.Л., Льюис К.Э., Масаки К., Кокер Л.Х. Конъюгированные лошадиные эстрогены и частота вероятного слабоумия и легких когнитивных нарушений у женщин в постменопаузе: исследование памяти Инициативы по охране здоровья женщин.Джама. 2004; 291: 2947–2958.

    17. Занди П.П., Карлсон М.К., Плассман Б.Л., Уэлш-Бомер К.А., Майер Л.С., Стеффенс Д.К., Брайтнер Дж. Заместительная гормональная терапия и заболеваемость болезнью Альцгеймера у пожилых женщин: исследование округа Кэш. Джама. 2002; 288: 2123–2129.

    18. Бэк Д., Виллен Дж., Шин С., Камарго Ф. Д., Гиги С. П., Бартель Д. П.. Влияние микроРНК на выход белка. Природа. 2008; 455: 64–71.

    19. Зельбах М., Шванхауссер Б., Тирфельдер Н., Фанг З., Ханин Р., Раевский Н. Широко распространенные изменения в синтезе белка, вызванные микроРНК.Природа. 2008; 455: 58–63.

    20. Chendrimada TP, Gregory RI, Kumaraswamy E, Norman J, Cooch N, Nishikura K, Shiekhattar R. TRBP рекрутирует комплекс Dicer в Ago2 для процессинга микроРНК и сайленсинга генов. Природа. 2005; 436: 740–744.

    21. Хан Дж., Ли Й, Йом К. Х., Нам Дж. У., Хео И, Ри Дж. К., Сон С. Ю., Чо Й, Чжан Б. Т., Ким В. Н.. Молекулярная основа распознавания первичных микроРНК комплексом Drosha-DGCR8. Клетка. 2006; 125: 887–901.

    22. Хео И, Джу Си, Чо Дж, Ха М, Хан Дж, Ким В.Н.Lin28 опосредует терминальное уридилирование микроРНК-предшественника let-7. Mol Cell. 2008; 32: 276–284.

    23. Ли Х.Й., Чжоу К., Смит А.М., Ноланд К.Л., Дудна Дж.А. Различная роль Dicer-связывающих белков человека TRBP и PACT в процессинге малых РНК. Nucleic Acids Res. 2013; 41: 6568–6576.

    24. Ли Й, Ан С, Хан Дж, Чой Х, Ким Дж, Йим Дж, Ли Дж, провост П., Радмарк О, Ким С., Ким В.Н. Ядерная РНКаза III Дроша инициирует процессинг микроРНК. Природа. 2003; 425: 415–419.

    25.Ли Й, Чон К., Ли Дж. Т., Ким С., Ким В. Н.. Созревание микроРНК: пошаговая обработка и субклеточная локализация. Embo J. 2002; 21: 4663–4670.

    26. Ли Й, Ким М., Хан Дж, Йом К. Х., Ли С., Пэк Ш., Ким В. Н.. Гены микроРНК транскрибируются РНК-полимеразой II. Эмбо Дж. 2004; 23: 4051–4060.

    27. Nothnick WB, Healy C, Hong X. Стероидная регуляция миРНК матки связана с модуляцией компонентов биогенеза миРНК Exportin-5 и Dicer1. Эндокринная. 2010; 37: 265–273.

    28.Берроуз AM, Ando Y, de Hoon MJ, Tomaru Y, Nishibu T, Ukekawa R, Funakoshi T, Kurokawa T., Suzuki H, Hayashizaki Y, Daub CO. Всесторонний обзор событий модификации miRNA 3 ‘животных и возможная роль 3 ‘Аденилирование в модулировании эффективности нацеливания на miRNA. Genome Res. 2010; 20: 1398–1410.

    29. Wyman SK, Knouf EC, Parkin RK, Fritz BR, Lin DW, Dennis LM, Krouse MA, Webster PJ, Tewari M. Посттранскрипционная генерация вариантов miRNA множественными нуклеотидилтрансферазами вносит вклад в сложность транскриптома miRNA.Genome Res. 2011; 21: 1450–1461.

    30. Чаттерджи С., Гроссханс Х. Активный оборот модулирует активность зрелой микроРНК у Caenorhabditis elegans. Природа. 2009; 461: 546–549.

    31. Амар Л., Бенуа С., Бомонт Дж., Вашер С.М., Крепин Д., Тауи М., Баруан-Тураншо А. Профилирование экспрессии микроРНК дугообразных и паравентрикулярных ядер гипоталамуса от отдельных крыс с использованием технологии секвенирования Illumina. J Neurosci Methods. 2012; 209: 134–143.

    32. Бак М., Силахтароглу А., Моллер М., Кристенсен М., Рат М.Ф., Скрябин Б., Томмеруп Н., Кауппинен С.Экспрессия микроРНК в центральной нервной системе взрослых мышей. Рна. 2008; 14: 432–444.

    33. Хуа Й.Дж., Тан З.Й., Ту К., Чжу Л., Ли У.С., Се Л., Сяо Х.С. Идентификация и прогнозирование мишеней miRNA, специфически экспрессируемых в нервной ткани крыс. BMC Genomics. 2009; 10: 214.

    34. Inukai S, de Lencastre A, Turner M, Slack F. Новые микроРНК, дифференциально экспрессирующиеся во время старения в мозге мышей. PLoS One. 2012; 7: e40028.

    35. Olsen L, Klausen M, Helboe L, Nielsen FC, Werge T.МикроРНК обнаруживают взаимоисключающие паттерны экспрессии в головном мозге взрослых самцов крыс. PLoS One. 2009; 4: e7225.

    36. Персенгиев С., Кондова И., Оттинг Н., Кеппен А.Х., Бонтроп РЭ. Полногеномный анализ экспрессии miRNA показывает потенциальную роль miR-144 в старении мозга и патогенезе спиноцеребеллярной атаксии. Neurobiol Aging. 2011; 32. 2316: e2317–2327.

    37. Herzer S, Silahtaroglu A, Meister B. Гибридизация in situ на основе заблокированной нуклеиновой кислоты выявляет miR-7a как обогащенную гипоталамусом микроРНК с отчетливым паттерном экспрессии.J Neuroendocrinol. 2012; 24: 1492–1504.

    38. Бодри А., Муйе-Ришар С., Шнайдер Б., Лоне Дж. М., Келлерманн О. miR-16 нацелен на переносчик серотонина: новый аспект адаптивного ответа на антидепрессанты. Наука. 2010; 329: 1537–1541.

    39. Харамати С., Навон И., Исслер О., Эзра-Нево Г., Гил С., Цванг Р., Хорнштейн Е., Чен А. МикроРНК как репрессоры вызванной стрессом тревоги: случай миндалевидного миР-34. J Neurosci. 2011; 31: 14191–14203.

    40. Ламберт Т.Дж., Сторм Д.Р., Салливан Дж. М..MicroRNA132 модулирует кратковременную синаптическую пластичность, но не базальную вероятность высвобождения в нейронах гиппокампа. PLoS One. 2010; 5: e15182.

    41. Мэджилл С.Т., Камбронн Х.А., Луйкарт Б.В., Лой Д.Т., Лейтон Б.Х., Вестбрук Г.Л., Мандель Г., Гудман Р.Х. микроРНК-132 регулирует рост дендритов и ветвление новорожденных нейронов во взрослом гиппокампе. Proc Natl Acad Sci U S. A. 2010; 107: 20382–20387.

    42. Пакер А.Н., Син Y, Харпер С.К., Джонс Л., Дэвидсон Б.Л. Бифункциональная микроРНК miR-9 / miR-9 * регулирует REST и CoREST и подавляется при болезни Хантингтона.J Neurosci. 2008; 28: 14341–14346.

    43. Ву Д., Раафат А., Пак Э., Клеменс С., Мурашов А.К. Путь дайсер-микроРНК имеет решающее значение для регенерации периферических нервов и функционального восстановления in vivo и регенеративного аксоногенеза in vitro . Exp Neurol. 2012; 233: 555–565.

    44. Лопес Дж. П., Лим Р., Кручану С., Крэппер Л., Фазано С., Лабонте Б., Маусион Дж., Ян Дж. П., Йерко В., Виньо Е., Эль Местикави С., Мехавар Н., Павлидис П. и др. miR-1202 является специфичной для приматов и обогащенной мозгом микроРНК, участвующей в лечении большой депрессии и антидепрессантами.Природная медицина. 2014; 20: 764–768.

    45. Morgan CP, Bale TL. Ранний пренатальный стресс эпигенетически программирует дисмаскулинизацию у потомков второго поколения по отцовской линии. Журнал неврологии: официальный журнал Общества нейробиологии. 2011; 31: 11748–11755.

    46. Рао Ю.С., Мотт Н.Н., Ван И, Чунг В.С., Пак Т.Р. МикроРНК в стареющем женском мозге: предполагаемый механизм возрастных эффектов эстрогена. Эндокринология. 2013; 154: 2795–2806.

