Множественные фолликулы в яичниках: Основные признаки мультифолликулярных яичников (МФЯ) – информация для пациентов

Содержание

множественные фолликулы в яичниках — 25 рекомендаций на Babyblog.ru

Добрый день, меня направляют на гистероскопию с целью удалить миомы в матке перед очередным ЭКО. Было несколько искусственных инсеминаций, один забор яйцеклеток (8 взяли, 3 эмбриона), пока безрезультатно. Я живу в Нидерландах, здесь ничего пациенту не говорят, просто направили на удаление миом, диагностированных по узи с водой. В прошлом году было то же самое (узи, гистероскопия), сказали, что ничего не нашли. Теперь другой доктор хочет провести ту же операцию, но я уже как-то сомневаюсь в их компетенции. Сделала 8 мая МРТ органов малого таза в Киеве. Результат ниже. Я публикую перевод с украинского, так что не обращайте внимание на мелкие ошибки. Завтра у меня предоперационная встреча с моим доктором. Хотелось бы услышать мнение тех, кто сталкивался с таким, так как здешние врачи на моей памяти искалечили уже нескольких моих знакомых. Боюсь страшно. Спасибо за отклик заранее. Поддержите просто. Пишу и рыдаю. —————————————————————— Нативное МР сканирования выполнено в корональной проекции в отводе Т1, в аксиальной, корональной и сагиттальной проекции в отводе Т2, в аксиальной проекции в отведениях T2- SPAIR, Т1 SPIR, DWI. МР сканирование с внутривенным контрастированием выполнено в аксиальной проекции в отведениях e-Thrive и Wave-post. В области маточно-прямокишечного углубление слева, широко прилегающие к заднебоковой стенки матки визуализируется без четких контуров, неправильной формы, солидный образование, гипоинтенсивное на Т2-ЗЗ, содержащее ячейки резко гиперинтенсивные на Т1-fs, неравномерно накапливает контрастное вещество, условным размером 22х9мм ( эндометриоз с преобладанием фиброзного компонента). Петля сигмовидной кишки локально подпаяна к описанному образованию, с признаками локального контактного распространения эндометриоза на стенку кишки. По ходу капсулы левого Яичника и в меньшей степени правого яичника, по ходу брюшины слева на уровне левой наружной подвздошной артерии, а также в области пузырно-маточного углубления справа визуализируются множественные подобные ячейки гиперинтенсивные на Т1-fs, размером 2-14мм. Матка в положении anteflexio, размером 41х59х98мм. В области тела и дна матки визуализируются множественные интрамуральные и субмукозные миомы, диаметром 13-34мм. В области задней и левой боковой стенки визуализируются единичные субсерозные лейомиомы, диаметром 14мм и 36мм соответственно. Лейомимы неравномерно накапливают контрастное вещество. Единичная лейомиома в области правого угла матки содержит ячейку кистозной дегенерации. Стенки матки неравномерные по утолщенные. Дифференциация между переходной зоной и миометрия сохранена. Эндометрий характеризуется относительно однородным МР сигналом. Полость матки резко деформирована за счет лейомиом. Цервикальный канал обычной формы, не расширен. Субмукозно, в стенках шейки матки визуализируются множественные Наботовые кисты диаметром 3-8мм. Правый и левый яичник с относительно четкими контурами, в размере не увеличены, в паренхиме визуализируются фолликулы диаметром 3-10мм. В левом яичнике визуализируется единичный фолликул, диаметром 30мм. Мочевой пузырь обычной формы, с четкими внешними контурами. Стенки пузыря не утолщены. Дополнительные новообразования в его полости не визуализируются. Прямая кишка с четкими контурами. Стенки не утолщены, равномерно накапливают контрастное вещество. Лимфоузлы малого таза и паховые лимфоузлы в умеренном количестве, в размерах не увеличены. Костно-деструктивных изменений не выявлено. В теле правой подвздошной кости визуализируется островок компактной кости, диаметром 15мм. Вывод: МР признаки распространенного внешнегенитального эндометриоза с вовлечением в процесс сигмовидной кишки (см описание), множественные лейомиомы матки.

Поликистоз яичников фото | Курортная клиника женского здоровья

Поликистоз яичников, спкя, пкя, синдром поликистозных яичников, диагностика спкя, поликистозные яичники фото, пкя фото — все это Вы можете увидеть в Фотогалерее Поликистозные яичники.

Фото поликистозного яичника девушки 22 лет. Стрелками указаны множественные мелкие фолликулы

3D-фото склерополикистозного яичника. Определяется плотная белочная оболочка и единичный фолликул

3D-фото яичника женщины 35 лет. Снижение овариального резерва — определяется 7 фолликулов в срезе

Фото поликистозного яичника. Причудливое изображение яичника

Фото поликистозных яичников девушки 19 лет

Фото поликистозных яичников. На 10 — й день менструального цикла по периферии яичника определяются множественные фолликулы 3-6 мм в диаметре

Фото поликистозного правого яичника. На 15 день менструального цикла определяется множество фолликулов 4-9 мм в диаметре. Доминантный фолликул отсутствует

Фото пкя. Поликистозный яичник у девушки 23 лет до лечения в нашей Клинике

Диагностика спкя. Множественные мелкие фолликулы («кисты») указаны стрелками

Обратите внимание на превосходное качество фотографий, сделанных на наших аппаратах.

Фото поликистозных яичников, выполненные нами, Вы можете встретить на многих российских и зарубежных сайтах.

Ведущие специалисты по бесконтактному лечению эрозии Южного Федерального Округа

Ермолаева Эльвира Кадировна
Является известным и признанным на Северном Кавказе специалистом по лечению поликистозных яичниковГинеколог, физиотерапевт-курортолог, врач ультразвуковой диагностики Щепкин Пётр Сергеевич
Опытный врач гинеколог, специалист по диагностике и лечению поликистоза яичников и женского бесплодияВрач ультразвуковой диагностикиК нему обращаются уставшие от длительного обследования и неэффективного лечения поликистоза яичников Ермолаев Олег Юрьевич
Кандидат медицинских наук гинеколог-эндокринолог, оперирующий гинеколог с 25-летним успешным опытом лечения поликистозных яичниковСпособен видеть взаимосвязи, которые ускользают от остальных


МЕЖДУНАРОДНЫМ ПРИЗНАНИЕМ репутации и достижений Курортной клиники женского здоровья в разработке и внедрении эффективных и безопасных лечебных методик и качества предоставляемых медицинских услуг ЯВЛЯЕТСЯ НАГРАЖДЕНИЕ Курортной клиники женского здоровья в Пятигорске Международным СЕРТИФИКАТОМ КАЧЕСТВА SIQS в сфере медицины и здравоохранения. Международный Сократовский Комитет, Оксфорд, Великобритания и Швейцарский институт стандартов качества, Цюрих, ШВЕЙЦАРИЯ. Подробнее…

Мы работаем без выходных и праздничных дней:

понедельник — пятница с 8.00 до 20.00,
суббота — воскресенье с 8.00 до 17.00.

Лечение поликистоза яичников в Пятигорске по предварительной записи по многоканальному телефону 8 (800) 500-52-74 (звонок по России бесплатный), или +7 (928) 022-05-32 (для зарубежных звонков).

Задать ВОПРОС ОНЛАЙН врачу гинекологу в Пятигорске можно по адресу [email protected]

ЗАПИШИТЕСЬ ОНЛАЙН на прием к опытному гинекологу в Пятигорске здесь.

С возрастом ты перестаешь получать удовольствие от многих вещей: одежды, путешествий, ресторанов, косметики, машин.

Только созерцание своего ЧАДА никогда не надоест.

ВАЖНО начать двигаться в правильном направлении!

ВСЁ, что нужно знать о правильном направлении в лечении поликистоза яичников, смотри ЗДЕСЬ:

С уважением к вероисповеданию и различным привычкам наших пациенток мы достигаем высокой эффективности и комфортности лечения.

Мы в ПОЛНОМ вашем РАСПОРЯЖЕНИИ при возникновении любых сомнений или пожеланий.

Наши дети

Что такое поликистоз яичников и как его лечить

Если вы обнаружите его у себя, ничего странного. Синдром поликистозных яичников — самое распространённое эндокринное нарушение у женщин от 15 до 44 лет.

По некоторым данным, им страдают до 26,7% всех женщин репродуктивного возраста — то есть каждая четвёртая.

Часто женщины даже не догадываются о существующем сбое в работе их организма и списывают его побочные эффекты — от угревой болезни до невозможности забеременеть — на личную «невезучесть». Но поликистоз яичников — то, что можно и нужно вовремя распознать и скорректировать.

Что такое поликистоз яичников

Чтобы разобраться, что это за нарушение, начнём с анатомии.

Яичники — это парные железы, расположенные по обе стороны от матки. В них созревают и хранятся женские половые клетки (яйцеклетки). Кроме того, яичники выполняют и эндокринную функцию: в них синтезируются, чтобы затем отправиться в кровоток, половые гормоны. Это очень сложные и точные процессы. Но иногда в них случается сбой.

При поликистозе яичников выработка гормонов и созревание яйцеклеток нарушаются. Яичники начинают производить больше андрогенов — мужских половых гормонов. А яйцеклетки не успевают вызреть и нередко не высвобождаются во время овуляции, как должно быть, а остаются в яичниках внутри собственной оболочки — фолликула.

Месяц за месяцем фолликулы с недозревшими яйцеклетками — «мешочки» диаметром около 8 мм — накапливаются в яичниках. Так образуются множественные кисты.

Каковы симптомы поликистоза яичников

Нарушения в процессе созревания яйцеклеток и гормональные сбои, как правило, дают о себе знать следующими признаками:

  • Нерегулярные месячные или их отсутствие.
  • Тянущие боли во время месячных, если те наступают. Также возможны более сильные кровотечения, чем обычно.
  • Невозможность забеременеть. Это естественно при отсутствии или нарушениях овуляции.
  • Появление волос там, где их у женщин не должно быть. Заметные усики над верхней губой, излишнее оволосение груди, спины, ягодиц, внутренней стороны бёдер — так даёт о себе знать избыток андрогенов.
  • Выпадение волос на голове. Речь об эдаком облысении по мужскому типу.
  • Лишний вес. Он нередко сопровождает гормональные сбои.
  • Появление угрей на лице и других частях тела.

Чем опасен поликистоз яичников

С возрастом эндокринные нарушения усугубляются и могут приводить к куда более неприятным последствиям для здоровья, нежели акне или задержка месячных. Вот лишь некоторые возможные осложнения:

  • повышенный уровень холестерина;
  • развитие диабета 2-го типа;
  • депрессия;
  • если вам всё же удастся забеременеть, может развиться гестоз — осложнение, сопровождающееся повышенным давлением, отёками, появлением белка в моче и угрожающее жизни и плода, и матери, или случиться выкидыш;
  • расстройства пищевого поведения;
  • апноэ — остановки дыхания во сне;
  • неалкогольный стеатогепатит — тяжёлое воспаление печени, вызванное накоплением жира в этом органе;
  • аномальные маточные кровотечения;
  • рак слизистой оболочки матки (эндометрия).

Откуда берётся поликистоз яичников

Точные причины, почему у одних женщин развивается этот эндокринный сбой, а другие никогда с ним не сталкиваются, на сегодня неизвестны. Есть только предположения. Так, возможно, определённую роль в появлении кист в яичниках играют следующие факторы.

1. Избыток инсулина

Инсулин — это гормон, который контролирует уровень сахара в организме. Но он тесно связан и с другими гормонами. Если по каким-то причинам инсулина в крови становится больше, увеличивается и выработка андрогенов. А это, в свою очередь, вызывает сбои в овуляции и провоцирует развитие синдрома поликистозных яичников.

2. Избыток андрогенов

Яичники, которые по разным причинам вырабатывают слишком много мужских гормонов, более подвержены появлению кист.

3. Наследственность

Нередко поликистоз яичников — семейная проблема, которая передаётся от матери к дочери или от бабушки к внучке. Какой-то конкретный ген, связанный с данным синдромом, пока не обнаружили. Предполагается, что их может быть несколько.

4. Хронические воспаления

Речь о вялотекущих воспалительных процессах в организме, которые заставляют иммунную систему постоянно находиться в состоянии боевой готовности. Причиной таких процессов могут быть хронические заболевания, лишний вес, затяжной стресс и даже частые простуды. Подобные воспаления сопровождаются повышением уровня андрогенов со всеми вытекающими.

Как лечить поликистоз яичников

Если вы обнаружили у себя хотя бы 2–3 из перечисленных выше симптомов, обязательно загляните к гинекологу. Врач выслушает ваши жалобы, проведёт осмотр. Возможно, понадобится сделать УЗИ и сдать анализ крови. Всё это поможет установить точный диагноз.

Если речь действительно идёт о синдроме поликистозных яичников, специалист назначит лекарственные препараты. Это могут быть:

  • оральные контрацептивы — чтобы наладить менструальный цикл;
  • гормональные средства — чтобы снизить уровень андрогенов или инсулина;
  • препараты, которые блокируют влияние андрогенов на кожу, что актуально в случае выраженного акне;
  • средства от бесплодия — если вы хотите забеременеть.

Может потребоваться и небольшая хирургическая операция, которая позволит восстановить овуляцию.

Кроме того, врач порекомендует вам внести некоторые изменения в образ жизни:

  • Скорректировать питание. В частности, ограничить простые углеводы — сладкое, магазинную выпечку, полуфабрикаты. Такие продукты приводят к повышению уровня инсулина в крови.
  • Больше двигаться. Во-первых, регулярные физические нагрузки косвенно снижают уровень инсулина. Во-вторых, они помогают контролировать лишний вес, который может быть одним из провокаторов внутреннего воспаления и, как следствие, развития поликистоза яичников.
  • Меньше нервничать. Стресс тоже способен приводить к хроническому воспалению.
  • Спать не менее 8 часов в сутки. Это вообще универсальный совет.