    47.Toufexis DJ, Myers KM, Bowser ME, Davis M. Эстроген нарушает подавление страха у самок крыс, возможно, за счет антагонистических эффектов рецептора эстрогена альфа (ERalpha) и ERbeta. Журнал неврологии: официальный журнал Общества нейробиологии. 2007; 27: 9729–9735.

    48. Миллер В.Дж., Сузуки С., Миллер Л.К., Ханда Р., Юта, РМ. Бета-изоформы рецептора эстрогена (ER), а не ERalpha, регулируют активность промотора кортикотропин-рилизинг-гормона альтернативным путем.Журнал неврологии: официальный журнал Общества нейробиологии. 2004; 24: 10628–10635.

    49. Пэрис О., Ферраро Л., Гробер О.М., Раво М., Де Филиппо М.Р., Джурато Дж., Насса Дж., Таралло Р., Кантарелла С., Риццо Ф., Ди Бенедетто А., Моттолезе М., Бенеш В. и др. Прямая регуляция биогенеза и экспрессии микроРНК бета-рецептором эстрогена при гормонально-зависимом раке молочной железы. Онкоген. 2012; 31: 4196–4206.

    50. Викрамасингх Н.С., Манавалан Т.Т., Догерти С.М., Риггс К.А., Ли Й., Клинге С.М.Эстрадиол подавляет экспрессию miR-21 и увеличивает экспрессию целевого гена miR-21 в клетках рака молочной железы MCF-7. Nucleic Acids Res. 2009; 37: 2584–2595.

    51. Bhat-Nakshatri P, Wang G, Collins NR, Thomson MJ, Geistlinger TR, Carroll JS, Brown M, Hammond S, Srour EF, Liu Y, Nakshatri H. Регулируемые эстрадиолом микроРНК контролируют эстрадиоловый ответ в клетках рака молочной железы . Nucleic Acids Res. 2009; 37: 4850–4861.

    52. Ибанес-Вентосо К., Ян М., Го С., Робинс Х., Пэджетт Р. У., Дрисколл М.Модулированная экспрессия микроРНК в течение взрослой жизни у Caenorhabditis elegans. Ячейка старения. 2006; 5: 235–246.

    53. Като М., Чен Х, Инукай С., Чжао Х., Слэк Ф.Дж. Связанные с возрастом изменения экспрессии малых некодирующих РНК, включая микроРНК, у C. elegans. Рна. 2011; 17: 1804–1820.

    54. Li N, Bates DJ, An J, Terry DA, Wang E. Повышающая регуляция ключевых микроРНК и обратная понижающая регуляция их предсказанных генов-мишеней окислительного фосфорилирования во время старения в мозге мыши. Neurobiol Aging.2011; 32: 944–955.

    55. Somel M, Guo S, Fu N, Yan Z, Hu HY, Xu Y, Yuan Y, Ning Z, Hu Y, Menzel C, Hu H, Lachmann M, Zeng R, et al. МикроРНК, мРНК и экспрессия белка связывают развитие и старение в мозге человека и макака. Genome Res. 2010; 20: 1207–1218.

    56. Абэ М., Накви А., Хендрикс Г.Дж., Фельцин В., Жу Ю., Григорьев А., Бонини Н.М. Влияние возрастного увеличения 2′-O-метилирования miRNA на старение и нейродегенерацию у Drosophila. Гены и развитие. 2014; 28: 44–57.

    57. Фридман Р.К., Фарх К.К., Бурдж С.Б., Бартель Д.П. Большинство мРНК млекопитающих являются консервативными мишенями для микроРНК. Genome Res. 2009; 19: 92–105.

    58. Lee HY, Doudna JA. TRBP изменяет процессинг микроРНК предшественника человека in vitro . Рна. 2012; 18: 2012–2019.

    59. Ферраро Л., Раво М., Насса Дж., Таралло Р., Де Филиппо М.Р., Джурато Дж., Чирилло Ф., Стеллато С., Сильвестро С., Кантарелла С., Риццо Ф, Чимино Д., Фриар О. и др. Влияние эстрогена на экспрессию микроРНК в клетках рака молочной железы, чувствительных к гормонам.Гормоны и рак. 2012; 3: 65–78.

    60. Веселы С., Таубер С., Седлазек Ф.Дж., Таджаддод М., фон Хезелер А., Янч М.Ф. ADAR2 вызывает воспроизводимые изменения в последовательности и количестве зрелых микроРНК в мозге мыши. Исследование нуклеиновых кислот. 2014; 42: 12155–12168.

    61. Meister G, Landthaler M, Patkaniowska A, Dorsett Y, Teng G, Tuschl T. Human Argonaute2 опосредует расщепление РНК, на которое нацелены миРНК и миРНК. Mol Cell. 2004; 15: 185–197.

    62. Guo L, Lu Z. Судьба цепи miRNA * посредством эволюционного анализа: значение для деградации как просто цепи-носителя или потенциальной регуляторной молекулы ?.PLoS One. 2010; 5: e11387.

    63. Окамура К., Филлипс, доктор медицины, Тайлер Д.М., Дуан Х, Чжоу Ю.Т., Лай Э.С. Регуляторная активность видов микроРНК * оказывает существенное влияние на эволюцию микроРНК и 3 ‘НТО. Nat Struct Mol Biol. 2008; 15: 354–363.

    64. Ян Дж. С., Филлипс, доктор медицинских наук, Бетель Д., Му П, Вентура А., Сипел А. С., Чен К. К., Лай Э. Широко распространенная регуляторная активность видов микроРНК * позвоночных. Рна. 2011; 17: 312–326.

    65. Шен Дж., Ся В., Хотская Ю. Б., Хо Л., Наканиши К., Лим СО, Ду И, Ван И, Чанг В. К., Чен С.Х., Хсу Дж.Л., Ву И., Лам Ю.С. и др.EGFR модулирует созревание микроРНК в ответ на гипоксию посредством фосфорилирования AGO2. Природа. 2013; 497: 383–387.

    66. Chakraborty TR, Hof PR, Ng L, Gore AC. Стереологический анализ экспрессии рецептора эстрогена альфа (ER альфа) в гипоталамусе крысы и ее регуляции старением и эстрогеном. J Comp Neurol. 2003; 466: 409–421.

    67. Chakraborty TR, Ng L, Gore AC. Возрастные изменения бета-рецептора эстрогена в гипоталамусе крысы: количественный анализ. Эндокринология. 2003; 144: 4164–4171.

    68. Кермат Б.А., Риха П.Д., Воллер М.Дж., Вулф А., Гор А.С. Молекулярные изменения гипоталамуса, лежащие в основе естественного репродуктивного старения самок крыс. Эндокринология. 2014; 155: 3597–3609.

    69. Мотт Н.Н., Пак Тр. Характеристика вариантов сплайсинга человеческого эстрогенового рецептора бета (ERbeta) в нейрональных клетках. J Neuroendocrinol. 2012; 24: 1311–1321.

    70. Пак Т.Р., Чанг В.С., Робертс Дж.Л., Ханда Р.Дж. Лиганд-независимые эффекты бета-рецептора эстрогена на активность промотора гонадотропин-рилизинг-гормона мыши.Эндокринология. 2006; 147: 1924–1931.

    71. Wang JM, Hou X, Adeosun S, Hill R, Henry S, Paul I, Irwin RW, Ou XM, Bigler S, Stockmeier C, Brinton RD, Gomez-Sanchez E. эффективность ранней или поздней терапии эстрогенами после овариэктомии у крыс. PLoS One. 2012; 7: e33493.

    72. Мотт Н.Н., Пинчети Э., Рао Ю.С., Пжибисен-Шиманска М.М., Принс С.А., Шульц К.Л., Ян Х, Глюксман М.Дж., Робертс Дж.Л., Пак Т.Р. Возрастзависимые эффекты 17beta-эстрадиола на динамику белок-белковых взаимодействий рецептора эстрогена бета (ERbeta) в вентральном гиппокампе.Протеомика клеток Mol. 2014; 13: 760–779.

    73. Ойола М.Г., Портильо В., Рейна А., Форадори С.Д., Кудва А., Хайндс Л., Ханда Р.Дж., Мани С.К. Анксиолитические эффекты и нейроанатомические мишени активации рецептора эстрогена-бета (ERbeta) селективным агонистом ERbeta у самок мышей. Эндокринология. 2012; 153: 837–846.

    74. Вайзер М.Дж., Ву Т.Дж., Ханда Р.Дж. Диарилпропионитрил, агонист бета-рецепторов эстрогена: биологическая активность R- и S-энантиомеров на поведение и гормональный ответ на стресс. Эндокринология.2009; 150: 1817–1825.

    75. Пак Т.Р., Линч Г.Р., Циглер Д.М., Лунден Дж.Б., Цай П.С. Нарушение начала полового созревания экзогенным тестостероном и эстрогеном у двух видов грызунов. Американский журнал физиологии эндокринологии и метаболизма. 2003; 284: E206–212.

    76. Тебар М., Руис А, Беллидо С, Санчес-Криадо Дж. Э.. Яичник опосредует эффекты RU486, вводимого во время проэструса, на диэстральную секрецию лютеинизирующего гормона у крыс. Биол Репрод. 1996; 54: 1266–1270.

    77.Schmittgen TD, Jiang J, Liu Q, Yang L. Высокопроизводительный метод мониторинга экспрессии предшественников микроРНК. Исследование нуклеиновых кислот. 2003; 32.

    78. Kinjo ER, Higa GS, de Sousa E., Casado OA, Damico MV, Britto LR, Kihara AH. Возможный новый механизм контроля экспрессии miRNA в нейронах. Экспериментальная неврология. 2013; 248: 546–558.

    79. Ливак К.Дж., Шмитген Т.Д. Анализ данных относительной экспрессии генов с использованием количественной ПЦР в реальном времени и метода 2 (-Delta Delta C (T)).Методы. 2001; 25: 402–408.

    80. Fic E, Kedracka-Krok S, Jankowska U, Pirog A, Dziedzicka-Wasylewska M. Сравнение методов осаждения белков для различных структур мозга крыс перед протеомным анализом. Электрофорез. 2010; 31: 3573–3579.

    Границы | E2 регулирует эпигенетическую сигнатуру на усилителе-промоторе нейроглобина в нейрональных клетках

    Введение

    17β-эстрадиол (E2) обладает нейропротекторной активностью в нескольких моделях нейродегенеративных расстройств, таких как рассеянный склероз, ишемия, инсульт и болезнь Альцгеймера (AD; Arevalo et al., 2015). Геномная передача сигналов E2 опосредуется рецепторами эстрогена альфа (ERα) и бета (ERβ), рецепторами ядерных факторов транскрипции, связанными с регуляторными областями генома, известными как промоторы и энхансеры. Более того, ERs образуют транскрипционные комплексы с несколькими факторами транскрипции и кофакторами, обеспечивая дальнодействующие взаимодействия между промотором и энхансером генов-мишеней (Welboren et al., 2009). Корегуляторы ER содержат факторы ремоделирования хроматина, такие как ферменты модификации гистонов. Динамика хроматина, связанная с эпигенетическими модификациями, представляет собой молекулярный механизм активации или репрессии экспрессии генов (Magnani, Lupien, 2014; Heinz et al., 2015).

    Эпигенетические изменения под контролем E2 влияют на консолидацию памяти и расход энергии в гипоталамусе (Zhao et al., 2010; Frick et al., 2011; Frank et al., 2014; López and Tena-Sempere, 2015). E2 индуцирует повышенную экспрессию ферментов ремоделирования хроматина, таких как гистондеацетилазы, деметилазы и ацетилтрансферазы (Zhao et al., 2010, 2012). В дорсальном гиппокампе E2 регулирует ацетилирование гистона 3 на промоторе нейротрофического фактора мозга (BDNF) (Fortress et al., 2014) и ERα, но не потеря ERβ, вызывает нарушение пространственной памяти у мышей (Bean et al., 2014). В гипоталамусе E2 модулирует энергетический гомеостаз несколькими путями, включая регуляцию транскрипции ключевых генов метаболизма мозга, таких как рецептор окситоцина, рецептор прогестерона (Gagnidze et al., 2013), рецептор лептина (Bennett et al., 1999; Lindell et al. ., 2001) и проопиомеланокортин (Pelletier et al., 2007).

    Одним из белков-мишеней, который увеличивается после лечения E2, является нейроглобин (NGB), связывающий кислород белок, который действует как поглотитель активных форм кислорода и азота.NGB оказывает нейрозащитное действие против окислительного повреждения, после инсульта и в моделях AD. E2 увеличивает уровни NGB в зависимости от дозы (1–10 нМ). Этот эффект достигается через 1 час лечения и сохраняется в течение 24 часов в клеточных линиях нейробластомы человека и в первичных нейронах гиппокампа мыши. Влияние E2 на экспрессию NGB очевидно также в первичных астроцитах (De Marinis et al., 2011, 2013a). Нейрональная гипоксия и церебральная ишемия увеличивают уровни NGB, которые защищают от нейродегенерации, поскольку подавление NGB вызывает апоптоз нейронов (Greenberg et al., 2008). E2 защищает H 2 O 2 -индуцированный апоптоз в нейронах (De Marinis et al., 2011). NGB сверхэкспрессируется на ранней стадии БА и образует комплекс с пептидом амилоид-β (Sun et al., 2013; Seal et al., 2015).

    Модуляция

    NGB при лечении E2 опосредуется ERβ, как показано на линии клеток нейробластомы человека (SK-N-BE), в первичных нейронах гиппокампа мышей, астроцитах мышей и нескольких линиях раковых клеток. Передача сигналов ERβ опосредуется ассоциированными с мембранами белками и оказывает влияние на митохондрии в качестве защиты от апоптоза (De Marinis et al., 2011, 2013b; Fiocchetti et al., 2014, 2015). Хотя это хорошо оцененные данные, вопрос о том, может ли ERα оказывать прямое влияние на транскрипцию NGB, подробно не проработан, поэтому мы рассмотрели этот вопрос в настоящей работе, используя дифференцированные клетки SK-N-BE и NT-2 в качестве нейрональных клеток. -как модели in vitro . Сравнение двух клеточных линий разного происхождения (SK-N-BE, клеточные линии нейробластомы человека и NT-2, клеточная линия эмбриональной карциномы человека) в условиях дифференцировки представляет собой модели для изучения E2-индуцированной регуляции транскрипции NGB и поиска геномных регуляторных областей. .

    Изучая базу данных ENCODE, мы обнаружили активные гистоновые метки и несколько факторов транскрипции, связывающихся в первом интроне локуса NGB различных линий нейрональных клеток (Cutrupi et al., 2014). Здесь мы обнаружили, что E2 индуцирует связывание ERα с локусом NGB и ремоделирует хроматин, изменяя эпигенетические метки. Мы продемонстрировали, что интронный энхансер, связанный с ERα после обработки E2, имел активные гистоновые метки, предполагая, что этот интронный энхансер является важной регуляторной областью в регуляции транскрипции NGB.Эти данные показали потенциальный механизм, с помощью которого E2 может опосредовать нейропротекторное действие NGB против нейротоксических стимулов, открывая путь к гормональной терапии старения.

    Материалы и методы

    Клеточные линии и методы лечения

    SK-N-BE, линия клеток нейробластомы человека, поддерживалась в среде RPMI (Roswell Park Memorial Institute) 1640, содержащей 2 мМ глутамина и дополненной 100 мл / л фетальной бычьей сыворотки, 10 мл / л заменимых аминокислот и Смесь антибиотиков 10 мл / л (пенициллин-стрептомицин амфотерицин).Для дифференциации 2 × 10 6 помещали в колбы для культивирования 75 см 2 (Corning Costar, Sigma-Aldrich, США) и обрабатывали 10 мкМ ретиноевой кислоты (RA) в течение 10 дней.

    Клетки NT-2, линия клеток эмбриональной карциномы человека, поддерживали в среде Игла, модифицированной Дульбекко (DMEM) / F12 (Sigma-Aldrich, США), с добавлением 5% фетальной бычьей сыворотки и 1% смеси антибиотиков, содержащей пенициллин-стрептомицин-амфотерицин. , во влажной атмосфере при 37 ° C и 5% CO 2 .Для дифференцировки 2 × 10 6 клеток помещали в колбы для культивирования 75 см 2 (Corning Costar, Sigma-Aldrich, США) и подвергали воздействию 10 мкМ RA в течение 5 недель. Среду для выращивания меняли три раза в неделю. Затем клетки повторно высевали и через 48 часов добавляли митотические ингибиторы цитозинарабинозид (1 мкМ), фтордезоксиуридин (10 мкМ) и уридин (10 мкМ) на 2 недели для ингибирования деления ненейронных клеток. Эксперименты проводили через 4–5 недель после прекращения лечения РА. Клетки выращивали в течение 24 часов в среде без гормонов, полученной из среды DMEM, не содержащей фенолового красного (31053–028, Life Technologies, U.S.A) с добавлением 5% сыворотки, обработанной декстраном древесного угля, и обрабатывали 17β-эстрадиолом (E2; E2758–1G, Sigma-Aldrich, США) в конечной концентрации 10 нМ.

    ОТ-ПЦР в реальном времени

    Тотальную РНК выделяли с использованием реагента TRIzol (Life Technologies, США). Пятьсот нанограмм общей РНК подвергали обратной транскрипции с использованием набора для синтеза кДНК RETROScript (Life Technologies, США).