Читайте также 🌺❤👩‍⚕️

лечение, диагностика, причины, симптомы — 8(495)120-02-05

Консультации Главного врача
Расширенная консультация главного врача 7000,00
Консультация акушера гинеколога первичная (кмн Херсонская Е.Б.) 6500,00
Консультация акушера-гинеколога 4 группы (кмн Херсонская Е.Б.) 6000,00
Консультация главного врача по кррекции назначенного лечения (кмн Херсонская Е.Б.) 2500,00
Дистанционная консультация врача по коррекции назначенного лечения 1500,00
Дистанционная консультация врача 3000,00
Консультация CITO (в неприемные дни) 9000,00
Консультации
Консультация акушера-гинеколога 2 группы 3500,00
Консультация акушера-гинеколога 3 группы (д-р Фотина Е.В.) 4000,00
Консультация первичная акушера-гинеколога 3 группы (д-р Фотина Е.В.) 4500,00
Дистанционная консультация акушера-гинеколога 3 группы (д-р Фотина Е.В.) 1000,00
Консультация акушера-гинеколога (заслуженный врач РФ Иванова Н.В., профессор Панина О.Б.) 8000,00
Консультация врача по коррекции назначенного лечения 2000,00
Консультация гинеколога-репродуктолога первичная 3500,00
Консультация гинеколога-репродуктолога повторная 3000,00
Консультация гинеколога-репродуктолога и УЗИ с целью оценки овариального резерва 4500,00
Консультация гинеколога-репродуктолога расширенная и УЗИ с целью оценки овариального резерва 5500,00
Консультация акушера гинеколога (д-р Егорова А.А., Муравина Е.Л.) 4000,00
Консультация гинеколога-эстетиста 4500,00
Акушерские инвазии
Амниотест (тест на подтекание околоплодных вод) 800,00
Амниотест Amnisure (экспресс-тест) 4000,00
Тест на беременность 1000,00
Введение разгружающего акушерского пессария (без стоимости пессария) 2500,00
Удаление разгружающего акушерского пессария (без стоимости пессария) 2500,00
Гинекологические процедуры
Забор гинекологического мазка I степень сложности 500,00
Забор гинекологического мазка II степень сложности 1000,00
Забор гинекологического мазка III степень сложности 1900,00
Процедура в гинекологическом кабинете I степень сложности 700,00
Процедура в гинекологическом кабинете II степень сложности 1700,00
Процедура в гинекологическом кабинете III степень сложности 2700,00
Кольпоскопия (видеокольпоскопия) 3000,00
Кольпоскопия (видеокольпоскопия) расширенная 4500,00
Введение внутриматочных противозачаточных средств (без стоимости спирали) 2700,00
Введение внутриматочных противозачаточных средств II степень сложности (без стоимости спирали) 4500,00
Извлечение внутриматочных противозачаточных средств (спирали) 1200,00
Извлечение внутриматочных противозачаточных средств (спирали) II степень сложности 1700,00
Постановка/удаление контрацептивного кольца (без стоимости кольца) 800,00
Постановка/удаление контрацептивного кольца (без стоимости кольца) II степень сложности 1100,00
Удаление инородного тела из влагалища 1000,00
Удаление инородного тела из влагалища II степень сложности 1500,00
Радиоволновое удаление единичных (до 3 ед.) кондилом или папиллом женских половых органов 2000,00
Радиоволновое удаление множественных (более 3 ед.) кондилом или папиллом женских половых органов 4000,00
Лечение патологии шейки матки радиоволновым методом (аппарат Сургитрон) I степень сложности 7000,00
Лечение патологии шейки матки радиоволновым методом (аппарат Сургитрон) II степень сложности 12000,00
Лечение патологии шейки матки радиоволновым методом (аппарат Сургитрон) III степень сложности 19000,00
Криогенное удаление единичных кондилом или папиллом женских половых органов (до 5 ед.) (стоимость азота включена) 2000,00
Криогенное удаление множественных кондилом или папиллом женских половых органов (до 10 ед.) (стоимость азота включена) 3000,00
Химическое удаление единичных кондилом или папиллом женских половых органов (до 5 ед.) 1000,00
Химическое удаление множественных кондилом или папиллом женских половых органов (до 10 ед.) 2000,00
Химическая деструкция патологии шейки матки (лечение заболеваний шейки матки солковагином) 2500,00
Вскрытие наботовых кист шейки матки 2000,00
Вскрытие наботовых кист шейки матки II степень сложности 3000,00
Гистеросонография 10000,00
Гистеросонография II степень сложности 13000,00
Аспирация содержимого матки 3200,00
Аспирация содержимого матки II степень сложности 4700,00
Установка акушерского пессария Арабин 7500,00
Аспирационная биопсия эндометрия (Пайпель-биопсия) 3500,00
Аспирационная биопсия эндометрия (Пайпель-биопсия) II степень сложности 4900,00
Петлевая биопсия шейки матки (1 позиция) с использованием аппарата Сургитрон 2700,00
Петлевая биопсия шейки матки (1 позиция) II степень сложности с использованием аппарата Сургитрон 3300,00
Выскабливание цервикального канала 2200,00
Выскабливание цервикального канала II степень сложности 3200,00
Выскабливание цервикального канала + петлевая биопсия шейки матки с использованием аппарата Сургитрон 7000,00
Выскабливание цервикального канала + петлевая биопсия шейки матки с использованием аппарата Сургитрон II степень сложности 10000,00
Выскабливание цервикального канала + петлевая биопсия шейки матки с использованием аппарата Сургитрон III степень сложности 15000,00
Гистероскопия, раздельное диагностическое выскабливание 16000,00
Гистероскопия, раздельное диагностическое выскабливание II степень сложности 19500,00
Гистероскопия, раздельное диагностическое выскабливание, удаление ВМС 18000,00
Гистероскопия, раздельное диагностическое выскабливание, удаление ВМС II степень сложности 25500,00
Гистероскопия, раздельное диагностическое выскабливание, петлевая биопсия шейки матки 18000,00
Гистероскопия, раздельное диагностическое выскабливание, петлевая биопсия шейки матки II степень сложности 27000,00
Гистероскопия, раздельное диагностическое выскабливание, полипэктомия 20000,00
Гистероскопия, раздельное диагностическое выскабливание, полипэктомия II степень сложности 27500,00
Гистероскопия, рассечение внутриматочных синехий 25000,00
Гистероскопия, рассечение внутриматочных синехий II степень сложности 37500,00
Выскабливание цервикального канала, удаление полипа цервикального канала 10000,00
Выскабливание цервикального канала, удаление полипа цервикального канала II степень сложности 15000,00
Инструментальное удаление ВМС 6000,00
Инструментальное удаление ВМС II степень сложности 9000,00
Конизация шейки матки 22000,00
Конизация шейки матки II степень сложности 25000,00
Операции на бартолиновой железе (марсупиализация, удаление бартолиновой железы) 15000,00
Операции на бартолиновой железе (марсупиализация, удаление бартолиновой железы) II степень сложности 22500,00
Снятие швов с шейки матки 3000,00
Снятие швов с шейки матки II степень сложности 4500,00
Снятие скобок после кесарева сечения I категории сложности 2500,00
Снятие скобок после кесарева сечения II категории сложности 3500,00
Снятие швов I категории сложности 3000,00
Снятие швов II категории сложности 4500,00
Цервикоскопия II степень сложности 12000,00
Цервикоскопия+выскабливание цервикального канала 18000,00
Цервикоскопия+выскабливание цервикального канала II степень сложности 15000,00
Полипэктомия II степень сложности 9000,00
Удаление образования влагалища 15000,00
Удаление новообразоания малой половой губы 15000,00
Удаление новообразоания малой половой губы II категории сложности 25000,00
Контурная пластика филлерами на основе гиалуроновой кислоты 3 мл 40000,00

Кузьмина С.А. • Ультразвуковая диагностика синдрома гиперандрогении

УЗИ аппарат HM70A

Экспертный класс по доступной цене. Монокристальные датчики, полноэкранный режим отображения, эластография, 3D/4D в корпусе ноутбука. Гибкая трансформация в стационарный сканер при наличии тележки.

Введение

Синдром гиперандрогении представляет собой патологическое состояние, обусловленное действием избыточной секреции андрогенов на органы и ткани-мишени, и является актуальной проблемой в эндокринной гинекологии [2,3,7-9]. Особая значимость этой патологии обусловлена нарушением репродуктивной функции большинства больных и онкологическими аспектами [2,3,8]. В зависимости от источника гиперандрогении выделяют овариальную, надпочечниковую, центральную формы cиндрома гиперандрогении [9].

Диагностика cиндрома гиперандрогении сложна; она включает клиническое, гормональное обследование, эхографию и морфологическое исследование [2-4,7,16,17]. Приоритетным направлением является применение высокоинформативных, доступных, неинвазивных методов, к которым относится эхография [12-17]. Внедрение ультразвуковых сканеров с высокой разрешающей способностью и трансвагинальный доступ расширили возможности исследования, приближая данный метод к морфологическому [4-6,10,11,18,19].

Так как при cиндроме гиперандрогении изменениям чаще всего подвергаются яичники, целью настоящей работы стала оценка эхографической структуры яичников при овариальной, надпочечниковой и центральной формах гиперандрогении.

Материалы и методы

Обследованы 159 больных с cиндромом гиперандрогении и 80 здоровых женщин (контрольная группа) в возрасте 18-30 лет. Численный состав больных в зависимости от формы гиперандрогении распределился следующим образом: овариальная гиперандрогения — 51 женщина; надпочечниковая гиперандрогения — 52, и центральная форма — 56 женщин.

Больным проводилось комплексное обследование, включающее общеклинические, гормональные, эхографические и морфологические методы, на основании чего определялась форма cиндрома гиперандрогении. Ультразвуковое исследование выполнялось на современных ультразвуковых аппаратах трансабдоминальным конвексным датчиком частотой 5 МГц и трансвагинальными датчиками частотой 7,5 МГц и 5 МГц. Сканирование осуществлялось в режиме реального времени в раннюю фолликулярную фазу менструального цикла или на фоне аменореи. Структура яичников изучалась по следующим показателям: определение объема яичников, объема стромы, коэффициента отношения объема яичника к объему стромы; оценка эхогенности стромы; расположение, количество и диаметр фолликулов в яичниках; исследование состояния капсулы яичников.

Объем яичников и объем стромы определялся путем обвода объекта, заложенного в функцию ультразвуковых сканеров и автоматически выводимого на экране (рис. 1). Этот способ позволяет определить объем органа с любой поверхностью, в том числе и неровной, что особенно важно для определения объема овариальной стромы. Объем яичников расценивался как увеличенный, если он превышал 8 см³. Средняя эхогенность стромы, сопоставимая с эхогенностью миометрия, считалась нормальной.

Рис. 1. Определение объема яичника и объема его стромы методом обвода.

Однако абсолютные значения объема стромы малоинформативны, важно знать, какую часть объема яичника она составляет в каждом конкретном случае. В связи с этим мы предложили вычислять коэффициент отношения объема яичника к объему стромы по формуле: К = объем яичника /объем стромы.

Количество фолликулов, подсчитанное в продольной плоскости сканирования и превышающее 15, расценивалось как патологическое. Их размер определялся на 5 — 7 день менструального цикла и считался нормальным при диаметре не более 8 мм и периферическом их расположении. Капсула яичников в норме не визуализировалась. Полученные результаты подвергнуты компьютерному статистическому анализу.

Результаты

Эхографическое исследование яичников показало различия между здоровыми и больными женщинами, а что касается последних — различия в зависимости от формы гиперандрогении. У пациенток с овариальной гиперандрогенией наблюдался периферический тип поликистозных яичников с двухсторонним их симметричным увеличением и множественными мелкими фолликулами количеством 16±4 и диаметром 6±2мм в их структуре (рис. 2).

Рис. 2 (а,б). Эхографическая картина яичника при овариальной гиперандрогении.

Фолликулы располагались в периферическом кортикальном слое яичников. Строма занимала центральную часть яичника, была утолщена, ее эхогенность повышена за счет гиперэхогенных включений. Объем стромы составил 6,6±0,7см³, коэффициент отношения объема яичника к объему стромы — 2,2±1,0. Капсула яичников визуализировалась у 15 (29,4%) больных. Эхографическая структура яичников у пациенток при овариальной гиперандрогении по сравнению с женщинами контрольной группы представлена в табл. 1.

Таблица 1. Эхографическая структура яичников у больных с овариальной гиперандрогенией и у здоровых женщин.

Показатель Здоровые,
n=80
Овариальная гиперандрогения,
n=51
Объем яичников, см³ 6,6 ± 1,4 17,7 ± 6
р
Объем стромы, см³ 1,5 ± 0,8 6,6 ± 0,7
р
Коэффициент отношения объема яичника к объему стромы 4,4 ± 1,1 2,2 ± 1
р
Количество фолликулов 8 ± 2 16 ± 4
р
Расположение фолликулов По периферии в кортикальном слое По периферии в кортикальном слое
Диаметр фолликулов, мм 6 ± 2 6 ± 2
Капсула Не визуализируется Визуализируется в 29,4%

Примечание: р — достоверность различий.

У больных центральной формой cиндрома гиперандрогении обнаружен диффузный тип поликистозных яичников, при котором в увеличенных яичниках множественные фолликулы количеством 22±3 располагались по всему объему как в периферическом слое, так и в центральной строме (рис. 3 а,б).


Рис. 3 (а,б). Эхографическая картина яичника при центральной форме cиндрома гиперандрогении.

Причем в периферических отделах яичников фолликулы определялись большего диаметра — 8±2 мм, чем в центральной строме — 4±2 мм. Строма визулизировалась утолщенной, средней эхогенности, с множественными фолликулярными структурами. В связи с наличием в строме фолликулов вычисление ее истинного объема, а также коэффициента отношения объема яичника к объему стромы не представлялось возможным. Капсула яичников не определялась. В табл. 2 приведена структура яичников у пациенток с центральной формой cиндрома гиперандрогении по сравнению с женщинам контрольной группы.

Таблица 2. Эхографическая структура яичников у больных с центральной формой cиндрома гиперандрогении и у здоровых женщин.

Показатель Здоровые,
n=80
Центральная форма cиндрома гиперандрогении,
n=56
Объем яичников, см³ 6,6 ± 1,4 22,1 ± 1
р
Объем стромы, см³ 1,5 ± 0,8 Не определялся
Коэффициент отношения объема яичника к объему стромы 4,4 ± 1,1 Не определялся
Количество фолликулов 8 ± 2 20 ± 2
р
Расположение фолликулов По периферии в кортикальном слое Диффузно, по перифериии в строме
Диаметр фолликулов, мм 6 ± 2 8 ± 2 в периферическом слое и 4 ± 1 в строме
р
Капсула Не визуализируется Не визуализируется

Примечание: р — достоверность различий.

У больных надпочечниковой гиперандрогенией объем яичников составил 8,1±1 см³. Фолликулы количеством 8±2, диаметром 6±2мм располагались в периферическом слое яичников (рис. 4).

Рис. 4. Эхографическая картина яичника при надпочечниковой гиперандрогении.

Центрально расположенная строма имела объем 1,95±0,5 см³, не отличающийся от нормы, с коэффициентом отношения объема яичника к объему стромы 4,3±0,5. В наших наблюдениях при надпочечниковой гиперандрогении поликистозных изменений в яичниках не обнаружено. Эхографическая структура яичников у больных надпочечниковой гиперандрогенией и в контрольной группе дана в табл. 3.

Таблица 3. Эхографическая структура яичников у больных надпочечниковой гиперандрогенией и у здоровых женщин.

Показатель Здоровые,
n=80
Больные с надпочечниковой формой гиперандрогении,
n=52
Объем яичников, см³ 6,6 ± 1,4 8,1 ± 1,0
р
Объем стромы, см³ 1,5 ± 0,8 1,95 ± 0,5
р > 0,05
Коэффициент отношения объема яичника к объему стромы 4,4 ± 1,1 4,3 ± 0,5
р > 0,05
Количество фолликулов 8 ± 2 8 ± 2
р > 0,05
Расположение фолликулов По периферии в кортикальном слое По перифериив кортикальном слое
Диаметр фолликулов, мм 6 ± 2 6 ± 2
р > 0,05
Капсула Не визуализируется Не визуализируется

Примечание: р — достоверность различий.

Объем яичников при данной форме гиперандрогении был больше, чем в контрольной группе (р

Таблица 4. Сравнение эхографической структуры яичников у больных с разными формами cиндрома гиперандрогении.

Гиперандрогения
показатели овариальная центральная форма надпочечниковая достоверность различий
Объем яичников, см³ 17,7 ± 6 22,1 ± 1 8,1 ± 1,0 р р1 р2
Объем стромы, см³ 6,6 ± 0,7 Не определялся 1,95 ± 0,5 р2
Коэффициент «объем яичника/объем стромы» 2,2 ± 1,0 Не определялся 4,3 ± 0,5 р2
Количество фолликулов 16 ± 4 20 ± 2 8 ± 2 p р1 р2
Расположение фолликулов По периферии Диффузное По периферии
Диаметр фолликулов, мм 6 ± 2 8 ± 2 по периферии и 4 ± 1 в строме 6 ± 2 р р1 р2 > 0,05
Капсула Визуализируется в 29,4% Не визуализируется Не визуализируется

Примечание: р — достоверность различий между овариальной и центральной формами гиперандрогении, р1 — между центральной и надпочечниковой формами, р2 — между овариальной и надпочечниковой формами.