    ПЦР в реальном времени выполняли с использованием 7900HT Fast Real Time PCR от Applied Biosystems, iTaqTM Universal SYBRR Green Supermix (Biorad) и системы обнаружения Bio-Rad iQ iCycler с зеленым флуорофором SYBR.Анализ кривой плавления проводился после каждого прогона, чтобы гарантировать один амплифицированный продукт для каждой реакции. Все реакции проводили по крайней мере в трех экземплярах для каждого образца. Праймеры для изучения экспрессии NGB были следующими: NGB-Forward: 5′-TGGAAGACCTGTCCTCACTG-3 ‘и NGB-Reverse: 5′-GAGCAGAGACTCACCCACTG-3’ (Zhang et al., 2011). Экспрессию генов нормализовали с использованием специфической амплификации 18S.

    Иммуноблот-анализ

    нейронных клеток SK-N-BE и NT-2, обработанных в соответствующих экспериментальных условиях, быстро помещали на лед и промывали ледяным PBS.Экстракты целых клеток получали в ледяном буфере для лизирования. Концентрацию белка в супернатанте количественно определяли в трех повторностях с помощью анализа бицинхониновой кислоты (BCA). Для определения NGB 100 мкг клеточных лизатов разделяли на 15% гели, переносили на нитроцеллюлозу и выявляли, соответственно, с помощью антител против NGB (Santa Cruz). Мембраны удаляли и инкубировали с антителом против актина. Реакции были разработаны с использованием системы повышенной хемилюминесценции (ECL) в соответствии с протоколом производителя (Amersham-Pharmacia, Biotech, Italia, Cologno Monzese, Италия).Денситометрический анализ выполняли с использованием программного обеспечения (Multi-analyst, версия 1.1, Bio-Rad Laboratories, Segrate, Италия). Сигналы NGB были нормализованы к сигналам соответствующего актина, были выражены в произвольных единицах оптической плотности и были средними значениями ± стандартное отклонение трех независимых экспериментов.

    Анализ иммунопреципитации хроматина (ChIP)

    Дифференцированные SK-N-BE и NT-2 обрабатывали носителем или E2 и инкубировали в течение 45 минут и 1 часа, после чего их обрабатывали 1% формальдегидом в PBS в течение 10 минут при комнатной температуре на шейкере для платформы.Реакцию сшивания останавливали добавлением глицина до конечной концентрации 125 мМ. Клетки дважды промывали холодным PBS перед сбором, а затем сшитые клетки ресуспендировали в буфере для лизиса клеток (5 мМ Pipes pH 8,0, 85 мМ KCl и 0,5% NP-40). После 10 мин инкубации на льду ядра собирали центрифугированием и ресуспендировали в буфере для лизиса ядер (50 мМ Tris-HCl pH 8,1, 10 мМ EDTA и 1% SDS). Лизаты клеток инкубировали на льду в течение 10 мин, а затем обрабатывали ультразвуком 10 раз в течение 20 с при 30% амплитуде (ультразвуковой аппарат SonoPlus HD2070).Небольшую часть обработанного ультразвуком хроматина (25 мкл) использовали для проверки того, что средний размер фрагментов ДНК находится в диапазоне 250–500 п.н. Комплексы ДНК / белок (30 мкг) разводили в буфере для иммунопреципитации (0,01% SDS, 1,1% Triton X-100, 1,2 мМ EDTA, 16,7 мМ Tris-HCl pH 8,0 и 167 мМ NaCl) до конечного объема 400 мкл. Иммунопреципитацию проводили путем добавления 1 мкг антител против ERα человека h284 и HC20 (Santa Cruz Biotechnology, США), h4K4me3 и h4K4me1 (Diagenode, Бельгия), h4K27me3 и h4K27Ac (Active Motif, U.S.A) и IgG (Abcam, Великобритания), а затем инкубируют при 4 ° C в течение ночи с вращением. Образцы с антителом IgG обрабатывали параллельно в качестве отрицательного контроля. На следующий день добавляли 30 мкл суспензии 50% Protein A Sepharose TM 4 Fast Flow (GE Healthcare, UK) и инкубировали в течение 2 часов при 4 ° C для захвата иммунных комплексов. Белки и ДНК, неспецифически связанные с шариками, удаляли последовательной промывкой буфером с низким содержанием соли (0,1% SDS, 1% Triton X-100, 2 мМ EDTA, 20 мМ Tris-HCl pH 8.0 и 150 мМ NaCl), высокосолевой буфер (0,1% SDS, 1% Triton X-100, 2 мМ EDTA, 20 мМ Tris-HCl, pH 8,0 и 500 мМ NaCl), промывочный буфер LiCl (0,25 M LiCl; 1 % натриевой соли дезоксихолата, 1 мМ ЭДТА, 10 мМ Трис-HCl pH 8,0 и 1% NP-40) и дважды с буфером Трис-ЭДТА (10 мМ Трис-HCl pH 8,0, 1 мМ ЭДТА) при 4 ° C в течение 5 мин. каждая стирка. Иммунопреципитированные комплексы ДНК-белок элюировали с шариков 1% SDS в 0,1 М NaHCO 3 . Затем комплексы ДНК-белок инкубировали с 0,2 М NaCl при 65 ° C в течение ночи с последующим расщеплением протеиназой K в течение 1 ч при 45 ° C для обратного сшивания.После удаления белка ДНК очищали экстракцией фенолом / хлороформом с последующим осаждением Et-OH.

    Количественное определение ДНК, обогащенной ChIP, проводили с помощью ПЦР в реальном времени с использованием iTaq Universal SYBR Green Supermix (Bio-Rad, США). Обогащение последовательностей-мишеней в иммунопреципитированных образцах было нормализовано для входных образцов (1% общего хроматина, используемого на IP) и выражено как увеличение специфического связывания по сравнению с контрольным неспецифическим связыванием IgG. Пользовательские праймеры ChIP представляют собой: промотор NGB, прямой: 5′-GAGGCGACCAAATTCAACAC-3 ‘, обратный: 5′-TGCAGAACGTAACTGACATCG-3′; Интронный энхансер NGB, прямой: 5’-CAGCTTGGATGTAGTGCAGC-3 ‘, обратный: 5′-TTCAGTTACCCGGTGAGACC-3′; GAPDH (Neg) вперед: 5’-TACTAGCGGTTTTACGGGCG-3 ‘, назад: 5′-TCGAACAGGAGGAGCAGAGAGCGA-3’.

    Биоинформатический анализ

    Наборы данных FANTOM5 (http://fantom.gsc.riken.jp/5/) содержат сайты начала транскрипции (TSS) и их экспрессию в первичных клетках, тканях и клеточных линиях человека и мыши с использованием кэп-анализа экспрессии генов (CAGE) (Форрест и др., 2014). Мы провели поиск NGB и проанализировали локус NGB, используя геномный инструмент браузера Zenbu (Severin et al., 2014). Мы выбрали транскрипты, обогащенные NGB TSS и экспрессией первого интрона. Для оценки уровня экспрессии NGB учитывали основной пик CAGE, приписываемый гену (p1 @ NGB).Для оценки уровня экспрессии РНК, транскрибируемых на интронном энхансере NGB, было выбрано окно в 100 п.н., сфокусированное на кластере пика CAGE (chr14: 77,735,777-7,773,587, сборка генома hg19). Были рассмотрены 20 образцов, связанных с наивысшим уровнем CAGE.

    Статистический анализ

    Статистические данные были выполнены с помощью GraphPad Prism версии 5.03 для Windows с помощью одностороннего дисперсионного анализа с последующим апостериорным тестом Бонферрони .

    Результаты

    Локус NGB в базе данных FANTOM5

    Мы ранее опубликовали биоинформатический анализ локуса NGB для выявления предполагаемых регуляторных регионов.Таким образом, мы исследовали новую базу данных FANTOM5, включая эксперименты CAGE на более чем 900 человеческих образцах (Forrest et al., 2014). Мы обнаружили несколько транскриптов в соответствии с TSS и в первом интроне гена NGB (рисунок 1). Первые интронные транскрипты отображаются на энхансере, который мы предсказали ранее (chr14: 77,735,963-77,736,462; hg19; Cutrupi et al., 2014). Присутствие транскриптов в энхансере указывает на сайт транскрипции некодирующей РНК, и эти транскрипты могут регулировать экспрессию генов.Следовательно, эта область может действовать как дальняя геномная регуляторная область для близлежащих генов (Ong and Corces, 2011). Однако данные по экспрессии транскриптов, происходящих от промотора NGB, показали их высокую распространенность в нескольких областях мозга, особенно в locus coeruleus , затылочной коре и доле, миндалевидном теле (Рисунок 2; пик промотора NGB CAGE). Напротив, первые интронные транскрипты высоко экспрессируются в ненейрональных тканях, идентифицируя эту геномную область (рис. 2; интронный энхансер NGB).

    Рисунок 1. Локус нейроглобина (NGB) и экспрессия транскрипта в базе данных FANTOM5. Zenbu Genome Browser локуса NGB человека (chr14: 77,730,566-77,739,297). В первых трех полосах представлены аннотации стенограммы из базы данных Entrez, Gencode и UCSC. Смысловые транскрипты выделены зеленым цветом, а антисмысловые — фиолетовым. Красная полоса отмечает высокий уровень транскриптов сайта начала транскрипции (TSS). Черная стрелка указывает антисмысловой транскрипт в первом интроне (chr14: 77 735 803-77 735 866).

    Рисунок 2. Выражение основного транскрипта NGB в базе данных FANTOM5. Гистограмма, показывающая ткани, связанные с наивысшим уровнем транскриптов, аннотированных с основным TSS NGB (p1 @ NGB) или с интронным энхансером.

    E2 индуцирует экспрессию NGB в дифференцированных клетках SK-N-BE и NT-2

    E2-индуцированная экспрессия белка NGB в клеточных линиях нейробластомы, SK-N-BE, была ранее продемонстрирована (De Marinis et al., 2011), и здесь мы исследовали клетки SK-N-BE и NT-2 в условиях, приводящих к дифференцировка клеток.Клетки высевали и культивировали в полной среде, затем выдерживали в среде, обедненной гормонами, в течение 24 часов перед обработкой 10 нМ E2 и собирали в разные моменты времени (3, 6, 12 и 24 часа). Для сравнения использовали клетки, выращенные в среде, обедненной гормонами, и обработанные в течение 24 часов 10 нМ Et-OH. Используя количественную ОТ-ПЦР, мы наблюдали, что E2 индуцировал экспрессию мРНК NGB с разной кинетикой в ​​двух типах клеток. Клетки SK-N-BE показали 4-кратное увеличение мРНК NGB после 12 ч обработки E2 ( F (4,15) = 7.7, P <0,001), и клетки NT-2 показали увеличение уровня мРНК NGB (~ 6 раз) через 3 часа и сохраняется до 12 часов ( F (4,15) = 44,5, P <0,0001; Рисунок 3A). Мы проанализировали уровень белка NGB с помощью вестерн-блоттинга: белок NGB увеличился в 2 раза после 6 часов обработки E2 в клетках SK-N-BE и в 3 раза через 3 часа в клетках NT-2 (рис. 3B). Кинетическая активация NGB между мРНК и белком после обработки E2 различается, что позволяет предположить, что E2 может регулировать NGB с помощью нескольких механизмов.

    Рисунок 3. Экспрессия мРНК и белка NGB в дифференцированных клетках нейробластомы SK-N-BE и NT-2. (A) Динамика мРНК NGB после обработки 10 нМ 17β-эстрадиолом (E2). Планки погрешностей представляют собой ± SEM трех независимых биологических повторов: * p -значение <0,05, ** p -значение <0,01 и *** p -значение <0,001. Значения p вычисляли с помощью одностороннего дисперсионного анализа (ANOVA) с последующим апостериорным тестом Бонферрони . (B) Динамика протеина NGB после обработки 10 нМ E2. Во всех случаях на диаграмме показаны средние нормированные значения денситометрии.

    E2 индуцирует ремоделирование хроматина в локусе NGB в дифференцированных клетках SK-N-BE и NT2

    Одним из этапов регуляции транскрипции экспрессии генов является ремоделирование хроматина. Динамические изменения эпигенетических модификаций связаны с регуляцией транскрипции при лечении E2 (Métivier et al., 2003). Гистоновые метки определяют специфические состояния хроматина: триметилирование гистона 3 лизина 4 (h4K4me3) является маркером активного состояния, соответствующего активации транскрипции гена в промоторе, триметилирование гистона 3 лизина 27 (h4K27me3) является маркером состояния молчания, соответствующего транскрипции гена. сайленсинга, тогда как монометилирование гистона 3 лизина 4 (h4K4me1) и ацетилирование гистона 3 лизина 27 (h4K27Ac) являются маркерами активных энхансеров.E2 индуцировал обогащение h4K27Ac активным энхансером (Hah et al., 2013). Чтобы обратиться к основным молекулярным механизмам того, как E2 регулирует экспрессию NGB, мы исследовали модификации гистонов на промоторе NGB и интронном энхансере с использованием иммунопреципитации хроматина с последующей количественной ОТ-ПЦР (ChIP-qPCR). Обогащение h4K4me3 было значительно увеличено на промоторе NGB в обоих типах клеток после 1 часа обработки E2 ( F (2,9) = 11,6, P <0,02 для SK-N-BE и F (2 , 9) = 44.1, P <0,002 для NT-2; Рисунок 4A). h4K27Ac ( F (2,9) = 71,4, P <0,001 для SK-N-BE и F (2,9) = 22,3, P <0,002 для NT-2) и h4K4me1 ( F (2,9) = 15,2, P <0,01 для SK-N-BE и F (2,9) = 62,4, P <0,001 для NT-2 ), увеличивалось после 45 минут и 1 часа обработки E2 таким же образом для двух типов клеток (Рисунок 4B).В совокупности эти данные предполагают, что E2 может регулировать транскрипцию NGB, индуцируя эпигенетическое ремоделирование промотора NGB и интронного энхансера.

    Фигура 4. E2 регулирует модификации гистонов в регуляторных геномных областях дифференцированных клеток нейробластомы SK-N-BE и NT-2. (A) Анализ ChIP-qPCR h4K4me3 и h4K27me3 на промоторе дифференцированных клеток SK-N-BE и NT-2, обработанных 10 нМ E2 в течение 45 минут и 1 часа. (B) ChIP-qPCR анализ h4K4me1 и h4K27Ac в интронной области дифференцированных клеток SK-N-BE и NT-2, обработанных 10 нМ E2 в течение 45 минут и 1 часа.Планки погрешностей представляют собой ± SEM трех независимых биологических повторов: * p -значение <0,05 и ** p -значение <0,01. Значения p вычисляли с помощью однофакторного дисперсионного анализа с последующим апостериорным тестом Бонферрони .

    ERα связывается с промотором NGB и интронным усилителем после обработки E2 в дифференцированных клетках SK-N-BE и NT-2

    E2 вызывает изменения модификаций гистонов и коэкспрессию ERα и NGB в различных областях мозга, что позволяет предположить, что E2 может регулировать экспрессию NGB посредством ERα.Чтобы проверить, связывается ли ERα с промотором NGB и предполагаемым энхансером (chr14: 77,735,963-77,736,462; hg19; сайт B), мы провели эксперименты ChIP-qPCR на дифференцированных клетках SK-N-BE и NT-2 с использованием ERα-специфических антител. E2 индуцировал связывание ERα с промотором NGB и усилителем первого интрона после 1 ч обработки (рис. 5). Промотор GAPDH использовали в качестве отрицательного контроля для связывания ERα. Эти данные предполагают, что E2-индуцированное связывание ERα с регуляторными областями NGB может привлекать ко-регуляторы, способные изменять состояния хроматина для активации транскрипции NGB.

    Фигура 5. E2 индуцирует ассоциацию рецептора эстрогена альфа (ERα) на промоторных и интронных областях дифференцированных клеток нейробластомы SK-N-BE и NT-2. ChIP-qPCR анализ связывания ERα на промоторе, интронном энхансере (Сайт B ) и области отрицательного контроля, GAPDH, дифференцированных клеток SK-N-BE (A) и NT-2 (B) , обрабатывали 10 нМ E2 в течение 45 мин и 1 ч. Планки погрешностей представляют собой ± SEM трех независимых биологических повторов.

    Обсуждение

    Настоящее исследование идентифицирует новый регуляторный домен в первом интроне локуса NGB, действующий как энхансер. E2 индуцировал связывание ERα и эпигенетические модификации в этой области генома совместно с промотором. Таким образом, мы описываем ERα-опосредованный геномный путь, способный регулировать транскрипцию NGB после обработки E2.