Обсуждение

Проведенное исследование показывает, что ультразвуковая структура яичников отличается при разных формах cиндрома гиперандрогении. Поликистозные изменения яичников наблюдаются при овариальной и центральной формах и отсутствуют у больных надпочечниковой гиперандрогенией. В связи с тем, что периферический тип поликистозных яичников типичен для овариальной гиперандрогении, а диффузный — для центральной формы, возможна дифференциальная диагностика данных патологических состояний по эхографическому признаку.

Наиболее сложна эхографическая диагностика периферического типа поликистозных яичников. Предлагаемый нами коэффициент отношения объема яичника к объему стромы позволяет определять стромальную гиперплазию, которая является главным морфологическим признаком овариальной гиперандрогении в каждом конкретном случае. Согласно полученным данным, коэффициент отношения объема яичника к объему стромы 3,3 и более соответствует норме, а 3,2 и менее указывает на наличие гиперплазии овариальной стромы. Применение данного показателя повышает точность эхографической диагностики овариальной гиперандрогении.

Литература

  1. Боярский К.Ю. Овариальная стимуляция и фолликулогенез в конце 90-х годов: на пороге будущего (обзор литературы) // Проблемы репродукции. — 1997. — N4. — С. 11-15.
  2. Вихляева Е.М. Болезнь поликистозных яичников // Азиатский вестник акушеров-гинекологов. — 1999. — Т.5. — N1-2. — С. 60-73.
  3. Гаспаров А.С., Кулаков В.И., Богданова Е.Д. Особенности клинического течения и эффективность лечения болезни поликистозных яичников в подростковом и зрелом репродуктивном возрастах // Проблемы репродукции. — 1995. — N4. — С. 11-17.
  4. Демидов В.Н., Алиева Э.А.. Струков А.В. Возможности эхографии в диагностике синдрома поликистозных яичников // Акушерство и гинекология. — 1991. — N1. — С. 40-42.
  5. Демидов В.Н., Зыкин Б.И. Ультразвуковая диагностика в гинекологии. — Медицина: М., 1990. — С. 123-125.
  6. Клиническое руководство по ультразвуковой диагностике / Под ред. Митькова В.В., Медведева М.В. — М., 1997. — Т.3. — С. 132-174.
  7. Манухин Л.Б., Геворкян М.А. Синдром поликистозных яичников // Проблемы репродукции. — 1999. — N6. — С. 21-26.
  8. Пищулин А.А., Бутов А.В., Удовиченко О.В. Синдром овариальной гиперандрогении неопухолевого генеза (обзор литературы) // Проблемы репродукции. — 1999. — N3. — С. 24-28.
  9. Раисова А.Т. Актуальные проблемы гиперандрогении // Клиницист. — 1995. — N3. — С. 54-59.
  10. Стрижаков А.Н., Давыдов А.И. Клиническая трансвагинальная эхография. — М., 1994. — С. 121-144.
  11. Чех Э. Ультразвуковая диагностика в акушерстве и гинекологии (пер. с чешского). — М., 1982.
  12. Botsis D., Kassanos D., Pyrgiotis E., Zourlas P.A. Sonographic incidenсe of polycystic ovaries in a gynecological population // Ultrasound-ObstetGynec, 1995, Sept. 6(3): 182-5.
  13. Campbell S., Goessens L., Goswany R. Real-time ultrasonography for determination of ovarian morphology and volume // Lancet, 1982, 1, 8269, p. 425-426.
  14. Dewailly D., Duhamel A., Robert Y. et al. Interrelationship between ultrasonography and biology in the diagnosis of polycystic ovarian syndrome // Ann. N.Y. Acad. Sci., May 28, N 687, p. 206-216.
  15. Dobson M.G. Transvaginal ultrasound // Churchill Livingstone, 1995.
  16. Filicori M., Flamigni C. The Ovary: Regulation, Dysfunction and Treatment // Bologna (Italy), 1996.
  17. Franks S. Ultrasound diagnosis of PCO. In Аdvances in Polycystic Ovary Disease, Mayo Clinic, Rochester, April 1996.
  18. Goldstein S.R., TimorATritsch I.E. Ultrasound in Gynecology // Churchill Livingstone Inc., 1995.
  19. Rosenberg C., Pardo J., Kaplan B. et al. A modified transvaginal sonographic technique for better ovary evaluаtion // Ultras. Obstetr. Gynec., 1992, v. 2, N 1, p. 153.
УЗИ аппарат HM70A

Экспертный класс по доступной цене. Монокристальные датчики, полноэкранный режим отображения, эластография, 3D/4D в корпусе ноутбука. Гибкая трансформация в стационарный сканер при наличии тележки.

Можно ли родить при мультифолликулярных яичниках

У меня мультифуликулезные яичники. Сказали, что это бесплодие.
Скажите, правда ли это?
Вероника
Russian Federation, Санкт-Петербург, Санкт-Петербург

Уважаемая Вероника!

Да, действительно, мультифолликулярные яичники — это одна из причин бесплодия. Такой диагноз ставят, если на яичниках расположено более 12 увеличенных фолликулов. Причем для первой фазы цикла такое состояние может являться вариантом нормы, но наличие множественных фолликулов на протяжение всего цикла требует лечения.

К другим симптомам, развивающимся при поликистозе яичников, относятся: нарушение менструального цикла, вторичная аменорея (т.е. прекращение менструаций на срок свыше полугода), ожирение, появление волос на лице, груди, спине и бедрах, угревая сыпь, жирная кожа лица и головы, боль внизу живота и другие. В ряде случаев поликистоз может протекать бессимптомно, а единственным признаком, указывающим на проблему, может быть отсутствие желаемой беременности.

Специалисты относят это состояние к ряду наследственных заболеваний. При образовании множественных фолликулов происходит снижение выработки женских гормонов, а количество мужского гормона (тестостерона), напротив, увеличивается. Также отмечается повышенная концентрация инсулина в крови. Обследование, как правило, выявляет соотношение гормонов ЛГ и ФСГ в районе 2,5 — 3, в то время как в норме оно не должно превышать 1,5 — 2.

Можно ли зачать ребенка при мультифолликулярных яичниках?

Если у вас обнаружили поликистоз яичников, то у вас могут возникнуть проблемы с зачатием ребенка. Во-первых, множественные кисты способствуют утолщению поверхностного слоя яичников, и яйцеклетке сложно выйти наружу. А во-вторых, из-за сниженного количества женских гормонов нарушается весь процесс созревания доминантного фолликула, и овуляция наступает довольно редко.

И хотя поликистозные яичники — это одна из распространенных причин женского бесплодия, это не приговор. При своевременном выявлении и лечении заболевания у женщины есть все шансы зачать, выносить и родить здорового ребенка.

Диагностика поликистоза яичников

Для верной постановки диагноза вам рекомендуется пройти соответствующее обследование. Для начала провести УЗИ-исследование органов малого таза в начале, середине и конце цикла. При мультифолликулярных яичниках, как правило, выявляются 12 и более увеличенных фолликулов от 2 до 9 мм в длину, а сам яичник имеет крупные размеры, в несколько раз превышающие нормальные.

Из гормональных исследований рекомендуется сдать анализ крови на ЛГ, ФСГ, тестостерон, инсулин, кортизол, 17-ОН-прогестерон, ДЭА-сульфат, гормоны щитовидной железы — Т3, Т4 и ТТГ. О сроках и правилах сдачи анализа вам расскажет ваш лечащий врач-гинеколог.

Данное обследование направлено на исключение других заболеваний гормонального характера, а именно синдрома Кушинга, андрогенитального синдрома, гиперпролактинемии и гипотиреоза.

Лечение

При подтверждении диагноза назначается лечение, которое может включать физио- и лазеротерапию, а также прием иммуностимулирующих и гормональных препаратов. В зависимости от причин и последствий заболевания могут быть показаны низкокалорийная диета, терапия оральными гормональными контрацептивами; препаратами, снижающими эффект мужских гормонов; препаратами, стимулирующими овуляцию (если вы желаете забеременеть). В самых трудных случаях может быть проведена лапароскопическая операция по удалению утолщенного слоя яичника. Но это крайняя мера. Если консервативное лечение начато вовремя, шансы на восстановление работы яичников высоки.

С уважением, Ксения.

Полезный совет?

Расскажите друзьям


Внимание!

Напоминаем вам, что статья носит рекомендательный характер.
Для установления правильного диагноза нужна очная консультация врача!

Поликистоз яичников – обзор

Морфология яичников

В своем классическом описании поликистоза яичников Штейн и Левенталь во время операции отметили, что кора яичника содержит многочисленные периферические антральные фолликулы, а строма яичника увеличена и составляет не менее 25% мозгового вещества. часть яичника. Гиперпластическая медуллярная строма, по-видимому, смещает кистозные фолликулы к периферии (рис. 21.2). Последующее внедрение ультразвуковой визуализации облегчило клиническую идентификацию поликистоза яичников, хотя морфологические критерии не были едиными. 19,56–58

В 2003 г. на консенсусной конференции в Роттердаме, Нидерланды, было установлено описание поликистоза яичников (рис. 21.3). Поликистоз яичников определяли как наличие 12 или более фолликулов в яичнике, независимо от локализации, или объем яичника более 10 см 3 . 6 В настоящее время это определение является общепринятым. Однако с появлением более нового оборудования и передовых технологий точность подсчета фолликулов повысилась.В недавнем отчете рабочей группы рекомендуется, чтобы порог для морфологии поликистозных яичников, основанный на количестве фолликулов, был увеличен до более чем 25 фолликулов на яичник, чтобы избежать чрезмерной интерпретации морфологии поликистозных яичников и ошибочного диагноза СПКЯ. 59 Эта новая рекомендация требует стандартизации методов подсчета фолликулов и проверки порога, определяющего избыток фолликулов. Кроме того, следует оценить полезность этой новой рекомендации в клинической практике.Пока эти меры не определены, подходят текущие ультразвуковые критерии или 12 или более фолликулов в яичнике или объем более 10 см 3 .

Это описание поликистоза яичников не следует путать с УЗИ яичников у женщин, выздоравливающих от гипогонадотропного гипогонадизма. У этих людей часто встречается множественный рост мелких антральных фолликулов, который может выглядеть как поликистоз яичников. У женщин, подвергающихся индукции овуляции, в результате стимуляции яичников может произойти образование множественных фолликулов.Таким образом, причастность мультифолликулярного яичника или поликистозного яичника следует рассматривать в рамках клинических условий.

В то время как сонографическая демонстрация поликистоза яичников при наличии типичных клинических признаков считается подтверждением синдрома, было ясно продемонстрировано, что морфология поликистозных яичников может быть обнаружена у женщин с нормальной овуляцией без гиперандрогении в анамнезе. 60 При исследовании 104 молодых датских женщин с поликистозом яичников только у 43 были обнаружены другие симптомы, соответствующие критериям СПКЯ. 61 Таким образом, 58% женщин с поликистозом яичников были практически нормальными без менструальных нарушений или признаков гиперандрогении. Точно так же недавно было показано, что поликистоз яичников является относительно частым явлением у большой группы хорошо охарактеризованных нормальных женщин в возрасте от 25 до 45 лет. 62 Из 257 женщин поликистоз яичников был выявлен у 32% в целом, причем наибольший процент, 62%, наблюдался у женщин в возрасте от 25 до 30 лет с последующим прогрессирующим снижением в более старших группах (рис.21.4). Физиологическая значимость поликистоза яичников у нормальных женщин не ясна, хотя лонгитюдное исследование показало, что такие люди не подвержены повышенному риску СПКЯ. 63 Таким образом, несмотря на то, что необходимая идентификация поликистозных яичников для установления диагноза представляется клинически целесообразной, морфогенез поликистозных яичников не обязательно может быть уникальным для заболевания.

Синдром поликистозных яичников: это не просто бесплодие

1.Фрэнкс С. Синдром поликистоза яичников. N Английский J Med . 1995;333:853–61 [Опубликованные опечатки появляются в N Engl J Med 1995;333:1435]…

2. Stein IF, Левенталь МЛ. Аменорея, связанная с двусторонним поликистозом яичников. Am J Obstet Gynecol . 1935; 29: 181–91.

3. Бахманн Г.А. Синдром поликистозных яичников: метаболические проблемы и новые возможности лечения. Am J Obstet Gynecol . 1998;179:S87–8.

4. Гузик Д. Синдром поликистозных яичников: симптоматика, патофизиология и эпидемиология. Am J Obstet Gynecol . 1998;179:S89–93.

5. Нестлер Ю.Е., Штраус Дж. Ф. 3d. Инсулин как эффектор метаболизма стероидов в яичниках и надпочечниках человека. Эндокринол Метаб Клин Норт Ам . 1991; 20: 807–23.

6. Нестлер Ю.Е. Роль ожирения и инсулина в развитии ановуляции. В: Филикори М., Фламиньи С., ред. Индукция овуляции: фундаментальные научные и клинические достижения: материалы Симпозиума по индукции овуляции: фундаментальные научные и клинические достижения, 20–22 января 1994 г., Палм-Бич, Флорида, США.Нью-Йорк: Excerpta Medica, 1994: 103–14.

7. Сперофф Л., Гласс Р.Х., Кейс Н.Г. Ановуляция и поликистоз яичников. В кн.: Клиническая гинекологическая эндокринология и бесплодие. 5-е изд. Балтимор: Уильямс и Уилкинс, 1994: 457–82.

8. Конте Ф.А., Грумбах М.М., Ито Ю, Фишер ЧР, Симпсон ER. Синдром женского псевдогермафродитизма, гипергонадотропного гипогонадизма и поликистозных яичников, связанный с миссенс-мутациями в гене, кодирующем ароматазу (P450arom). J Clin Endocrinol Metab . 1994; 78: 1287–92.

9. Вентуроли С., Порку Э, Фаббри О, Магрини О, Гамми Л, Парадизи Р, и другие. Эпизодическая пульсирующая секреция ФСГ, ЛГ, пролактина, эстрадиола, эстрона и циркадные колебания ЛГ при синдроме поликистозных яичников. Клин Эндокринол [Oxf] . 1988; 28: 93–107.

10. Адамс Дж., Полсон Д.В., Фрэнкс С. Распространенность поликистозных яичников у женщин с ановуляцией и идиопатическим гирсутизмом. Br Med J [Clin Res] . 1986; 293: 355–9.

11. Полсон Д.В., Адамс Дж, Уодсворт Дж, Фрэнкс С. Поликистоз яичников — частая находка у здоровых женщин. Ланцет . 1988; 1 (8590): 870–2.

12. Клейтон Р.Н., Огден В, Ходжкинсон Дж, Уорсвик Л, Родин Д.А., Дайер С, и другие. Насколько распространены поликистозные яичники у нормальных женщин и каково их значение для фертильности населения? Клин Эндокринол [Oxf] .1992; 37: 127–34.

13. Дунайф А., Гивенс Дж. Р., Хазелтин Ф. П., Мерриам Г. Р. Синдром поликистоза яичников. Бостон: Blackwell Scientific, 1992: 377–84.

14. Дунайф А. Гиперандрогенная ановуляция (СПКЯ): уникальное нарушение действия инсулина, связанное с повышенным риском развития инсулиннезависимого сахарного диабета. Am J Med . 1995; 98:33С–9С.

15. Легро РС. Синдром поликистозных яичников: современные и перспективные парадигмы лечения. Am J Obstet Gynecol .1998; 179:S101–8.

16. Дунайф А, Сегал КР, Шелли Д.Р., Зеленый Г, Добрянский А, Лихолай Т. Доказательства отличительных и внутренних дефектов действия инсулина при синдроме поликистозных яичников. Диабет . 1992;41:1257–66.