    E2 индуцирует рекрутирование ERα преимущественно в области элементов ответа на эстроген (ERE). Анализ In silico выявил отсутствие потенциальной ERE в промоторе NGB и энхансере интрона.Сайты связывания факторов транскрипции Sp1 и NF-kB присутствуют на промоторе NGB, и их связывание продемонстрировано в клеточных линиях нейробластомы (Liu et al., 2012). Следовательно, связывание ERα может опосредоваться Sp1 и NF-kB (Welboren et al., 2009). Другим фактором транскрипции, который опосредует связывание ERα, является белок, связывающий элемент ответа cAMP (CREB), связанный с промотором NGB мыши в клетках нейробластомы N2a (Liu et al., 2013). Изучая базу данных ENCODE, мы обнаружили, что несколько факторов транскрипции могут связывать интронный энхансер NGB, подтверждая гипотезу о том, что активный транскрипционный комплекс, связанный с интронным энхансером, может образовывать петлю взаимодействия с промотором NGB (Cutrupi et al., 2014). База данных FANTOM5 показала, что первые интронные транскрипты соответствуют предсказывающему интронному энхансеру. Теги CAGE идентифицируют двунаправленные кэпированные РНК, которые перекрываются с активными гистоновыми метками для энхансеров, h4K27Ac (Andersson et al., 2014). Однако эти первые интронные транскрипты экспрессируются в гладких мышцах, где экспрессия NGB еще не обнаруживается, что позволяет предположить, что первый интронный энхансер может находиться в активном состоянии в этой конкретной ткани в базовых условиях в качестве предполагаемой альтернативы TSS, поскольку существует однонаправленный транскрипт.В нейрональных клетках первый интронный энхансер может переходить из состояния равновесия в активное состояние после стимулов. В наших нейронных моделях интронный энхансер приобретает активные гистоновые метки после обработки E2, даже несмотря на то, что в библиотеке FANTOM5 нет никаких транскриптов в этих конкретных типах клеток. Следовательно, интронный энхансер может стать активным после стимула E2 в нейрональных моделях.

    После анализа коэкспрессии генов на основе базы данных Allen Brain Atlas (ABA) мы обнаружили, что ERα и NGB в высокой степени коэкспрессируются в гипоталамусе (Cutrupi et al., 2014). Используя анализ профилей экспрессии гена ABA в конкретных областях мозга, коэкспрессия рецепторов стероидных гормонов связана с областью, специфичной для типов клеток. В частности, ERα высоко экспрессируется в определенных областях гипоталамуса в соответствии с регулируемыми эстрогенами генами, такими как NGB (Mahfouz et al., 2016). Эффекты эстрогена в энергетическом гомеостазе гипоталамуса в значительной степени опосредуются ERα, как продемонстрировано моделями нокаута ERα и ERβ (López and Tena-Sempere, 2015). Кроме того, NGB также экспрессируется в гиппокампе у трансгенных мышей с избыточной экспрессией NGB в условиях гипоксии и БА (Raida et al., 2013; Sun et al., 2013), и как ERα, так и ERβ связаны с одними и теми же патологическими состояниями (Arevalo et al., 2015). В целом эти данные показали, что специфические для области мозга молекулярные механизмы могут регулировать экспрессию NGB после лечения E2.

    E2 регулирует экспрессию NGB как геномными, так и негеномными путями, что продемонстрировано на нейрональных и ненейрональных клеточных моделях. E2 увеличивает уровень белка NGB в нейрональных клетках и индуцирует локализацию NGB в митохондриях, где после повреждения окислительным стрессом NGB ингибирует проапоптотическую передачу сигналов с помощью ERβ (De Marinis et al., 2013б). В кортикальных астроцитах мышей ERβ опосредует E2-индуцированную экспрессию NGB и индуцируемую липополисахаридами (LPS) провоспалительную передачу сигналов (De Marinis et al., 2013a). В линиях раковых клеток ERα сверхэкспрессируется по сравнению с ERβ и опосредует экспрессию NGB при лечении E2 (Fiocchetti et al., 2014). В этой работе мы использовали дифференцированные NT-2 клетки, в которых ERα сверхэкспрессируется по отношению к ERβ, поэтому вклад ERα в E2-индуцированное ремоделирование хроматина в локусе NGB может быть преобладающим.

    Мы обнаружили, что E2 индуцирует связывание ERα с промотором NGB и энхансером интрона, что коррелирует с динамикой эпигенетических модификаций.E2 индуцировал повышенный уровень активных гистоновых меток h4K4me3 на промоторе NGB и h4K4me1-h4K27Ac на интронном энхансере. ERα экспрессируется в определенных областях гипоталамуса, которые важны для регуляции энергетического гомеостаза (Frank et al., 2014). Молекулярные механизмы, которые происходят при ремоделировании хроматина, могут быть вызванным ERα рекрутированием ко-регуляторов с ферментативной активностью, чтобы индуцировать модификации гистонов в регуляторных регионах (Green and Carroll, 2007). Описано несколько факторов, формирующих комплексы ERα в моделях рака молочной железы, но мало что известно о нервной системе.Кофакторы SRC-1 и SRC-2, связанные с гистонацетилтрансферазой p300 / CBP, экспрессируются в определенных нейронах гипоталамуса и регулируются изоформами экспрессии рецепторов прогестерона (Apostolakis et al., 2002; Gagnidze et al., 2013; Acharya et al., 2015) .

    Кроме того, E2 регулирует экспрессию ферментов, которые осуществляют модификации гистонов: усиление ацетилирования гистона 3 и снижение гистондеацетилазы, HDAC2 и HDAC3, в гиппокампе (Frick, 2015). При консолидации памяти изменения модификаций гистонов описываются на BDNF (Fortress et al., 2014). В этом контексте E2-индуцированные эффекты памяти опосредуются негеномным путем, где ERK и PI-3-киназа активируют CREB, который представляет собой фактор транскрипции, управляющий ремоделированием хроматина и регуляцией экспрессии генов (Frick, 2015).

    При патологических состояниях E2-индуцированный NGB может опосредовать антиапоптотический ответ (De Marinis et al., 2011). Снижение уровня E2 во время менопаузы связано с высоким риском когнитивных нарушений, инсульта и АД. E2 оказывает нейропротекторное действие на нескольких животных моделях нейродегенеративных заболеваний, таких как ишемия, AD и экспериментальный аутоиммунный энцефаломиелит (EAE; Arevalo et al., 2015). Кроме того, взаимодействие ERα с нейрофибриллярным клубком и комплексами NGB-Aβ предполагает, что белки, агрегированные с ERα и NGB, могут ингибировать их функции, поэтому дерегуляция нарушает нейропротекторный эффект при БА (Sun et al., 2013; Seal et al., 2015; Wang et al., 2016). NGB коэкспрессируется с ERα в определенных областях гипоталамуса (Hundahl et al., 2008; Cutrupi et al., 2014). NGB представляет собой гем-белок с функцией окислительной защиты и образует комплекс с цитохромом с в митохондриях (Yu et al., 2012). E2 регулирует энергетический гомеостаз, действуя на специфические для гипоталамуса области, а снижение E2 во время старения было связано с увеличением массы тела и распределением жира (Fontana et al., 2015). В целом эти данные предполагают, что E2-индуцированный NGB может регулировать функцию митохондрий: контроль метаболизма глюкозы, генерации АТФ и апоптоза нейронов.

    NGB также экспрессируется в гиппокампе, где функции ERα важны для формирования памяти, в то время как ERβ снижает гены-мишени эстрогена (Han et al., 2013; Cho et al., 2015; Фрик, 2015). Модели нокаута ERα и сверхэкспрессии ERα продемонстрировали центральную роль в функции памяти (Foster et al., 2008; Bean et al., 2014). Подавление ERα было связано с ухудшением памяти в период старения и менопаузы, когда снижается уровень эстрогенов (Frick, 2015). Эстрогены регулируют нейрогенез в гиппокампе и играют центральную роль в нейропластичности (Barha and Galea, 2010). Наша работа обращает внимание на эпигенетические модификации в регуляторных областях генома при лечении эстрогенами, а также на эпигенетические изменения, происходящие при старении (Frick et al., 2011). Совместная экспрессия ERα и NGB в нескольких областях мозга предполагает, что они могут регулировать различные сигналы, важные для формирования памяти в гиппокампе и для энергетического гомеостаза в гипоталамусе. Данные, полученные для дифференцированных клеток NT-2 и SK-N-BE, могут свидетельствовать о том, что состав и среда транскрипционного комплекса регулируют экспрессию NGB после обработки E2. Следовательно, эти данные в клеточных моделях поддерживают дальнейшие эксперименты на нейродегенеративных моделях мышей для исследования того, какой эпигенетический контекст является благоприятным для гормональной терапии.

    Авторские взносы

    MG, SR, AI, LV, GF, VM, LR, ET и MDB вносят свой вклад в: Существенный вклад в концепцию или дизайн работы; или сбор, анализ или интерпретация данных для работы; и составление проекта работы или ее критический пересмотр на предмет важного интеллектуального содержания; и окончательное утверждение версии, которая будет опубликована; и согласие нести ответственность за все аспекты работы, чтобы вопросы, связанные с точностью или целостностью любой части работы, должным образом исследовались и решались.

    Заявление о конфликте интересов

    Авторы заявляют, что исследование проводилось при отсутствии каких-либо коммерческих или финансовых отношений, которые могут быть истолкованы как потенциальный конфликт интересов.

    Благодарности

    Исследование

    было поддержано итальянским MURST (PRIN Grant20109MXHMR_005) и местным университетом Турина, финансирование исследований в 2015 году. Фонд Веронези (MG).

    Список литературы

    Ачарья, К. Д., Финкельштейн, С. Д., Блесс, Э.П., Неттлс, С. А., Мулак-Джеричевич, Б., Коннели, О. М. и др. (2015). Эстрадиол предпочтительно индуцирует рецептор прогестина-A (PR-A), а не PR-B в клетках, экспрессирующих коактиваторы ядерных рецепторов в гипоталамусе самок мышей. eNeuro 2: ENEURO.0012-15.2015. DOI: 10.1523 / ENEURO.0012-15.2015

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Андерссон Р., Гебхард К., Мигель-Эскалада И., Хоф И., Борнхольдт Дж., Бойд М. и др. (2014). Атлас активных энхансеров для разных типов клеток и тканей человека. Природа 507, 455–461. DOI: 10.1038 / nature12787

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Апостолакис, Э. М., Рамамурфи, М., Чжоу, Д., Оньяте, С., и О’Мэлли, Б. В. (2002). Острое нарушение работы выбранных коактиваторов стероидных рецепторов предотвращает репродуктивное поведение у крыс и демаскирует генетическую адаптацию у мышей с нокаутом. Мол. Эндокринол. 16, 1511–1523. DOI: 10.1210 / me.16.7.1511

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Аревало, М.-A., Azcoitia, I., и Garcia-Segura, L.M. (2015). Нейропротекторное действие рецепторов эстрадиола и эстрогенов. Nat. Rev. Neurosci. 16, 17–29. DOI: 10.1038 / nrn3856

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Барха, К. К., Галеа, Л. А. М. (2010). Влияние различных эстрогенов на нейропластичность и познание в гиппокампе. Биохим. Биофиз. Acta 1800, 1056–1067. DOI: 10.1016 / j.bbagen.2010.01.006

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Беннет, П.А., Линделл, К., Уилсон, К., Карлссон, Л. М., Карлссон, Б., и Робинсон, И. С. (1999). Циклические вариации количества рецепторов лептина, но не циркулирующего лептина, коррелируют с экспрессией NPY во время эстрального цикла. Нейроэндокринология 69, 417–423. DOI: 10.1159 / 000054444

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Чо, Дж., Ю, Н. К., Чой, Дж. Х., Сим, С. Э., Кан, С. Дж., Квак, К. и др. (2015). Множественные репрессивные механизмы в гиппокампе во время формирования памяти. Наука 350, 82–87. DOI: 10.1126 / science.aac7368

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Кутрупи, С., Ферреро, Г., Рейнери, С., Кордеро, Ф., и Де Бортоли, М. (2014). Геномная линза по транскрипции нейроглобина. IUBMB Life 66, 46–51. DOI: 10.1002 / iub.1235

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Де Маринис, Э., Аказ-Фонсека, Э., Аревало, М.А., Асченци, П., Фиоккетти, М., Марино, М., и другие. (2013a). Противовоспалительное действие 17β-эстрадиола в первичных астроцитах требует активации нейроглобина, опосредованной рецептором эстрогена b. J. Neuroendocrinol. 25, 260–270. DOI: 10.1111 / jne.12007

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Де Маринис, Э., Фиоккетти, М., Акконча, Ф., Асченци, П., и Марино, М. (2013b). Повышение регуляции нейроглобина, индуцированное 17β-эстрадиолом, секвестрирующим цитокром с в митохондриях, предотвращает индуцированный h3O2 апоптоз клеток нейробластомы. Cell Death Dis. 4: e508. DOI: 10.1038 / cddis.2013.30

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Де Маринис, Э., Асченци, П., Пеллегрини, М., Галлуццо, П., Булзоми, П., Аревало, М. А., и др. (2011). 17β-эстрадиол — новый модулятор уровня нейроглобина в нейронах: роль в нейропротекции против токсичности, вызванной h3O2. Нейросигналы 18, 223–235. DOI: 10.1159 / 000323906

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Фиоккетти, М., Камилли, Г., Акконча, Ф., Леоне, С., Асчензи, П., и Марино, М. (2015). ERβ-зависимая регуляция нейроглобина нарушает индуцированный 17β-эстрадиолом апоптоз в клетках рака толстой кишки DLD-1 при повреждении окислительным стрессом. J. Steroid Biochem. Мол. Биол. 149, 128–137. DOI: 10.1016 / j.jsbmb.2015.02.005

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Fiocchetti, M., Nuzzo, M. T., Totta, P., Acconcia, F., Ascenzi, P., and Marino, M. (2014). Нейроглобин, игрок, способствующий выживанию в α-положительных раковых клетках по рецептору эстрогена. Cell Death Dis. 5: e1449. DOI: 10.1038 / cddis.2014.418

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Фонтана Р., Делла Торре С. Д., Меда К., Лонго А., Ева К. и Магги А. С. (2015). Регуляция энергетического обмена в гипоталамусе самок мышей заместительной терапией эстрогенами. Эндокринология 155, 2213–2221. DOI: 10.1210 / en.2013-1731

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Форрест, А. Р. Р., Каваджи, Х., Рели, М., Бэйли, Дж. К., де Хун, М. Дж., Хаберле, В. и др. (2014). Атлас экспрессии у млекопитающих на уровне промотора. Природа 507, 462–470. DOI: 10.1038 / природа13182

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Крепость, А. М., Ким, Дж., Пул, Р. Л., Гулд, Т. Дж., И Фрик, К. М. (2014). 17β-Эстрадиол регулирует изменения гистонов, связанные с консолидацией памяти, и увеличивает ацетилирование промотора Bdnf у самок мышей среднего возраста. ЖЖ. Mem. 21, 457–467. DOI: 10.1101 / лм. 034033.113

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Фостер, Т. К., Рани, А., Кумар, А., Цуй, Л., и Семпл-Роуленд, С. Л. (2008). Опосредованная вирусным вектором доставка рецептора эстрогена-α в гиппокамп улучшает пространственное обучение у мышей с нокаутом рецептора эстрогена-α. Мол. Ther. 16, 1587–1593. DOI: 10.1038 / MT.2008.140

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Франк, А., Браун, Л. М., и Клегг, Д. Дж. (2014). Роль гипоталамических рецепторов эстрогена в регуляции метаболизма. Фронт. Нейроэндокринол. 35, 550–557. DOI: 10.1016 / j.yfrne.2014.05.002

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Фрик, К. М., Чжао, З., и Фань, Л. (2011). Эпигенетика эстрогенетической эпигенетической регуляции гормонально-индуцированного улучшения памяти. Эпигенетика 6, 675–680. DOI: 10.4161 / epi.6.6.16177

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Гагнидзе, К., Вейл, З. М., Фаустино, Л. К., Шаафсма, С. М., и Пфафф, Д. В. (2013). Ранние гистоновые модификации вентромедиального гипоталамуса и преоптической области после введения эстрадиола. J. Neuroendocrinol. 25, 939–955. DOI: 10.1111 / jne.12085

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Грин, К. А., Кэрролл, Дж. С. (2007). Транскрипция, опосредованная эстрогеновыми рецепторами, и влияние кофакторов и состояние хроматина. Nat. Rev. Cancer 7, 713–722.DOI: 10.1038 / nrc2211

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Ха, Н., Мураками, С., Нагари, А., Данко, К. Г., и Ли Краус, В. (2013). Транскрипты энхансеров маркируют активные сайты связывания рецепторов эстрогена. Genome Res. 23, 1210–1223. DOI: 10.1101 / gr.152306.112

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Хан, X., Энлле, К. К., Бин, Л. А., Рани, А., Семпл-Роуленд, С. Л., Кумар, А., и др. (2013). Роль рецепторов эстрогена α и β в сохранении функции гиппокампа при старении. J. Neurosci. 33, 2671–2683. DOI: 10.1523 / JNEUROSCI.4937-12.2013

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Хайнц, С., Романоски, К. Э., Беннер, К., и Гласс, К. К. (2015). Выбор и функция энхансеров, специфичных для определенного типа клеток. Nat. Rev. Mol. Cell Biol. 16, 144–154. DOI: 10.1038 / nrm3949

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Hundahl, C.A., Kelsen, J., Dewilde, S., and Hay-Schmidt, A.(2008). Нейроглобин в головном мозге крысы (II): совместная локализация с нейротрансмиттерами. Нейроэндокринология 88, 183–198. DOI: 10.1159 / 000135617

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Линделл К., Беннетт П. А., Ито Ю., Робинсон И. К. А. Ф., Карлссон Л. М. С. и Карлссон Б. (2001). 5′-нетранслируемые области рецептора лептина у крысы: относительная численность, геномная организация и связь с предполагаемыми элементами ответа. Мол. Клетка. Эндокринол. 172, 37–45. DOI: 10.1016 / s0303-7207 (00) 00382-8