17. Дунайф А, Сегал КР, Футтервейт В, Добрянский А. Глубокая периферическая резистентность к инсулину, независимая от ожирения, при синдроме поликистозных яичников. Диабет .1989; 38: 1165–74.

18. Эрманн Д.А., Барнс РБ, Розенфилд Р.Л., Каваган МК, Империал Дж. Распространенность нарушений толерантности к глюкозе и сахарного диабета у женщин с синдромом поликистозных яичников. Лечение диабета . 1999; 22:141–6.

19. Бурген Г.А., Гивенс Дж. Р., Китабчи АЕ. Корреляция гиперандрогении с гиперинсулинизмом при поликистозе яичников. J Clin Endocrinol Metab . 1980; 50: 113–6.

20. Чанг Р.Дж., Накамура Р.М., Джадд ХЛ, Каплан С.А. Инсулинорезистентность у пациенток без ожирения с поликистозной болезнью яичников. J Clin Endocrinol Metab . 1983; 57: 356–9.

21. Талбот Э., Гузик Д, Клеричи А, Берга С, Детре К, Веймер К, и другие. Факторы риска ишемической болезни сердца у женщин с синдромом поликистозных яичников. Артериосклеры Тромб Васк Биол .1995; 15:821–6.

22. Кулам CB, Аннегерс Дж. Ф., Кранц Дж.С. Синдром хронической ановуляции и ассоциированная неоплазия. Акушерство Гинекол . 1983; 61: 403–7.

23. Рон Э., Луненфельд Б, Менцер Дж, Блюмштейн Т, Кац Л, Ольснер Г, и другие. Заболеваемость раком в когорте бесплодных женщин. Am J Эпидемиол . 1987; 125: 780–90.

24. Дикий РА. Гиперандрогения: последствия сердечно-сосудистых заболеваний эндометрия и молочной железы.В: Adashi EY, Rock JA, Rosenwaks Z, ред. Репродуктивная эндокринология, хирургия и технологии. Филадельфия: Липпинкотт-Рейвен, 1996:1617.

25. Фаркуар С.М., Бердсолл, Массачусетс, Мэннинг Пенсильвания, Митчелл Дж. М., Франция JT. Распространенность поликистоза яичников при ультразвуковом сканировании в популяции случайно выбранных женщин. Aust NZ J Obstet Gynaecol . 1994; 34: 67–72.

26. Конвей Г.С., Честь JW, Джейкобс ХС. Гетерогенность синдрома поликистозных яичников: клинические, эндокринные и ультразвуковые особенности у 556 пациенток. Клин Эндокринол [Oxf] . 1989; 30: 459–70.

27. Фрэнкс С. Синдром поликистозных яичников: меняющаяся перспектива. Клин Эндокринол [Oxf] . 1989; 31: 87–120.

28. Адамс Дж., Фрэнкс С, Полсон Д.В., Мейсон HD, Абдулвахид Н, Такер М, и другие. Мультифолликулярные яичники: клинические и эндокринные особенности и реакция на пульсирующий гонадотропин-рилизинг-гормон. Ланцет . 1985; 2 (8469/70): 1375–9.

29. Лобо Р.А., Грейнджер Л, Гебельсманн У, Мишель ДР. Повышение уровня несвязанного эстрадиола в сыворотке как возможный механизм неадекватной секреции гонадотропина у женщин с поликистозом яичников. J Clin Endocrinol Metab . 1981; 52: 156–158.

30. Кармина Е, Розато Ф, Маджоре М, Гальяно А.М., Индовина Д, Янни А. Секреция пролактина при синдроме поликистозных яичников (СПКЯ): корреляция со стероидным паттерном. Acta Endocrinol [Copenh] . 1984; 105: 99–104.

31. Гаудас В.Т., Дюмесик Д.А. Синдром поликистоза яичников. Эндокринол Метаб Клин Норт Ам . 1997; 26: 893–12.

32. Кидди Д.С., Гамильтон-Фэрли Д., Буш А, короткая Ф, Аняоку В, Рид МДж, и другие. Улучшение эндокринной функции и функции яичников при диетическом лечении женщин с ожирением и синдромом поликистозных яичников. Клин Эндокринол [Oxf] .1992; 36: 105–11.

33. Йен СС. Хроническая ановуляция, вызванная периферическими эндокринными нарушениями. В: Йен С.С., Джаффе Р.Б., ред. Репродуктивная эндокринология: физиология, патофизиология и клиническое ведение. 3-е изд. Филадельфия: Сондерс, 1991: 576–630.

34. Веласкес Э., Акоста А, Мендоса СГ. Менструальная цикличность после терапии метформином при синдроме поликистозных яичников. Акушерство Гинекол . 1997; 90: 392–5.

35. Морин-Папунен Л.С., Койвунен Р.М., Руоконен А, Мартикайнен ХК.Терапия метформином улучшает менструальный цикл с минимальными эндокринными и метаболическими эффектами у женщин с синдромом поликистозных яичников. Fertil Steril . 1998; 69: 691–6.

36. Аззиз Р., Закур Х.А. Синдром поликистоза яичников. В: Уоллах Э.Э., Закур Х.А., ред. Репродуктивная медицина и хирургия. Сент-Луис: Мосби, 1995:209.

Синдром поликистозных яичников (СПКЯ)

Доктор Хайдер Наджар, акушер-гинеколог

СПКЯ — это сложное гормональное заболевание, которое может быть связано с множеством проблем, включая нерегулярные и аномальные менструации, бесплодие, проблемы с кожей и волосами.

Очень важно различать синдром поликистозных яичников и так называемый «поликистоз яичников». Поликистоз яичников, в настоящее время известный как мультифолликулярные яичники, относится к наличию более 12 или 15 фолликулов в каждом яичнике без проявления симптомов и признаков полного синдрома ПКЯ. Очень часто можно увидеть мультифолликулярные яичники, особенно у молодых женщин, что не обязательно связано с проблемой синдрома в целом.

СПКЯ встречается относительно часто. Он может поражать от 5 до 15% женщин репродуктивного возраста (от подросткового возраста до менопаузы).К сожалению, высокий процент таких случаев остается невыявленным. СПКЯ является одной из наиболее частых причин бесплодия.

Мы до сих пор не до конца понимаем причину СПКЯ, однако семейный анамнез и генетика играют значительную роль в развитии этого состояния. Гормоны и образ жизни также важны. Обычно резистентность к инсулину присутствует у 20–25% женщин с СПКЯ. У них обычно высокий уровень инсулина, который не работает эффективно при метаболизме сахара.У них также высокий уровень андрогенов, которые обычно называют мужскими гормонами. Это заблуждение, поскольку эти гормоны обычно существуют у женщин на определенных уровнях. Постановка диагноза СПКЯ может сбивать с толку пациентов, а иногда и практикующих врачей. Описание яичников на УЗИ тоже может немного запутать. Как правило, для постановки диагноза СПКЯ женщинам необходимо наличие двух из следующих критериев:

  1. Аномальные менструации, которые могут проявляться нерегулярными менструациями или их отсутствием.
  2. Мультифолликулярные яичники на УЗИ. Это не означает наличие кист на яичниках, а скорее наличие множества мелких фолликулов, которые могут придавать яичникам «кистозный вид».
  3. Проблемы с кожей или волосами, которые могут проявляться прыщами или чрезмерной растительностью на лице или теле. Это может также включать выпадение волос на коже головы, когда уровень тестостерона высок.

Лечение СПКЯ

Очень важно помнить, что СПКЯ — это не болезнь.Это синдром, который означает, что это комбинация признаков или симптомов. Лечение этого синдрома обычно направлено на симптомы и проблемы, которые могут возникнуть в результате этого. Основные направления лечения включают:

  1. Модификация образа жизни и снижение веса. Только они могут преобразовать циклы из нерегулярных циклов, которые происходят без овуляции, в овуляторные, регулярные менструации, которые могут помочь фертильности и устранить другие симптомы.
  2. Медикаментозное лечение, например противозачаточные таблетки, будет нашим первым вариантом при любых нерегулярных или отсутствующих менструальных циклах.Этот вариант был бы, очевидно, полезен, если фертильность нежелательна. Регулярные циклы приема таблеток предотвратят риск того, что слизистая оболочка матки станет слишком толстой. Таблетка также поможет уменьшить другие нежелательные симптомы, такие как изменения волос и кожи.
    Другим вариантом лечения может быть метформин, который поможет, в частности, пациентам с резистентностью к инсулину. Также было обнаружено, что метформин помогает вызвать овуляцию с другими лекарствами или без них.
  3. Препарат для стимуляции овуляции, включая кломид.Этот селективный модулятор рецептора эстрогена может помочь вызвать овуляцию, и обычно необходимо регулярное наблюдение за овуляцией с помощью ультразвука, чтобы пара могла попробовать половой акт по времени.
  4. Хирургические варианты обычно зарезервированы для пациентов, у которых менее инвазивные подходы не дали результата.
  5. Вспомогательные репродуктивные технологии, включая ЭКО или ВМИ. Обычно это крайняя мера, и вероятность успеха у женщин с СПКЯ обычно очень высока.

Для лечения этого состояния может потребоваться многопрофильная команда, которой мы в Create Health гордимся тем, что работаем с огромным количеством профессионалов, включая диетолога, психолога, психиатра, эндокринолога и физиотерапевта.

Если у вас есть какие-либо вопросы или пожелания, не стесняйтесь обращаться к нам по электронной почте или запишитесь на прием к одному из наших опытных специалистов.


« назад

СПКЯ и фертильность: все, что вам нужно знать

Что такое синдром поликистозных яичников (СПКЯ)?

СПКЯ, сокращение от синдрома поликистозных яичников, является распространенным заболеванием, связанным с гормонами, при котором яичники не всегда выделяют яйцеклетку в конце менструального цикла (от начала менструации до начала следующей).Это может привести к трудностям с беременностью.

Считается, что это очень распространенное заболевание, затрагивающее примерно 1 из каждых 5 женщин в Великобритании.

Если у вас поликистоз яичников (ПКО):

  • Ваши яичники немного больше нормы
  • у вас гораздо больше фолликулов (заполненных жидкостью карманов на яичниках, из которых высвобождаются яйцеклетки во время овуляции)

Наличие поликистозных яичников не означает, что у вас СПКЯ. СПКЯ означает, что ваши яичники немного отличаются от яичников большинства женщин, в то время как СПКЯ — это расстройство, связанное с несбалансированным уровнем гормонов.

Симптомы СПКЯ


Наличие поликистозных яичников не означает, что у вас есть поликистоз яичников. Чтобы поставить диагноз СПКЯ, у вас должен быть поликистоз яичников и некоторые из следующих симптомов:

  • нерегулярные менструации или отсутствие
  • больше волос на лице или теле
  • меньше волос на голове
  • трудности с похудением или быстрое увеличение веса
  • акне или жирная кожа
  • трудности с беременностью

Месячные считаются «нерегулярными», если продолжительность вашего цикла (интервал между началом менструации) постоянно меняется.В среднем менструальный цикл длится 28 дней, хотя это нормально, если он немного короче или длиннее.

У вас могут быть некоторые из этих симптомов СПКЯ, но они варьируются от женщины к женщине, причем у некоторых женщин симптомы проявляются в более легкой форме, а у других — в более тяжелой форме.

Каковы причины СПКЯ?


Точная причина синдрома поликистозных яичников неизвестна, но он может быть генетическим, так как вероятность того, что он возникнет у вас, выше, если он есть у кого-либо из ваших родственников (матери, тети, сестры).

Симптомы СПКЯ связаны с гормонами:

  • У женщин с поликистозом яичников уровень тестостерона несколько выше нормы, что связано со многими симптомами, такими как увеличение количества волос на лице.
  • Если у вас СПКЯ, ваш организм может не реагировать на инсулин (это называется резистентностью к инсулину), поэтому уровень глюкозы в вашем организме выше. Высокий уровень инсулина может привести к увеличению веса и проблемам с фертильностью. Если у вас диагностирован СПКЯ, у вас повышен риск развития диабета в более позднем возрасте

Есть ли у меня СПКЯ?

Женщины с легкими симптомами часто осознают, что у них СПКЯ, только когда начинают пытаться зачать ребенка, особенно если их вес то увеличивается, то уменьшается.

Использование комбинированных оральных контрацептивов («таблеток») может помешать вам заметить, что у вас СПКЯ, потому что:

  • у многих из них есть 7 дней без таблеток каждый месяц и кровотечение отмены, которое можно ошибочно принять за менструацию (это ненастоящая менструация, поскольку она не связана с производством яйцеклеток или утолщением слизистой оболочки матки).
  • женщин не могут сказать, регулярны ли у них месячные.
  • таблетки содержат гормоны, которые могут облегчить симптомы СПКЯ. Это может улучшить прыщи и уменьшить лишний рост волос.(Это стандартное лечение СПКЯ, когда женщины не хотят забеременеть.)

Диагноз СПКЯ ставится при наличии любых двух из следующих признаков:

  • нерегулярные менструации или отсутствие
  • трансвагинальное сканирование (при котором во влагалище вводится зонд), показывающее поликистозные яичники
  • увеличение количества волос на лице или теле или результаты анализов, показывающие, что у вас избыточный уровень тестостерона.

Если вы считаете, что у вас СПКЯ, обратитесь к врачу общей практики, чтобы получить направление к гинекологу.

Как происходит нормальная овуляция?

При нормальном менструальном цикле с овуляцией в фолликулах яичников созревает определенное количество яйцеклеток. Самая спелая яйцеклетка попадает в одну из фаллопиевых труб, где встречается со сперматозоидом, если таковой имеется.

Если у вас СПКЯ, несмотря на то, что поликистозные яичники содержат фолликулы с яйцеклетками, фолликулы не развиваются и не созревают должным образом, поэтому не происходит овуляции или выхода яйцеклеток. Это называется ановуляцией.

Многие женщины не узнают, что у них СПКЯ, пока они не попытаются забеременеть, особенно если они использовали гормональную контрацепцию, которая маскирует нерегулярные менструации или отсутствие менструаций, потому что это допускает ежемесячные кровотечения.

«С тех пор, как мой диагноз и путь к зачатию начались, я обнаружил, что у многих других женщин, которых я знаю, есть это, и у них также были проблемы с зачатием. Я думаю, что у многих из нас были симптомы, когда мы были подростками, но они принимали таблетки, которые маскировали это состояние в течение многих лет».

СПКЯ

Как лечить СПКЯ, если вы пытаетесь забеременеть?


Сам по себе СПКЯ не лечится, но симптомы можно лечить.Если у вас ИМТ более 30, вам будет рекомендовано похудеть с помощью здорового питания и физических упражнений. Это само по себе может вызвать овуляцию вашего тела. Даже если этого не произойдет, это позволит вашим лекарствам работать лучше и снизит риски во время беременности.

Существует ряд различных лекарств, помогающих зачать ребенка при СПКЯ

  • цитрат кломифена (самая известная торговая марка в Великобритании — Clomid) — стимулирует яичники к высвобождению яйцеклеток
  • метформин используется для коррекции резистентности к инсулину, которая также может присутствовать при СПКЯ
  • комбинация вышеперечисленного.

Если вы принимаете таблетки цитрата кломифена:

  • в первом цикле лечения вам сделают трансвагинальное сканирование, чтобы проверить, подходит ли вам эта доза. Сканирование будет смотреть на ваши фолликулы, чтобы увидеть, как они развиваются.
  • , вам не будут давать его в течение более шести месяцев, так как это увеличивает риск развития рака яичников.

Если цитрат кломифена не работает, вам могут предложить:

  • гонадотропины (лекарство от бесплодия, основанное на гонадотропных гормонах, стимулирующих яичники производить и созревать яйцеклетки).Это с большей вероятностью приведет к чрезмерной стимуляции ваших яичников и вызовет многоплодную беременность, но вы будете регулярно проходить сканирование для проверки развивающихся фолликулов.
  • операции с использованием метода, называемого лапароскопическим сверлением яичников (LOD). Это убивает ткань яичников, которая вырабатывает тестостерон.
  • ЭКО – при котором яйцеклетка извлекается, оплодотворяется вне организма и переносится в матку.

Узнайте больше о лечении бесплодия.

Каковы мои шансы на зачатие при СПКЯ?

Хотя трудно дать статистику, так как случаи сильно различаются, а разные методы лечения имеют разные показатели успеха, большинство женщин с СПКЯ смогут родить ребенка при лечении бесплодия.Для женщин моложе 35 лет это еще более актуально.

Психическое здоровье и СПКЯ

Узнать, что у вас проблемы с фертильностью, может быть настоящим шоком, а чувство вины и неудачи не редкость. Однако, если вы можете, думайте об этом как о медицинской проблеме, которая поддается лечению наряду с большинством других заболеваний, а не как о женщине. Многие, многие пары используют лечение бесплодия, чтобы зачать ребенка, и о неудобном начале долго забывают в последующие годы.

Для некоторых пар работа над различными лечебными процедурами является длительным, сложным и тревожным процессом, особенно если это сочетается с необходимостью взять отпуск на несимпатичном рабочем месте.Старайтесь максимально поддерживать друг друга, проводя консультации, лечение и встречи.

‘Когда мне поставили диагноз, мне пришлось смириться с тем, что зачатие ребенка потребует времени, мне нужно было быть доброй и терпеливой по отношению к своему телу, но я никогда не теряла надежды на то, что забеременею. Я потратил время на то, чтобы правильно питаться, начал программу «от дивана до 5 км» и избавился от стресса в своей жизни». Страдающий СПКЯ

СПКЯ и беременность


СПКЯ во время беременности может увеличить риск вызванной беременностью гипертензии, преэклампсии и преждевременных родов.Все женщины должны быть обследованы на наличие гестационного диабета к 20 неделе беременности, а все лекарства, которые вы принимаете, должны быть проверены.

Дополнительная поддержка

Благотворительная организация Verity запускает специальный веб-сайт с ресурсами и поддержкой для женщин, страдающих СПКЯ.

The Fertility Network UK имеет форумы и поддержку для тех, кто страдает бесплодием.

В чем разница между кистой яичника и СПКЯ?

Синдром поликистозных яичников (СПКЯ) и кисты яичников: в их названиях есть слово «киста», но являются ли эти два состояния одним и тем же? Короткий ответ: нет.К тому времени, как вы закончите читать эту статью, вы получите длинный ответ, но мы сразу дадим вам краткое объяснение:

  • СПКЯ — это гормональное расстройство, которое иногда сопровождается поликистозом яичников — они не имеют кисты, но вместо этого имеют большее, чем обычно, количество мелких (2-8 мм) антральных фолликулов яичников (заполненных жидкостью мешочков, в которых размещаются и выделяются яйцеклетки).
  • Любой фолликул, в том числе присутствующий в поликистозных яичниках, может стать фолликулярной кистой (наиболее распространенный тип кисты яичника), которая растет во время менструального цикла и заполняется прозрачной жидкостью.
  • Другие типы кист яичников — тератомы , цистаденомы и эндометриомы — считаются «настоящими» кистами, поскольку они содержат биологический материал, а не только жидкость, и они не связаны напрямую с менструальным циклом.

Продолжайте читать, чтобы лучше понять, что такое СПКЯ, какие виды кист яичников могут возникнуть и что в конечном итоге отличает два типа проблем с яичниками.

Что такое синдром поликистозных яичников (СПКЯ)?

Синдром поликистозных яичников (СПКЯ) — это гормональное расстройство, которым страдает до 1 из 10 женщин с яичниками.Несмотря на распространенность СПКЯ, его часто не диагностируют и не лечат (в одном исследовании этот показатель составляет 70%!).

«Синдром» при СПКЯ обозначает группу симптомов, которые постоянно возникают вместе как часть состояния. Таким образом, диагноз СПКЯ ставится при подтверждении двух из трех следующих симптомов (это также известно как Роттердамские критерии): нерегулярные менструации или овуляция , повышенный уровень андрогенов или избыточный рост волос и/или «поликистозные» яичники .

  1. Нерегулярные менструации или овуляция или их отсутствие определяются как отсутствие менструаций в течение как минимум трех месяцев или 35+ дневных менструальных циклов. Нерегулярная овуляция может привести к большему наращиванию слизистой оболочки стенок матки (эндометрия) между менструациями, что часто вызывает более тяжелые менструации с более сильными болями и дискомфортом.
  2. Повышенный уровень андрогенов , которые представляют собой группу гормонов, критически важных для репродуктивного развития, наиболее известным из которых является тестостерон.Хотя андрогены иногда называют «мужскими» гормонами, они вырабатываются и у людей с яичниками, а тестостерон, в частности, влияет на все, от состава тела до чувствительности к инсулину.
  3. «Поликистозные» яичники увеличены и содержат множественные незрелые фолликулы яичников (12 и более с одной стороны).

Каковы симптомы СПКЯ?

Некоторые из наиболее распространенных симптомов СПКЯ включают :

  • Чрезмерный рост волос на теле (или гирсутизм)
  • Акне
  • Увеличение веса
  • Проблемы с беременностью (из-за нерегулярной овуляции) и лечили?

    Любой из Роттердамских критериев может иметь другие причины по отдельности, поэтому диагностика СПКЯ у медицинского работника важна для получения полной картины вашего здоровья и может включать сбор анамнеза, анализ гормона фертильности, гинекологический осмотр и даже измерение метаболизм сахара для оценки резистентности к инсулину.

    Поскольку для диагностики СПКЯ необходимы только два из трех Роттердамских критериев, УЗИ для подтверждения наличия поликистозных яичников не всегда требуется, если выполняются два других критерия. А в некоторых случаях симптомов может быть достаточно, чтобы определить высокий уровень андрогенов без тестирования на гормоны.

    Лечение СПКЯ может включать :

    Что такое кисты яичников?

    Кисты яичников (иногда называемые массами придатков) довольно часто встречаются у людей с яичниками, предполагаемая распространенность составляет от 8% до 18%.Кисты яичников обычно безвредны, появляются и исчезают без каких-либо симптомов. Существует много типов кист яичников, но вот четыре наиболее распространенных:

    • Функциональные кисты являются наиболее распространенным типом кист яичников и встречаются у большинства людей с яичниками. Обычно они исчезают сами по себе и не вызывают никаких симптомов. Существует два типа функциональных кист: Кисты желтого тела возникают в любое время фолликул яичника выпускает свою яйцеклетку, тогда как фолликулярные кисты возникают, когда фолликул не может высвободить свою яйцеклетку и продолжает расти.
    • Тератомы (или дермоидные кисты) — это кисты, содержащие различные ткани, из которых состоит тело, такие как кожа, волосы и иногда зубы. В редких случаях тератомы могут быть раковыми (так называемые незрелые тератомы).
    • Цистаденомы формируются на наружной поверхности яичника. Хотя они могут вырасти довольно большими, они, как правило, доброкачественные.
    • Эндометриомы образуются в результате эндометриоза, состояния, при котором ткань, похожая на слизистую оболочку матки, разрастается за пределами матки.

    Приведенный выше список не является исчерпывающим: существует множество других редких типов доброкачественных или злокачественных кист, которые могут присутствовать в яичнике. Хотя рассмотрение всех типов выходит за рамки этой статьи, важно знать, что они существуют.

    Симптомы кист яичников (некоторые из которых могут совпадать с синдромом поликистозных яичников) включают :

    Сан-Франциско, объясняет, что симптомы всех различных типов кист яичников обычно совпадают.Вот почему, по его словам, «трудно определить тип кисты только по симптомам».

    Как диагностируются и лечатся кисты яичников?

    Медицинский работник может подтвердить наличие кисты с помощью гинекологического осмотра. Определение типа кисты осуществляется с помощью анализов крови, теста на беременность, УЗИ органов малого таза и/или лапароскопии, когда используется небольшая камера для визуализации внутренней части живота и просмотра яичников и любых возможных кист. Лечение зависит от размера кисты, от того, заполнена ли она жидкостью, твердая или смешанная, от внешнего вида кисты, а также от того, пережила ли пациент менопаузу.

    Лечение кист яичников может включать:

    • Подход «наблюдай и жди», включающий обезболивание
    • Хирургическое вмешательство в редких случаях, когда киста слишком велика, вызывает внутреннее кровотечение из-за разрыва или ожидается быть раковыми

    Часто кисты яичников рассасываются сами по себе в течение нескольких менструальных циклов, и около 8% женщин в пременопаузе имеют кисты яичников, требующие лечения

    Могут ли СПКЯ или кисты яичников влиять на фертильность?

    СПКЯ является одним из Ведущие причины бесплодия.Поскольку СПКЯ может привести к нерегулярной овуляции, часто бывает трудно определить фертильное окно человека (дни, когда он с наибольшей вероятностью забеременеет), чтобы забеременеть. В таких ситуациях наборы для прогнозирования овуляции (например, современный тест на фертильность) могут помочь предсказать овуляцию, даже если она нерегулярна. У некоторых людей с СПКЯ вообще не бывает овуляции, что делает невозможным забеременеть.

    Большинство кист яичников не влияют на фертильность, за исключением эндометриом (вызванных эндометриозом).Эндометриоз сам по себе может блокировать фаллопиевы трубы, по которым проходит яйцеклетка, чтобы встретиться со сперматозоидом, или иным образом снизить фертильность.

    Собираем все вместе: каковы самые большие различия между «поликистозными» яичниками и кистами яичников?

    В контексте поликистоза яичников термин «киста» немного неверен. Как поясняется в одном исследовании 2014 года, киста представляет собой «выстланный эпителием (тонкой тканью на поверхности органов), наполненный жидкостью мешок, обычно более 2 см». При СПКЯ «яичники обычно увеличены и содержат множественные [маленькие] фолликулы, обычно менее 8 мм, не выстланные эпителием.Проще говоря, поликистоз яичников может быть результатом отсутствия регулярной овуляции, что приводит к множественным маленьким фолликулам в яичниках. У пациентов без СПКЯ фолликулы того же типа, но в среднем их меньше.

    Доктор Харитон говорит, что его пациенты с трудом понимают разницу между поликистозными яичниками и кистой яичников «постоянно». «Это большая проблема с неправильным названием», объясняет он. Итак… в чем же именно заключаются эти различия? Иногда множественные маленькие фолликулы яичников в поликистозных яичниках, но не всегда приводят к фолликулярным кистам, но фолликулярные кисты также могут возникать у людей без СПКЯ.Фолликулярные кисты и кисты желтого тела изменяются в зависимости от разных фаз менструального цикла. С другой стороны, тератомы, цистаденомы и эндометриомы не связаны напрямую с менструальным циклом.

    Практический результат

    Хотя СПКЯ и кисты яичников могут иметь некоторые совпадения, они различаются с точки зрения исходов и подходов к лечению. И хотя это руководство должно помочь вам понять, как сравниваются и противопоставляются СПКЯ и кисты яичников, всегда важно поговорить с вашим лечащим врачом, если у вас возникли какие-либо проблемы, чтобы они могли помочь вам разобраться в них. .

    Тем не менее, если вам интересно узнать об уровне гормона фертильности или характере овуляции, Modern Fertility предоставит вам информацию по обоим направлениям. Тест на гормон фертильности измеряет до семи гормонов, чтобы дать вам базовые данные о вашей фертильности и помочь вам увидеть, как она меняется с течением времени. Тест на овуляцию определяет лютеинизирующий гормон (ЛГ) в моче, который является гормоном, вызывающим овуляцию, поэтому вы можете понять свой уникальный цикл и точно определить лучшие дни для зачатия. И, конечно же, блог Modern Fertility доступен для вас круглосуточно и без выходных с медицинской информацией о репродуктивном здоровье.

    Эта статья была рассмотрена доктором Эдуардо Харитоном, акушером-гинекологом и научным сотрудником по репродуктивной эндокринологии и бесплодию Калифорнийского университета в Сан-Франциско.

    Поликистоз яичников может быть фактором риска развития опухоли яичников в модели спонтанного рака яичников у кур-несушек

    Хроническое воспаление и длительный окислительный стресс являются потенциальными предрасполагающими факторами для развития злокачественных новообразований, включая рак яичников (OVCA).Информация об ассоциации хронических патологических состояний яичников, включая синдром поликистозных яичников (СПКЯ), с развитием OVCA неизвестна. Цель этого исследования состояла в том, чтобы изучить, связаны ли состояния поликистозных яичников с развитием OVCA. В предварительном исследовании были случайным образом отобраны 3-4-летние куры-несушки и исследованы на наличие поликистозных яичников с раком (ПКЯЯ). В проспективном исследовании за курами наблюдали с помощью ультразвукового сканирования для выявления случаев поликистозных яичников и последующего развития OVCA.Ткани нормальных яичников и ЗПКЯ исследовали на предмет инфильтрации макрофагами, экспрессии интерлейкина-16 и супероксиддисмутазы 2. В предварительном исследовании был обнаружен спонтанный ЗПКЯ на ранних и поздних стадиях у кур. ПКЯ у кур сопровождались притоком макрофагов (17,33 ± 2,26 при ПКЯ на ранней стадии и 24,24 ± 2,5 при ПКЯ на поздней стадии в 20 мм 90 005 2 площади ткани по сравнению с 6,77 ± 1,58 у нормальных кур). Экспрессия интерлейкина-16 была более чем в 2,5 раза выше, а супероксиддисмутазы 2 была примерно в 3 раза выше у кур с ПКЯ, чем у обычных кур.Проспективное исследование показало развитие OVCA у некоторых кур с поликистозом яичников (PCO). Развитие СПКЯ у кур было связано с хроническим воспалением в яичниках. Куры-несушки могут представлять собой потенциальную модель для изучения спонтанного СПКЯ и его долгосрочного риска развития СПКЯ.

    1. Введение

    Синдром поликистозных яичников (СПКЯ) — гинекологическое заболевание, поражающее 5–10% женщин репродуктивного возраста [1, 2]. Сообщается, что СПКЯ ассоциирован с эндокринными и метаболическими нарушениями, приводящими к проявлению гетерогенных симптомов [3].Хотя были проведены обширные исследования, молекулярная этиология и долгосрочные риски СПКЯ остаются спорными и в значительной степени неизвестными. Обширные исследования также показали связь СПКЯ с другими серьезными состояниями. Сахарный диабет 2 типа и сердечно-сосудистые заболевания были предложены в качестве факторов риска, связанных с СПКЯ [4], но неизвестно, связаны ли с этим синдромом дополнительные долгосрочные риски, такие как развитие злокачественных новообразований. Несколько исследований предполагают связь СПКЯ со злокачественными новообразованиями, включая рак яичников (OVCA) [5, 6] и рак эндометрия [7, 8].Таким образом, крайне необходима информация о ранней этиологии, а также о долгосрочных рисках СПКЯ, поскольку это может не только спасти жизнь пациентов, но также улучшить качество жизни и уменьшить бремя расходов на общественное здравоохранение.

    Гиперандрогения, ожирение с резистентностью к инсулину или без нее и дисфункция яичников, включая олиго/ановуляцию, являются некоторыми симптомами, связанными с СПКЯ [9, 10]. Хотя эндокринный дисбаланс считается этиологией СПКЯ, появляющаяся информация свидетельствует о том, что СПКЯ также может быть воспалительным явлением [11] и связан с повышенным уровнем в кровотоке нескольких воспалительных маркеров [12].Однако ожирение также связано с вялотекущим воспалением [13]. Таким образом, возможно, что длительное неразрешившееся слабовыраженное воспаление может быть связано с развитием СПКЯ. Однако неизвестно, является ли слабовыраженное воспаление причиной или следствием СПКЯ.

    Ткани яичников, включая поверхностный эпителий яичников (OSE) и фимбриальный поверхностный эпителий (FSE), подвергаются (в месте овуляторного разрыва и месте получения овулирующей яйцеклетки, соответственно) хроническим воспалительным агентам в результате овуляторных повреждений.Связанные с овуляцией инсульты/облучения приводят к инфильтрации иммунных клеток, включая макрофаги и другие представители врожденной иммунной системы, в постовуляторные фолликулярные ткани. Макрофаги являются источником IL-16 [14], хемоаттрактантного цитокина, который может привлекать CD4 и CD8 Т-клетки к месту разрыва овуляции, как сообщалось о повреждениях в других тканях [15]. Таким образом, инфильтрация и накопление иммунных клеток в месте овуляторного разрыва может приводить к увеличению потребности в кислороде, что приводит к развитию гипоксического состояния.В последующем гипоксия может приводить к развитию окислительного стресса и хронического вялотекущего воспаления [16, 17]. Кроме того, предполагается, что хроническое слабовыраженное воспаление и окислительный стресс являются потенциальными факторами развития канцерогенеза [18]. Таким образом, стойкий окислительный стресс, а также хроническое воспаление могут быть факторами риска развития злокачественных новообразований яичников. Возможно, что хроническое слабовыраженное воспаление и окислительный стресс могут быть общими состояниями, преобладающими как при СПКЯ [19], так и при OVCA.Однако неизвестно, связано ли слабовыраженное воспаление яичников с развитием СПКЯ и является ли СПКЯ фактором риска канцерогенеза яичников. Исследования на людях распространенности вялотекущего хронического воспаления при СПКЯ как этиологии и патогенеза развития СПКЯ сложны и требуют много времени. Животные модели уже давно используются при изучении заболеваний человека, которые трудно изучать у людей.

    У моделей грызунов ни СПКЯ, ни OVCA не развиваются спонтанно [20–22].Индуцированные СПКЯ и OVCA на моделях грызунов не представляют собой спонтанные СПКЯ и OVCA у женщин. Однако у кур-несушек ЗОВКА развивается спонтанно, а гистопатология опухолей яичников, а также диссеминация ЗОВЯ сходны с женскими [21, 23]. Более того, как и у женщин, функции яичников у кур также регулируются гонадотропинами, включая ФСГ (фолликулостимулирующий гормон), ЛГ (лютеинизирующий гормон) и стероиды яичников. Таким образом, целью данного исследования было (1) выяснить, развивается ли у кур-несушек поликистоз яичников спонтанно, и если да, то связано ли это с хроническим слабовыраженным воспалением, и (2) определить, развивается ли у кур с поликистозом яичников OVCA.Эти цели были рассмотрены в двух исследованиях, включая предварительное исследование и проспективное исследование.

    2. Материалы и методы

    Все исследования и процедуры проводились в соответствии с протоколом, одобренным Институциональным комитетом по уходу и использованию животных (IACUC) для животных.

    2.1. Животные (куры)
    2.1.1. Предварительное исследование

    Трех-четырехлетние куры-несушки белых леггорн ( Gallus domesticus ) содержались в соответствии со стандартными методами содержания в соответствии с протоколом, одобренным IACUC, с предоставлением 14-часового светлого и 10-часового темного периода и свободного доступ к воде и корму.Показатели яйценоскости кур используются в качестве относительного показателя их показателей овуляции и регистрируются ежедневно. При нормальных методах содержания яйценоскость здоровой белой курицы леггорн составляет примерно 250 яиц в год. Когда яйценоскость падает до 50 % и менее, чем у здоровой курицы, это считается низким показателем яйценоскости [24]. В общей сложности 130 кур с нормальной и низкой или нерегулярной яйценоскостью и с вздутием живота или без него (индикатор асцитической жидкости, потенциально связанной с раком яичников) были выбраны случайным образом.Сообщается, что примерно у 10–20% кур этой возрастной группы развивается OVCA [21, 22, 24].

    2.2. Общий осмотр и сбор тканей

    У всех кур перед эвтаназией брали кровь и отделяли образцы сыворотки. После эвтаназии куры были исследованы на общий статус яичников. Регистрировали и фотографировали наличие или отсутствие кисты и/или твердой массы. Опухоли, если они присутствовали, были стадированы в соответствии с грубым метастатическим статусом, как сообщалось ранее [21]. Именно на ранней стадии рака яичников опухоль ограничена яичником и может сопровождаться или не сопровождаться асцитом.Однако на поздних стадиях ОЗКА опухоль метастазировала в другие органы за пределы брюшной полости и сопровождалась средне-профузным асцитом. Ткани, включая нормальные яичники, а также яичники, содержащие кисты и опухоли на ранней или поздней стадии, разделяли на несколько блоков, обрабатывали парафином или делали замороженные срезы для рутинной гистологии, иммуногистохимии, Вестерн-блоттинга и исследований экспрессии генов.

    2.3. Гистологическая оценка

    Парафиновые срезы исследовали с помощью световой микроскопии с использованием обычных красителей (гематоксилин-эозин), как сообщалось ранее [21], и оценивали нормальные, кистозные и/или злокачественные признаки, указывающие на различные типы опухолей.

    2.4. Иммуногистохимическое исследование

    Локализация макрофагов и клеток, экспрессирующих IL-16 (провоспалительный цитокин), а также интенсивность экспрессии SOD2 (супероксиддисмутаза 2, фермент с антиоксидантным свойством) в здоровых яичниках и яичниках с поликистозом яичников при раке (PCOC) на ранней стадии (PCOC-ES) и поздней стадии (PCOC-LS) проводили с использованием антимакрофагов (Abcam, Кембридж, Массачусетс), IL-16 (Kingfisher Biotech Inc., Сент-Пол, Миннесота) или SOD2 (кроличья антимакрофагия). SOD2/MnSOD, Abcam, Cambridge, MA) первичные антитела, соответственно, с использованием стандартного метода окрашивания ABC (набор VECTASTAIN Elite ABC HRP, Peroxidase, Universal, R.TU, Burlingame, CA), как сообщалось ранее [25]. Кроме того, репрезентативные срезы СПКЯ окрашивали на экспрессию Ki67 (антитела против Ki67, Abcam, Cambridge, MA), маркера клеточной пролиферации, для определения пролиферативного потенциала клеток кист яичников. Для всех иммуногистохимических маркеров первые антитела были исключены при контрольном окрашивании, а иммунореакции на контрольном срезе не наблюдались.

    Частота макрофагов и клеток, экспрессирующих IL-16, или интенсивность экспрессии SOD2 в срезах толщиной 5  мкм и толщиной мкм определяли с помощью светового микроскопа, подключенного к программному обеспечению для обработки цифровых изображений (MicroSuite, версия 5; Olympus Corporation, Токио, Япония). ).Выбирали от трех до пяти областей, содержащих высокую популяцию иммунопозитивных клеток или сильное иммуноокрашивание в срезе на яичник, и подсчитывали популяцию макрофагов и клеток, экспрессирующих IL-16, или определяли интенсивность окрашивания SOD2. Частота макрофагов и клеток, экспрессирующих IL-16, или интенсивность окрашивания SOD2 в срезе определяли при увеличении объектива × 40 и увеличении окуляра × 10, как сообщалось ранее [25]. Эти оценки иммунопозитивных клеток (макрофагов и клеток, экспрессирующих IL-16) или интенсивности окрашивания SOD2 выражали в 20-мм площади 2 тканей в нормальных яичниках или в поликистозных яичниках с раком на ранней или поздней стадии.

    2.5. Одномерный (1D) вестерн-блоттинг (WB)

    Иммуногистохимическая экспрессия белков SOD2 нормальными яичниками и поликистозными яичниками с раком на ранних и поздних стадиях была подтверждена 1D-WB с использованием тех же антител, упомянутых выше (разведение 1 : 1000). Иммунореакции на мембране визуализировали как продукт хемилюминесценции (субстрат Super Dura West; Pierce/Thermo Fisher, Рокфорд, Иллинойс), и изображения получали с помощью ChemiDoc XRS (Bio-Rad, Hercules, CA).

    2.6. Полуколичественная и количественная полимеразная цепная реакция (RT-PCR/qRT-PCR)

    Изменения экспрессии мРНК IL-16 в связи с развитием OVCA у кур с поликистозными яичниками оценивали с помощью полуколичественной полимеразной цепной реакции с обратной транскрипцией. (ПЦР), как сообщалось ранее [25]. Для ПЦР-анализа с обратной транскрипцией были отобраны репрезентативные образцы нормальных яичников и яичников с поликистозными опухолями на ранней или поздней стадии на основании их реактивности в иммуногистохимии.Специфичные для кур праймеры IL-16 были разработаны с помощью программного обеспечения OligoPerfect Designer (Thermo Fisher Scientific, Waltham, MA) с использованием последовательности IL-16 из NCBI (GenBank NM_204352.3). Прямой праймер представлял собой 5-TCTCTGCTTTCCCCTGAA-GA, а обратный праймер — 5-GTCCATTGGGAAACACCT-TG, расположенный между экзонами 4 и 6. β -Актин использовали в качестве эндогенного контроля с прямым праймером TGCGTGACATCAAGGAGAAG и обратным праймером TGCGTGACATCAAGGAGAAG. ATGCCAGGGTACATTGTGGT. Ожидаемый размер ампликона IL-16 составлял 199 пар оснований, а для β -актина — 300 пар оснований.ПЦР-ампликоны визуализировали в 3% агарозном геле (Pierce/Thermo Fisher) в трис-ацетат-ЭДТА-буфере и окрашивали бромистым этидием. Изображение было получено с использованием системы ChemiDoc XRS (Bio-Rad, Hercules, CA). Количественную экспрессию гена IL-16 исследовали с помощью ПЦР в реальном времени (TaqMan Gene Expression Assays, Applied Biosystems™, Thermo Fisher Scientific, Waltham, MA).

    2.7. Проспективное исследование

    С помощью трансвагинального ультразвукового сканирования (ТВУЗИ) были отобраны 36 кур-несушек в возрасте 3–4 лет (), выращенных в аналогичных условиях, как упоминалось ранее, без кист или твердых образований в яичниках.Отобранных кур выращивали в аналогичных условиях, как указано выше, и проспективно наблюдали в течение 40 недель с помощью ТВУЗИ с 10-недельными интервалами, как сообщалось ранее [21]. Несушек подвергали эвтаназии при диагностике наличия солидных масс в яичниках во время проспективного наблюдения или в конце периода исследования (40 недель). Макроскопическую морфологию регистрировали, как указано выше.

    2.8. УЗИ

    Яичники у кур сканировали с использованием имеющейся в продаже системы для УЗИ, прикрепленной к эндовагинальному датчику (Ультразвуковая система MicroMaxx®, SonoSite Inc., Ботелл, Вашингтон). Сонографическую визуализацию выполняли, как сообщалось ранее [24, 26]. Вкратце, передающий гель наносили на поверхность эндовагинального датчика и покрывали крышкой датчика, после чего повторно наносили передающий гель на крышку датчика. Было выполнено двухмерное сканирование в полутоновом, цветном и импульсном допплеровском ТВУЗИ. Механические параметры оптимизировали с использованием полностью функциональных яичников у молодых кур-несушек и использовали в качестве контроля яичников с опухолями. Яичник и его соседние области визуализировались путем сканирования датчика после локализации фолликула.Оценка морфологических особенностей, включая кисты яичников и солидные массы, если они есть, выполнялась с помощью сканирования в градациях серого, и внимание уделялось количеству кист, а также развитию иерархических фолликулов, солидных участков и эхогенности. После того, как морфологические оценки были завершены, цветовой допплер активировался для обнаружения цветовых сигналов сосудов, а сигналы импульсных доплеровских волн записывались и использовались для анализа резистивных индексов. Все сканы TVUS (скриншоты) были заархивированы в цифровом виде в виде неподвижных клипов и клипов в реальном времени на односторонних записываемых цифровых видеодисках (формат DVD+RW; Maxell Corporation of America, Fair Lawn, NJ), которые можно было прочитать на персональном компьютере, как сообщалось ранее [ 26].

    2.9. Статистический анализ

    Различия в частоте иммунопозитивных клеток или интенсивности иммунного окрашивания среди нормальных яичников, а также яичников с поликистозом и раком на ранней или поздней стадии были проанализированы с использованием программного обеспечения GraphPad Prism (GraphPad Software Inc., Сан-Диего, Калифорния) и оценивается с помощью ANOVA и -тестов. Затем проводили попарные сравнения между группами (нормальные яичники или яичники с кистами и раком на ранней или поздней стадии) двухвыборочными тестами.Данные представлены как среднее  ± SEM; все сообщаемые значения являются двусторонними и считаются значимыми.

    3. Результаты
    3.1. Общий осмотр

    У кур-несушек левый яичник развивается до зрелого функционального яичника, тогда как правый яичник становится рудиментарным. Куры обычно несут по яйцу каждый день в течение 5–6 дней; после чего курица делает паузу на сутки. Затем она возобновляет откладку яиц на 5–6 дней (что называется размером кладки или последовательностью откладки). После эвтаназии у кур с нормальными и функциональными яичниками было 3–5 крупных преовуляторных иерархических фолликулов, несколько мелких желточных фолликулов и множество белых фолликулов, выступающих над поверхностью яичника без кист или масс твердой ткани (рис. 1(а)).Эти яичники были классифицированы как « нормальных яичника ». Из 130 кур в предварительном исследовании яичники у 8 кур имели заполненные жидкостью кисты яичников (количество кист,  = >25) разного размера (маленькие, средние и большие), выступающие над поверхностью яичника, а также твердую массу яичника либо ограничена частью яичников (ранняя стадия OVCA) или метастазирует в дистальные органы (поздняя стадия OVCA) (рис. 1(b) и 1(d)). Иногда в этих яичниках выявляли один или два преовуляторных фолликула.Эти яичники были классифицированы как поликистозных яичника с раком (PCOC) на ранней стадии (PCOC-ES) и поздней стадии (PCOC-LS). Опухоли у этих кур сопровождались асцитической жидкостью или без нее. Кроме того, у 19 кур без кист яичников солидная тканевая масса либо ограничивалась частью яичника (ранняя стадия OVCA, ), либо метастазировала в дистальные органы, сопровождаясь обильным асцитом (поздняя стадия OVCA, ).

    3.2. Наблюдения под микроскопом

    Из нормальных кур с функциональными яичниками случайным образом было отобрано 20 кур для микроскопического исследования.В яичниках нормальных кур наблюдались встроенные в строму фолликулы, включая примордиальные и первичные фолликулы, содержащие развивающиеся ооциты, окруженные гранулезным и недифференцированным слоями теки, и несколько атретических фолликулов (рис. 2(а)). У кур с СПКЯ на ранних и поздних стадиях наблюдали множественные кисты яичников с ооцитами или без них, встроенные в строму (рис. 2(б)). По сравнению с нормальными яичниками, в этих яичниках также было замечено много встроенных атретических фолликулов. В некоторых случаях стромальные кисты содержали гиперпластические клетки с фигурами митозов, указывающими на потенциальную злокачественную трансформацию (рис. 2(с)).Злокачественные клетки у кур с РПЯ были крупного размера с плеоморфными ядрами, содержащими множественные митотические фигуры (рис. 2(г)).

    3.3. Экспрессия маркеров клеточной пролиферации

    Неконтролируемая клеточная пролиферация является отличительной чертой рака, а Ki67 — маркер клеточной пролиферации, который обычно используется для определения клеточной пролиферации при злокачественной трансформации. Чтобы проверить, экспрессируют ли кисты у кур с поликистозными состояниями яичников и раком яичников Ki67, срезы окрашивали Ki67.Наблюдалась интенсивная экспрессия Ki67 злокачественными клетками СПКЯ (рис. 3). Сходные паттерны интенсивной экспрессии Ki67 обнаружены и в эпителиальных клетках кист. Некоторые из этих клеток в кистах были расположены в виде небольших кластеров (красные стрелки), тогда как некоторые имели нормальный вид монослоя эпителиальных клеток (черные стрелки) (рис. 3).

    3.4. Локализация макрофагов

    Клетки, окрашенные антимакрофагальными антителами, имели неправильную форму и локализовались в строме и слое теки фолликулов в нормальных яичниках (рис. 4(а)).У кур с СПКЯ на ранних и поздних стадиях макрофаги локализовались в строме, а также вблизи кист яичников (рис. 4(б) и 4(в)). По сравнению с нормальными яичниками многие макрофаги были локализованы в строме, окружающей опухоль и кисты (рис. 4(b) и 4(c)). Кроме того, по сравнению со слоями теки в нормальных стромальных фолликулах, многие макрофаги также наблюдались в кистах яичников.

    По сравнению с частотой макрофагов у кур с нормальными яичниками (6.77 ± 1,58 макрофагов на участке ткани 20 мм 2 ), частота макрофагов была достоверно выше () в строме ПКЯ на ранней стадии (17,33 ± 2,26 макрофагов на участке ткани 20 мм 2 ) и еще больше увеличивался в СПКЯ на поздней стадии (24,24 ± 2,50 макрофагов в 20 мм 2 площади ткани) (рис. 4(d)).

    3.5. Обнаружение клеток, экспрессирующих IL-16

    В строме нормальных яичников было обнаружено несколько клеток, экспрессирующих IL-16 (рис. 5(а)).Приток клеток, экспрессирующих IL-16, был обнаружен вблизи кист яичников в строме (рис. 5(b)). Более того, многие клетки, экспрессирующие IL-16, были локализованы в стромальной ткани, окружающей кисты и опухоли у кур с РПЯ (рис. 5(c)). Случайное окрашивание на IL-16 злокачественных клеток, а также клеток кист яичников также наблюдалось у кур с СПКЯ (рис. 5(с)).

    По сравнению с частотой клеток, экспрессирующих IL-16, у нормальных кур (6,32 ± 1,72 на 20 мм 2 площади ткани), частота стромальных клеток, экспрессирующих IL-16, была значительно выше () у кур с ПКОС в начале (17.43 ± 3,91 в 20 мм 2 площади ткани) и поздние стадии (22,83 ± 4,37 в 20 мм 2 площади ткани) (рис. 6(а)).

    Тканевая экспрессия IL-16, обнаруженная с помощью иммуногистохимии, была подтверждена исследованиями генной экспрессии, включая полуколичественную ПЦР и ПЦР в реальном времени. Как наблюдалось в иммуногистохимических исследованиях, сильная амплификация экспрессии мРНК IL-16 была обнаружена при СПКЯ на ранней и поздней стадиях (рис. 6 (б)). Эти наблюдения были дополнительно подтверждены количественной ПЦР, которая показала значительное увеличение экспрессии гена IL-16 при СПКЯ на ранних и поздних стадиях (рис. 6(с)).

    3.6. Интенсивность экспрессии SOD2

    Экспрессия SOD2 была локализована в цитоплазме эпителиальных, а также стромальных клеток нормальных яичников, кист яичников и злокачественных клеток при СПКЯ на ранних и поздних стадиях (рис. 7(а) и 7(в) ). Окрашивание SOD2 наблюдали в клетках стромы и гранулезы стромальных фолликулов в нормальных яичниках (рис. 7(а)). Однако окрашивание экспрессии SOD2 было сильнее в клетках кист яичников (рис. 7(b)) и злокачественных клетках при РПЯ (рис. 7(c)).

    В целом интенсивность экспрессии SOD2 значительно увеличивалась () по мере прогрессирования заболевания от нормального до PCOC-ES до PCOC-LS. По сравнению с интенсивностью экспрессии SOD2 в нормальных кур (15,7 × 10 5 ± 6,3 × 10 до 5 в 20 мм 2 площадь ткани), интенсивность окрашивания SOD2 (24,9 × 10 5 ± 14,3 × 10 5 в области ткани размером 20 мм 2 ) была значительно выше у кур с СПКЯ на ранней стадии ().Интенсивность окрашивания SOD2 еще больше увеличилась (34,7 × 10 5  ± 10,5 × 10 5 на площади ткани 20 мм 2 ) у кур с СПКЯ на поздней стадии (рис. 8(а)).

    Иммуноблоттинг был проведен для подтверждения иммуногистохимической экспрессии SOD2 тканями яичников. Размер полосы приблизительно 27 кДа был обнаружен в гомогенатах яичников (рис. 8(b)). По сравнению с нормальными яичниками экспрессия SOD2 была сильнее в гомогенатах поликистозных яичников с раком на ранней стадии (PCOC-ES) и поздней стадии (PCOC-LS) (рис. 8(b)).

    3.7. Оценка проспективного сонографического мониторинга

    Во время проспективного мониторинга сонографическая морфология больших преовуляторных фолликулов в оттенках серого показала темный круглый или овальный ооцит, содержащий концентрическое кольцо в центре каждого фолликула. По сравнению с функциональными преовуляторными фолликулами кисты яичников были разных размеров, заполнены жидкостью и имели неправильную форму с относительно тонкой и острой стенкой кисты без какого-либо концентрического кольца (рис. 9(а) и 9(б)). При проспективном наблюдении у 2 кур с поликистозом яичников были обнаружены небольшие солидные образования, ограниченные частью яичников (рис. 9(а) и 9(б)).У этих кур был предварительно диагностирован PCOC. С другой стороны, у 3 кур наблюдалось твердое образование в яичниках без каких-либо кист, и у этих кур был предварительно диагностирован OVCA. В целом, макроскопические исследования после эвтаназии кур в конце периода мониторинга подтвердили ультразвуковой прогноз о том, что у 2 из 36 кур был СПКЯ (рис. 9(с)), а у 3 кур были опухоли яичников без кист в яичнике. После макроскопической оценки опухоли также были подтверждены обычной гистологией, как упоминалось ранее (рис. 9(d)).

    4. Обсуждение

    Это первое исследование, сообщающее о спонтанной заболеваемости поликистозом яичников у кур-несушек, доклинической модели спонтанного рака яичников. Эта исследовательская часть этого исследования показала, что примерно 6% кур с опухолями яичников имели поликистоз яичников, что позволяет предположить, что поликистоз яичников может быть потенциальным фактором риска развития спонтанного рака яичников. Это предположение основано на результатах проспективного наблюдения за курами, у которых у подгруппы с поликистозом яичников развился спонтанный рак яичников.Результаты этого исследования также свидетельствуют о преобладании вялотекущих хронических воспалений при развитии и прогрессировании спонтанного рака яичников у кур с поликистозом яичников. Это исследование также предполагает, что стойкий окислительный стресс может быть связан с вялотекущим воспалением яичников, а стойкий окислительный стресс в поликистозных яичниках может быть причиной злокачественной трансформации этих яичников.

    Яичники у женщин с СПКЯ содержат множественные кисты [27].В этом исследовании, как и у женщин, у кур с поликистозом яичников и раком на ранней стадии было более 25 заполненных жидкостью кист разного размера в яичниках. Кроме того, поликистоз яичников у кур сопровождался меньшим количеством (только один или два) преовуляторных функциональных (овулирующих) фолликулов по сравнению с их нормальными аналогами. Таким образом, скорость яйцекладки (показатель скорости овуляции) у этих кур также была значительно ниже, что указывает на то, что поликистоз яичников у кур связан со сниженной скоростью овуляции и скорости яйцекладки.Таким образом, наличие множественных кист вместе со сниженной яйценоскостью может свидетельствовать о дефектах функции яичников, включая рост фолликулов и/или овуляцию у этих кур. Эндокринный дисбаланс может быть одним из таких дефектов, связанных со снижением функции яичников, как предполагается у людей [28]. Основные физиологические процессы функции яичников, включая рост фолликулов, созревание и овуляцию, контролируются эндокринной регуляцией у кур и человека [29]. Кроме того, появляющаяся информация указывает на потенциальную связь дополнительных неэндокринных состояний, включая хроническое воспаление яичников, с частотой СПКЯ у женщин.Кроме того, хроническое воспаление и неустраненный окислительный стресс являются предрасполагающими факторами к злокачественной трансформации [18]. Это исследование показало, что по сравнению с нормальными яичниками частота макрофагов и клеток, экспрессирующих IL-16 (провоспалительный и хемотаксический цитокин), была выше в поликистозных яичниках с раком на ранней и поздней стадиях. Кроме того, приток IL-16 был обнаружен в непосредственной близости кист яичников в строму. Более того, иммунореакция на экспрессию IL-16 также была обнаружена в эпителиальных клетках (внутренняя выстилающая стенка) кист в строме.IL-16 представляет собой провоспалительный цитокин, секретируемый макрофагами, CD8 T-клетками и эпителиальными клетками [14, 30, 31]. IL-16, хемоаттрактант, приводит к возвращению других иммунных клеток в место повреждения и воспаления, что приводит к окислительному взрыву, который впоследствии вызывает окислительный стресс [32, 33]. Эти результаты позволяют предположить, что состояние слабовыраженного воспаления связано с развитием поликистоза яичников. Хроническое воспаление является следствием хронической активации иммунных клеток и увеличения секреции провоспалительных цитокинов и хемокинов, включая IL-18, моноцитарный хемоаттрактантный белок-1 (MCP-1) и макрофагальный воспалительный белок-1 α (MIP-1). α ) [34–36].Сообщалось о преобладании вялотекущего воспалительного состояния у женщин с синдромом поликистозных яичников, у которых яичники были инфильтрированы макрофагами [19, 37, 38]. Это исследование также показало увеличение популяции макрофагов и их секреторного провоспалительного продукта, клеток, экспрессирующих IL-16, в связи с СПКЯ яичников. Однако неизвестно, требуется ли слабовыраженное воспалительное состояние для развития поликистоза яичников.

    Предположение о том, что стойкий окислительный стресс и хроническое слабовыраженное воспаление являются предрасполагающими факторами для развития поликистоза яичников и последующего развития рака яичников, основано на наблюдении повышенной экспрессии SOD2 яичниками кур.В настоящем исследовании наблюдалась экспрессия антиоксидантного фермента СОД2 клетками кист яичников и злокачественными клетками при СПКЯ на ранних и поздних стадиях. SOD2 играет важную роль в нейтрализации реактивных свободных окислительных радикалов. Приток иммунных клеток к месту хронического повреждения (например, овуляторные повреждения в яичнике) и последующее развитие окислительного стресса может привести к хроническому воспалению [11]. Во время окислительного стресса активные формы кислорода (АФК), включая супероксиды, продуцируются как побочные продукты митохондриальной цепи переноса электронов [39].Супероксиды высокотоксичны, вызывая преждевременную гибель клеток, а клетки увеличивают экспрессию SOD2, чтобы противостоять окислительному стрессу [40, 41]. SOD2 поглощает супероксиды и превращает их в перекись водорода и двухатомный кислород и, таким образом, защищает клетки от гибели [42]. Таким образом, повышенная экспрессия SOD является суррогатным маркером окислительного стресса, а также воспаления.

    Повышенная экспрессия SOD2 в кистах и ​​опухолях яичников у кур с РПЯ, наблюдаемая в этом исследовании, может быть ответом на окислительный стресс из-за повышенной инфильтрации иммунными клетками (макрофагами и клетками, экспрессирующими IL-16) в поликистозных яичниках и последующим развитие ПКОС.Было показано, что макрофаги инфильтрируются в яичники при СПКЯ [11], а SOD2 способствует выживанию опухолевых клеток от смерти, связанной с окислительным стрессом, в микроокружении опухоли, включая светлоклеточный рак яичников [43] и нейроэндокринные опухоли [44]. Кроме того, предполагается, что макрофаги связаны со злокачественным прогрессированием. Сообщалось, что IL-16 перемещается из цитоплазмы в ядро, где он стимулирует экспрессию MDM2, ингибитора опухолевого супрессора p53.Ингибирование p53 может привести к неконтролируемому росту аномальных клеток, что приводит к злокачественным новообразованиям [45]. Было также показано, что IL-16 связан со злокачественными новообразованиями, включая развитие и прогрессирование лейкемии и рака яичников [46]. Сообщалось, что эндокринно-иммунное взаимодействие участвует в регуляции нормальной и аномальной функции яичников. Таким образом, в контексте хронического и длительного неразрешенного воспаления члены иммунной системы могут модулировать эндокринную физиологию яичников, приводя к развитию поликистоза яичников, который может быть вовлечен в последующее развитие рака яичников у кур.В пользу этого предположения говорит и сходство экспрессии маркера клеточной пролиферации и злокачественной трансформации (Ki67) клетками кист.

    Это исследование имеет несколько трансляционных аспектов. Отсутствие легкодоступной спонтанной модели является серьезным препятствием для получения информации об этиопатогенезе поликистоза яичников и СПКЯ. Отсутствие доклинической модели спонтанного рака яичников также влияет на исследования, направленные на получение информации, необходимой для разработки интервенционных стратегий при поликистозе яичников и раке яичников.Модели индуцированного поликистоза яичников на грызунах не представляют спонтанного СПКЯ. СПКЯ у человека представляет собой состояние с многофакторной этиологией и гетерогенным характером. Более того, у моделей на грызунах не развиваются долгосрочные риски патологии яичников, включая спонтанный рак яичников. Таким образом, наблюдения на моделях грызунов, включая гормональную индукцию и генетические мутации, трудно перенести в клинику для изучения риска поликистоза яичников с последующим развитием рака яичников.Напротив, как наблюдалось в наших предварительных исследованиях, за которыми последовали проспективные исследования, у кур-несушек спонтанно развивается поликистоз яичников с признаками, аналогичными тем, которые наблюдаются у людей (включая множественные заполненные жидкостью кисты, снижение скорости овуляции и стойкое слабовыраженное воспаление). ). Кроме того, OVCA у кур также экспрессирует несколько маркеров, сходным образом экспрессируемых в OVCA человека. Кроме того, существует сходство в эндокринном контроле функции яичников у кур и человека.Более того, куры-несушки широко доступны, легкодоступны, рентабельны по сравнению с грызунами и просты в управлении. Кроме того, доступность неинвазивного трансвагинального ультразвукового сканирования для проспективного мониторинга также способствует возможности использования кур-несушек в качестве модели для получения информации о спонтанном развитии поликистоза яичников и СПКЯ, что трудно изучать у человека.

    Это исследование также имеет некоторые ограничения, включая меньшее количество образцов, а также продолжительность проспективного наблюдения за курами на предмет развития поликистоза яичников и последующего прогрессирования рака яичников.Во-первых, хотя СПКЯ у женщин является сложным заболеванием с гетерогенной этиологией, для диагностики СПКЯ доступны некоторые установленные и общепринятые рекомендации. Поскольку это первое исследование ПКЯ у кур, к сожалению, таких критериев для диагностики ПКЯ у кур нет. Тем не менее, это исследование показало несколько особенностей, связанных с поликистозом яичников, включая количество кист, повышенную частоту макрофагов, окислительный стресс и воспаление у кур, аналогично наблюдаемым у людей с поликистозом яичников [11, 27, 38].Во-вторых, дополнительные признаки СПКЯ у человека, включая развитие инсулинорезистентности и гиперандрогении, у кур не изучались. Однако было показано, что эти особенности СПКЯ человека являются следствием окислительного стресса [11], и это исследование также показало усиление окислительного стресса у кур с СПКЯ. В-третьих, одним из ограничений этого исследования является то, что в нем изучались нормальные куры и куры с ПКЯ с ранней и поздней стадиями OVCA, но не изучались куры только с ПКЯ без опухоли яичников.Тем не менее, проспективная часть этого исследования смягчила это ограничение, поскольку в нем наблюдали за курами только с поликистозом яичников, диагностированным с помощью ультразвукового сканирования, чтобы определить развитие OVCA у кур с поликистозом яичников. В-четвертых, в этом исследовании SOD2 использовался в качестве маркера окислительного стресса, который не может быть сильным и надежным маркером окислительного стресса. Однако SOD2 использовался в качестве маркера окислительного стресса, и было показано, что он предотвращает окислительный стресс [41]. Кроме того, сообщалось, что SOD2 способствует метастазированию опухоли [27, 43].Кроме того, был выбран SOD2, так как он ингибирует экспрессию воспалительных цитокинов [47]. Несмотря на все эти ограничения, наблюдения этого исследования приведут к тому, что куры-несушки станут моделью спонтанного поликистоза яичников для изучения его долгосрочных рисков, включая OVCA. Кроме того, эта модель также будет полезна для исследования по разработке профилактических мер против возникновения поликистоза яичников и последующего риска развития рака яичников.

    5. Выводы

    В заключение, результаты этого исследования показывают, что у кур-несушек спонтанно развивается поликистоз яичников, который связан с хроническим воспалением и окислительным стрессом. Поскольку воспаление и хронический стресс являются признаками злокачественного развития, поликистоз яичников может быть потенциальным фактором риска последующего развития рака яичников. Это предположение основано на наших наблюдениях при проспективном наблюдении за курами с ПКО, у которых позже развилась СОПП. Таким образом, курица-несушка предлагает потенциальную модель для получения информации об этиологии спонтанного возникновения поликистоза яичников и его долгосрочного риска развития рака яичников.Эта модель также будет полезна для разработки стратегий профилактики поликистоза яичников и риска развития OVCA.

    Доступность данных

    Данные, использованные для поддержки результатов этого исследования, можно получить у соответствующего автора по запросу.

    Конфликт интересов

    Авторы заявляют, что у них нет конкурирующих интересов в отношении публикации этой статьи.

    Благодарности

    Мы благодарим Уильяма Ханафина, MS, научного сотрудника отдела зоотехники Иллинойского университета в Урбане-Шампейне за помощь в сборе тканей кур.Мы также благодарим Katie L. Grott, BS, менеджера Университета Иллинойса на Исследовательской птицефабрике Urbana-Champaign, за содержание кур. Это исследование было поддержано Национальным институтом здравоохранения США/Национальным институтом рака, номер награды (NIH/NCI CA187309) и организацией Swim Across America.

    Синдром поликистозных яичников | Кедры-Синай

    Обзор

    Синдром поликистозных яичников, также известный как СПКЯ, вызывается гормональным дисбалансом, препятствующим нормальной овуляции.Гирсутизм, акне или андрогенная алопеция — это состояния, которые могут быть результатом повышенного производства мужских гормонов, называемых андрогенами, у женщин с СПКЯ.

    Название синдром поликистозных яичников происходит от кистозного вида яичников больных женщин. Также называемый синдромом Штейна-Левенталя, поликистоз — это термин, который просто означает «множество кист». Поликистоз яичников обычно содержит множество мелких — обычно менее 1 сантиметра — кист (заполненных жидкостью мешочков). Эти кисты обычно располагаются вокруг поверхности или чуть ниже поверхностного слоя яичника.При непосредственном осмотре или с помощью ультразвука эти маленькие кисты обычно выглядят как жемчужная нить. Яичники пораженных женщин могут быть немного увеличены по сравнению со здоровыми яичниками.

    Каждая из этих небольших кист представляет собой фолликул, содержащий одну яйцеклетку, которая пытается развиться до стадии, когда она будет готова к выходу из яичника (процесс, известный как овуляция). Однако из-за сложной биохимической ситуации в яичниках при СПКЯ развитие этих фолликулов останавливается слишком рано, что приводит к скоплению мелких фолликулов и отсутствию овуляции.Это отсутствие овуляции является причиной того, что женщинам с СПКЯ обычно трудно забеременеть.

    СПКЯ может увеличить риск развития других состояний или заболеваний с течением времени, таких как диабет, высокий уровень холестерина, болезни сердца и гиперплазия эндометрия.

    Симптомы

    Симптомы СПКЯ сильно различаются и схожи с симптомами других состояний. Следовательно, женщины с этими симптомами не обязательно имеют СПКЯ.

    Симптомы включают:

    • Избыточный рост волос (гирсутизм), угри или облысение
    • Бесплодие
    • Нерегулярная овуляция и аномальные менструальные периоды
    • Ожирение и резистентность к инсулину
    • Поликистоз яичников

    Избыточный рост волос, прыщи или облысение

    Женщины, страдающие СПКЯ, обычно жалуются на чрезмерный рост волос, угревую сыпь или облысение (выпадение или истончение волос на голове).Гирсутизм относится к избыточному росту грубых, часто длинных и темных волос по мужскому типу на лице, груди, животе, спине, руках и ногах. Облысение, также называемое андрогенной алопецией, относится к потере или истончению волос на голове.

    Гирсутизм, акне или андрогенная алопеция могут быть результатом повышенной выработки мужских гормонов, называемых андрогенами, у женщин с СПКЯ. Яичники и часто надпочечники женщин с СПКЯ вырабатывают избыточное количество андрогенов. Избыток мужских гормонов циркулирует в крови и действует на волосяные фолликулы в коже, стимулируя рост длинных, грубых и обычно темных волос.Они также вызывают прекращение роста волос на коже головы, что приводит к облысению. Избыток андрогенов также приводит к перепроизводству кожного сала, что приводит к закупорке пор и появлению прыщей.

    Помимо того, что гирсутизм, акне и андрогенная алопеция считаются серьезной косметической проблемой для многих женщин, они могут указывать на основную проблему, вызывающую серьезную озабоченность, — повышенный уровень андрогенов. Имеются данные, свидетельствующие о том, что длительное повышение уровня андрогенов у женщин с СПКЯ может привести к проблемам с уровнем холестерина и других липидов, которые являются факторами риска сердечно-сосудистых заболеваний.

    Важно отметить, что не у всех женщин с гирсутизмом, акне или алопецией есть СПКЯ. Кроме того, не у всех женщин с гирсутизмом обнаруживается повышенный уровень андрогенов. И наоборот, не у всех женщин с СПКЯ будет гирсутизм.

    Важным фактором развития или отсутствия развития гирсутизма является расовая и этническая принадлежность. Было показано, что женщины восточноевропейского происхождения подвержены повышенному риску проявления гирсутизма, тогда как у азиатских женщин рост волос будет незначительным или отсутствующим, несмотря на одинаковые уровни андрогенов.


    Бесплодие

    Женщины с СПКЯ часто испытывают трудности с беременностью. При СПКЯ нарушены как овуляция (выход яйцеклетки из яичника), так и развитие эндометрия. Нормальная фертильность требует, чтобы яичник выпустил яйцеклетку или яйцеклетку, которая может быть оплодотворена мужской спермой. После оплодотворения развивающийся эмбрион должен попасть в матку, где эндометрий развит надлежащим образом, чтобы обеспечить продолжение беременности.

    У женщин с СПКЯ не происходит нормальной овуляции, в результате чего их эндометрий не развивается должным образом.Важно помнить, что не у всех бесплодных женщин есть СПКЯ. Существует много причин бесплодия, из которых СПКЯ — только одна.

    Также важно помнить, что женщины с СПКЯ могут забеременеть, в одних случаях естественным путем, а в других — с помощью лекарств или вспомогательных репродуктивных технологий. Тот факт, что у женщины СПКЯ, не означает, что она не может забеременеть самостоятельно.


    Нерегулярная овуляция и аномальные менструальные периоды

    Одним из характерных признаков СПКЯ являются нерегулярные менструации.У женщин с СПКЯ обычно интервалы между менструациями намного больше, чем стандартные 28 дней. Между этими женщинами нередко проходит несколько месяцев между менструациями или даже нет менструаций вообще.

    Когда менструальные периоды сильно разделены, это называется олигоменореей. Когда у женщины шесть месяцев нет менструации, это называется аменореей.

    Чтобы понять, что вызывает у женщин с СПКЯ нерегулярные менструации, нам необходимо установить связь между яичником и маткой.Яичник вырабатывает гормоны (эстроген и прогестерон), которые отвечают за развитие внутренней оболочки матки, называемой эндометрием. Работа эндометрия заключается в том, чтобы реагировать на эти гормоны таким образом, чтобы беременность развивалась в матке, если произойдет оплодотворение яйцеклетки. Чтобы эндометрий правильно реагировал на гормоны яичников, яичники должны вырабатывать эти гормоны очень организованным образом. Очень важный процесс овуляции поддерживает эту организацию.

    Яичники женщин с СПКЯ не регулярно овулируют (выпускают яйцеклетку). Следовательно, гормоны, вырабатываемые этими яичниками, не вырабатываются организованно, как того требует эндометрий. Результатом этого неорганизованного производства гормонов женщина с СПКЯ видит нерегулярные менструальные циклы. Обычно, когда у женщины с СПКЯ редкие менструации, они могут быть очень тяжелыми.

    Важно понимать, что не у всех женщин с нерегулярными менструациями есть СПКЯ.Существует МНОЖЕСТВО причин нерегулярных менструаций, и женщины с нерегулярными менструациями должны пройти обследование у врача, чтобы определить причину. Также важно помнить, что не у всех женщин с нерегулярной овуляцией есть СПКЯ, и не у всех пациенток с СПКЯ нерегулярные менструации. Многие женщины, которые думают, что у них «регулярные» менструальные кровотечения или менструации, на самом деле не имеют регулярной овуляции. Следовательно, тщательная оценка овуляции пациенток должна проводиться у женщин, которые думают, что у них «регулярные циклы», но имеют другие признаки СПКЯ, такие как гирсутизм.


    Ожирение и резистентность к инсулину

    Многие женщины с синдромом поликистозных яичников (СПКЯ) имеют избыточный вес, хотя от одной трети до половины женщин с СПКЯ имеют нормальный вес. Таким образом, у женщин, не страдающих ожирением, также может быть СПКЯ.

    Многие женщины с СПКЯ имеют некоторую степень резистентности к инсулину. Инсулин — это гормон, вырабатываемый поджелудочной железой, который отвечает за переработку сахаров (то есть углеводов), которые мы потребляем с пищей. Инсулинорезистентность — это состояние, при котором ткани организма не реагируют должным образом на нормальные уровни инсулина.Это заставляет поджелудочную железу производить большее количество инсулина для обработки того же количества сахаров. По мере ухудшения резистентности к инсулину поджелудочная железа вынуждена вырабатывать все возрастающее количество инсулина. Если резистентность к инсулину становится настолько серьезной, что поджелудочная железа не может вырабатывать достаточное количество инсулина для удовлетворения потребностей организма, у пациента развивается сахарный диабет.

    Пример черного акантоза.

    Инсулинорезистентность при СПКЯ усугубляется избыточным весом или ожирением.Признаком инсулинорезистентности является черный акантоз, хотя не у всех инсулинорезистентных женщин есть акантоз. Точная причина резистентности к инсулину у женщин с СПКЯ еще не ясна. Большое количество исследований направлено на то, чтобы узнать больше о резистентности к инсулину, о том, почему она возникает и как лучше всего ее лечить.

    Однако хорошо известно, что снижение веса у женщин с избыточным весом с СПКЯ значительно улучшит резистентность к инсулину. В дополнение к улучшению резистентности к инсулину снижение веса также может улучшить многие другие признаки и симптомы СПКЯ.Например, женщины с избыточным весом, страдающие СПКЯ и резистентностью к инсулину, которые теряют вес, могут восстановить нормальную овуляцию, нормальный менструальный цикл и нормальную фертильность.

    Хотя ученые все еще находятся в процессе понимания связи между ожирением, резистентностью к инсулину и СПКЯ, очевидно, что существует какая-то общая связь, связывающая все эти факторы вместе. Важно понимать, что не все женщины с ожирением страдают СПКЯ. И наоборот, не все женщины с СПКЯ имеют избыточный вес.Также важно отметить, что существует связь между СПКЯ, избыточным весом и повышенным риском развития диабета.

    Диагностика

    СПКЯ имеет такой широкий спектр симптомов, что ни один тест не может быть использован для диагностики синдрома. В зависимости от ваших симптомов может быть проведено несколько обследований и тестов для диагностики СПКЯ.

    К ним относятся:

    • Анализы крови
    • Анализы уровня инсулина
    • История болезни
    • Тазовый осмотр
    • Анализы уровня щитовидной железы
    • Трансвагинальное УЗИ
    • Анализ мочи

    Если у вас диагностирован СПКЯ, вам необходимо будет ежегодно проходить анализы для определения уровня инсулина, глюкозы, холестерина и триглицеридов.Регулярное тестирование поможет снизить риск любых долгосрочных осложнений.

    Имейте в виду, что не у всех женщин, у которых на УЗИ обнаружены поликистозные яичники, есть СПКЯ. Поликистоз яичников является структурной находкой яичника, и эту единичную находку не следует путать со всем синдромом. На самом деле, у многих женщин, у которых нет других признаков или симптомов СПКЯ, на УЗИ были обнаружены яичники, выглядящие как поликистозные.

    Многие женщины слышат термин «поликистоз яичников» и связывают его с раком яичников.Это не тот случай. Поликистоз яичников не является раком, и диагноз СПКЯ не означает, что у вас рак. Кроме того, если вам сказали, что у вас была или в настоящее время есть киста яичника, это не означает, что у вас СПКЯ. Помните, что нормальный яичник создает кисту каждый месяц в процессе овуляции. Наличие или наличие в анамнезе кисты яичника не является признаком СПКЯ.

    Чтобы определить причину гирсутизма, ваш врач возьмет анализы крови на различные уровни гормонов. Ваш врач может также назначить УЗИ органов малого таза или рентген, чтобы убедиться, что у вас нет опухоли яичников или надпочечников.Надпочечники также можно проверить, выполнив тест стимуляции надпочечников.

    Лечение

    Поскольку специфического лечения СПКЯ не существует, лечение направлено на купирование симптомов СПКЯ и предотвращение долгосрочных осложнений.

    Некоторые методы лечения могут включать:

    Медикаментозная терапия — Включая противозачаточные таблетки для коррекции нерегулярных менструальных циклов, препараты, повышающие чувствительность к инсулину, препараты для лечения бесплодия, таблетки для похудения и лекарства от прыщей.

    Косметическая терапия , которая может включать процедуры по удалению волос и устранению прыщей.

    Заместительная гормональная терапия может быть назначена для коррекции гормонального дисбаланса, связанного с СПКЯ.

    Консультации по питанию доступны для лечения ожирения и облегчения резистентности к инсулину.

    Операция по удалению яичников или матки (двусторонняя сальпингоовариэктомия или гистерэктомия) является вариантом для женщин с выраженными симптомами СПКЯ, которые не хотят будущих беременностей.

    Чтобы остановить прогрессирование гирсутизма, большинству женщин следует сначала назначить гормональную терапию, как правило, обычные противозачаточные таблетки. После того, как гормональное лечение подействует в полной мере, можно использовать электроэпиляцию для окончательного удаления любых оставшихся волос.

    Кремы для лица, восковая эпиляция и средства для бритья также помогают избавиться от нежелательных волос.

Добавить комментарий

Ваш адрес email не будет опубликован.