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Лю, Н., Ю, З., Ли, Ю., Юань, Дж., Чжан, Дж., Сян, С. и др. (2013). Регуляция транскрипции гена нейроглобина мыши с помощью белка, связывающего циклический AMP-чувствительный элемент (CREB) в клетках N2a. Neurosci. Lett. 534, 333–337. DOI: 10.1016 / j.neulet.2012.11.025

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Лю Н., Yu, Z., Xiang, S., Zhao, S., Tjärnlund-Wolf, A., Xing, C., et al. (2012). Механизмы транскрипционной регуляции экспрессии гена нейроглобина, индуцированной гипоксией. Biochem. J. 443, 153–164. DOI: 10.1042 / BJ20111856

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Лопес, М., и Тена-Семпере, М. (2015). Эстрогены и контроль энергетического гомеостаза: взгляд на мозг. Trends Endocrinol. Метаб. 26, 411–421. DOI: 10.1016 / j.tem.2015.06.003

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Маньяни, Л., и Лупиен, М. (2014). Хроматин и эпигенетические детерминанты передачи сигналов рецептора эстрогена α (ESR1). Мол. Клетка. Эндокринол. 382, ​​633–641. DOI: 10.1016 / j.mce.2013.04.026

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Махфуз, А., Лелиевельд, Б. П. Ф., Грефхорст, А., Ван Верт, Л. Т. К. М., и Мол, И. М. (2016). Полногеномная коэкспрессия стероидных рецепторов в мозге мышей: идентификация сигнальных путей и функционально скоординированных областей. Proc. Natl. Акад. Sci. U S A 113, 2738–2743. DOI: 10.1073 / pnas.1520376113

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Métivier, R., Penot, G., Hübner, M. R., Reid, G., Brand, H., Kos, M., et al. (2003). Рецептор эстрогена-α управляет упорядоченным, циклическим и комбинаторным набором кофакторов на природном промоторе-мишени. Cell 115, 751–763. DOI: 10.1016 / s0092-8674 (03) 00934-6

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Пеллетье, Г., Ли, С., Луу-Те, В., и Лабри, Ф. (2007). Эстрогенная регуляция проопиомеланокортина, нейропептида Y и мРНК кортикотропин-рилизинг-гормона в гипоталамусе мышей. J. Neuroendocrinol. 19, 426–431. DOI: 10.1111 / j.1365-2826.2007.01548.x

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Райда, З., Хундал, К. А., Ньенгаард, Дж. Р., и Хей-Шмидт, А. (2013). Нейроглобин у мышей с повышенной экспрессией: характер экспрессии и влияние на размер ишемического инфаркта головного мозга. PLoS One 8: e76565. DOI: 10.1371 / journal.pone.0076565

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Сил, М., Уппал, С., Кунду, С., и Дей, С. Г. (2015). Взаимодействие апо-нейроглобина с комплексами гем-Aα, связанными с болезнью Альцгеймера. J. Biol. Неорг. Chem. 20, 563–574. DOI: 10.1007 / s00775-015-1241-y

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Северин, Дж., Лизио, М., Харшбаргер, Дж., Кавадзи, Х., Дауб С.О., Хаяшизаки Ю. и др. (2014). Интерактивная визуализация и анализ крупномасштабных наборов данных секвенирования с использованием ZENBU. Nat. Biotechnol. 32, 217–219. DOI: 10.1038 / NBT.2840

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Сунь Ф., Мао X., Се Л., Гринберг Д. А. и Цзинь К. (2013). Белок нейроглобина активируется при болезни Альцгеймера. J. Alzheimers Dis. 36, 659–663. DOI: 10.3233 / JAD-130323

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Ван, К., Zhang, F., Jiang, S., Siedlak, S.L., Shen, L., Perry, G., et al. (2016). Рецептор эстрогена-α локализован в нейрофибриллярных клубках при болезни Альцгеймера. Sci. Реп. 6: 20352. DOI: 10.1038 / srep20352

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Велборен, У. Дж., Свип, Ф. К. Дж., Спан, П. Н., Стунненберг, Х. Г. (2009). Геномное действие рецептора эстрогена α: каковы цели и как они регулируются? Endocr. Relat. Рак 16, 1073–1089.DOI: 10.1677 / ERC-09-0086

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Ю, З., Лю, Н., Лю, Дж., Ян, К., и Ван, X. (2012). Нейроглобин — новая мишень для эндогенной нейропротекции от инсульта и нейродегенеративных расстройств. Внутр. J. Mol. Sci. 13, 6995–7014. DOI: 10.3390 / ijms13066995

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Zhang, W., Tian, ​​Z., Sha, S., Cheng, L.Y.L., Philipsen, S., и Tan-Un, K.-C. (2011). Функциональный анализ и анализ последовательности промоторной области гена нейроглобина человека. Биохим. Биофиз. Acta 1809, 236–244. DOI: 10.1016 / j.bbagrm.2011.02.003

    CrossRef Полный текст | Google Scholar

    Чжао, З., Фан, Л., Фортресс, А. М., Боулвар, М. И., и Фрик, К. М. (2012). Ацетилирование гистонов в гиппокампе регулирует распознавание объектов и усиление распознавания объектов, вызванное эстрадиолом. J. Neurosci. 32, 2344–2351. DOI: 10.1523 / JNEUROSCI.5819-11.2012

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Чжао, З., Фан, Л., Фрик, К. М. (2010). Эпигенетические изменения регулируют усиление консолидации памяти, вызванное эстрадиолом. Proc. Natl. Акад. Sci. U S A 107, 5605–5610. DOI: 10.1073 / pnas.08107

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Wechseljahre von Eveline Daub-Amend portofrei bei bücher.de bestellen

    Wechseljahre von Eveline Daub-Amend portofrei bei bücher.де Бестеллен

    Jeder Wechsel ist auch eine Veränderung — und dadurch gleichsam eine neue Chance. Für Frauen, bei denen sich die Wechseljahre ankündigen, werden die Symptome des Älterwerdens und der Verlust der Fruchtbarkeit oft zu Auslösern einer Lebens- und Identitätskrise. Dass aber eben auch Chancen und Möglichkeiten in diesem Wechsel liegen, zeigt Eveline Daub-Amend in ihrem nun überarbeiteten und erweiterten Ratgeber, der natürliche Wege zur Behandlung beinhaltet und zudem den Verchenseung die seigt.… Mehr

    Andere Kunden interessierten sich auch für

    Jeder Wechsel ist auch eine Veränderung — und dadurch gleichsam eine neue Chance. Für Frauen, bei denen sich die Wechseljahre ankündigen, werden die Symptome des Älterwerdens und der Verlust der Fruchtbarkeit oft zu Auslösern einer Lebens- und Identitätskrise. Dass aber eben auch Chancen und Möglichkeiten in diesem Wechsel liegen, zeigt Eveline Daub-Amend in ihrem nun überarbeiteten und erweiterten Ratgeber, der natürliche Wege zur Behandlung beinhaltet und zudem den Verchenseung die seigt.

    Подробная информация о продукте

    • Aethera
    • Verlag: Freies Geistesleben
    • 4. Aufl.
    • Seitenzahl: 160
    • Erscheinungstermin: Oktober 2006
    • Deutsch
    • Abmessung: 215 мм x 160 мм x 11 мм
    • Gewicht: 376g
    • ISBN-13: 9783772550416
    • ISBN-

      : 9783772550416

    • ISBN:

    • ISBN Schreiben Sie eine Kundenbewertung zu diesem Produkt und gewinnen Sie mit etwas Glück einen 15, — EUR bücher.де – Гутшейн!

      3 Marktplatz-Angebote für «Wechseljahre» ab 4,30 €

    miРНК

    ВЗАИМОДЕЙСТВИЕ

    miR-7a

    ДА
    ( F (6,57) = 7.065, p <0,0001)

    miR-9

    ДА
    ( F (6,57) = 4,824, p <0,0001)

    9493
    9493
    9493

    НЕТ

    miR-125a

    ДА
    ( F (6,57) = 4,077, p = 0,002)

    03

    ДА
    ( F (6,57) = 14.832, p <0,0001)

    miR-495

    ДА
    ( F (6,57) = 3,958, p = 0,002)

    Zustand Preis Porto Zahlung Verkäufer Рейтинг кишки

    4,57

    4,57 €

    3,00

    3,00 €

    PayPal diakonia Dienstleistungsbetriebe GmbH 99,8% gebrau50 Angebot 905 ; кишка

    4,89

    4,89 €

    3,00

    3,00 €

    Banküberweisung ровная звезда 100,0% Zum Angeubot 905uretebra

    4,30

    4,30 €

    2,20

    2,20 €

    Selbstabholung und Barzahlung, PayPal, Offene Rechnung Förderverein Bücherei Eilfingen.V. 100,0% Zum Angebot

    Es gelten unsere Allgemeinen Geschäftsbedingungen: www.buecher.de/agb

    Выходные данные

    www.

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *