Постгеморрагический шок: 19.03.2021 Геморрагический шок: клинические рекомендации

Содержание

Сердечная недостаточность (В.И. Целуйко, д.м.н., профессор, заведующая кафедрой кардиологии и функциональной диагностики Харьковской медицинской академии последипломного образования)

Сердечная недостаточность

 

В.И. Целуйко, д.м.н., профессор, заведующая кафедрой кардиологии и функциональной диагностики

Харьковской медицинской академии последипломного образования

 

Сердечная недостаточность (СН) — клинический синдром, включающий следующие признаки: клинические симптомы сердечной недостаточности (одышка в покое или при физической нагрузке и/или слабость, утомляемость, застойные явления в легких и/или отеки на нижних конечностях), а также объективные доказательства структурной или функциональной патологии сердца в состоянии покоя.

 

Эпидемиология

 

СН является одной из наиболее важных проблем здравоохранения всех развитых стран мира, так как у 1,5-2% населения имеются ее признаки.

Проблема распространенности хронической СН (ХСН) во многом определяется увеличением продолжительности жизни людей, то есть «старением» населения планеты. В странах Западной Европы ХСН встречается у 2,9-3,9% населения. Показатель распространенности СН зависит от возраста пациента и увеличивается с каждым десятилетием жизни. В возрастной группе 25-34 года он составляет 0,02 на 1000 населения, от 45 до 54 лет — 2,1, а от 75 до 84 лет — 54 случая на 1000 населения.

 

Этиология

 

Сердечная недостаточность — синдром, который сопровождает многие заболевания сердца. Наиболее частыми причинами развития СН являются ишемическая болезнь сердца (ИБС) — около 70%, артериальная гипертензия (АГ) — 17,1%, клапанные пороки сердца — 10%, кардиомиопатии — 10%. Следует отметить, что иногда определить причину СН не удается.

Течение и прогрессирование СН существенным образом зависит не только от этиологии, но и от фона, на котором протекает заболевание. Факторы, которые способствуют прогрессированию СН:

— кардиальные: нарушения ритма и проводимости, инфаркт миокарда;

— не кардиальные: инфекции, патология щитовидной железы, хроническая почечная недостаточность, физическое и эмоциональное перенапряжение, злоупотребление алкоголем, жидкостью, солью, эмболия легочных сосудов.

Прием препаратов, способствующих СН: антиаритмические препараты (кроме амиодарона), НПВП, глюкокортикоиды, антагонисты кальция (кроме амлодипина и фелодипина), вазодилататоры непрямого действия (ингибиторы фосфодиэстеразы), α- и β-адреностимуляторы, противоопухолевые препараты, некоторые антибиотики, антигипертензивные препараты центрального действия.

Физические воздействия: радиация, гипертермия, гипотермия, сигаретный дым.

Классификация СН включает:

1. Клиническую стадию СН.

2. Вариант сердечной недостаточности.

3. Функциональный класс.

Выделяют следующие клинические стадии: СН-І, СН-ІІА, СН-ІІБ, СН-ІІІ. Все они отвечают соответствующим стадиям хронической недостаточности кровообращения по классификации Н.Д. Стражеско-В.Х. Василенко (1935).

І стадия. Скрытая недостаточность кровообращения, проявляющаяся только при физической нагрузке (одышка, тахикардия, чрезмерное утомление и т. п.). В покое гемодинамика и функции органов не нарушены. Трудоспособность снижена.

Патогенез геморрагического шока — Медицина — Наука — Каталог статей

Причинами геморрагического шока у рожениц и родильниц являются преждевременная отслойка нормально расположенной плаценты, предлежание плаценты, разрыв матки, гипо- и атония матки в раннем послеродовом периоде и некоторые другие осложнения.

 

«Шок» — не конкретный диагноз, а собирательное название ряда патологических состояний различной этиологии. Различают травматический, геморрагический, бактериально-токсический, кардиогенный, а также гипо-, нормо- и гиперволемический, гипо-, нормо- и гипертензивный шок и т. д. Широкое использование термина «шок» привело к его неправильному применению в отдельных разделах медицины: «гинекологический шок», «акушерский шок», «хирургический шок» и др.

 

Термин «шок» следует использовать только для обозначения тяжелых состояний, связанных с травмой, крово-потерей, ожогом, инфекцией, при которых отмечается определенный комплекс патологических воздействий на организм. Понятие «шок» в сознании врача всегда отождествляется с тяжелым состоянием больного, необходимостью оказания срочной помощи, является сигналом тревоги и стимулом к немедленному лечению больного. С патофизиологической точки зрения, «шок» — это кризис микроциркуляции, ее неспособность обеспечить адекватный тканевый обмен, удовлетворить потребности тканей в кислороде, энергетических продуктах, удалить токсические продкты обмена. Патофизиологические изменения в организме, развивающиеся в ответ на кровопотерю, обозначают как «геморрагический шок». Многие авторы противопоставляют понятия «геморрагический шок», «кровопо-теря» или «коллапс».

Как правило, основанием для этого являются результаты экспериментальных работ, в которых стремятся получить модель «чистой» кровопотери или «чистой» травмы (кровопускание, сдавление конечности и т. д.).

В клинике, где травма и кровотечение всегда неразрывны и одновременно формируют патофизиологический процесс, разделение шока и кровопотери абсолютно неоп-равдано. Следует учитывать и то обстоятельство, что у многих беременных женщин имеется «готовность к шоку» в связи с хроническими циркуляторными, метаболическими, дистрофическими изменениями на фоне соматических заболеваний, позднего токсикоза и других осложнений беременности. Осложненный родовой акт, сопровождающийся утомлением, травмой и болями, также не только снижает толерантность роженицы к кровопотере, но и в значительной степени способствует развитию геморрагического шока.

 

В патогенезе геморрагического шока основную роль играет несоответствие между уменьшающимся в связи с кровотечением объемом циркулирующей крови (ОЦК) и емкостью сосудистого русла. Дефицит ОЦК обусловливает снижение венозного возврата к правому сердцу, уменьшение ударного и минутного объема, снижение артериального давления. В ответ на это включаются физиологические приспособительные механизмы, основными из которых являются: 1) перераспределение крови в сосудистом русле; 2) перераспределение жидкостей тела с поступлением интерстициальной жидкости в кровоток, т. е. аутогемодилюция; 3) рефлекторная активация вазомоторного’ центра, обусловливающая резкое повышение содержания в крови вазоактивных веществ (катехоламины, серотонин и др.), что приводит к периферическому сосудистому спазму.

 

Первые два механизма способны компенсировать кро-вопотерю, если она не превышает 20% ОЦК (1000 мл). Кровь из сосудов пищеварительного тракта, мышц, подкожных сплетений поступает в центральную сосудистую сеть, происходит также разведение крови, поступающей в кровоток, внеклеточной жидкостью, что сопровождается снижением концентрации гемоглобина и уменьшением числа эритроцитов.

У родильниц перераспределение крови в значительной степени происходит за счет крови, поступающей из матки — это дополнительные объемы, появляющиеся в процессе развития беременности и необходимые для обеспечения нормального маточно-плацентарного кровотока. При кровопотерях, превышающих 20—25% ОЦК (1000—1200 мл), этих двух механизмов компенсации гиповолемии недостаточно и ведущей защитной реакцией организма является спазм периферических сосудов, способствующий поддержанию удовлетворительного состояния центральной гемодинамики и нормального или близкого к норме артериального давления. Важную роль в развитии этой реакции играет сужение венозной части сосудистого русла, так как именно в ней, как в системе низкого давления, содержится до 60—70% объема крови.

 

Развиваясь как защитная реакция, периферический сосудистый спазм в дальнейшем становится одной из причин возникновения необратимого шока, способствуя последовательному развитию нарушений микроциркуляции. Эти нарушения имеют следующие фазы: 1) вазокон-стрикция, сопровождающаяся открытием артериовенозных шунтов и снижением кровотока в капиллярах; 2) расширение сосудистого пространства: нарастающая гипоксия тканей обусловливает открытие дополнительного числа капилляров, не функционирующих (функционирующих циклами) при физиологических состояниях организма.

Капиллярное русло составляет 5—15% всего кровотока, поэтому расширение капиллярной сети приводит к еще большему несоответствию между объемом крови и емкостью сосудистого русла. В результате этого происходит прогрессирующее замедление кровотока в периферическом сосудистом звене, развиваются гипо- и аноксия, переходящие в анаэробный метаболизм и сопровождающиеся накоплением недоокисленных продуктов, гистамина и других веществ. Одновременно ухудшается центральная гемодинамика: еще больше уменьшается венозный возврат и минутный объем сердца, снижается артериальное давление; 3) диссеминированное внутрисосудистое свертывание крови (ДВС), которое развивается вследствие активации внутренней системы гемостаза на фоне нарастающего ацидоза. Важную роль в активации свертывающей системы играет кровяной тромбопластин, освобождающийся в результате агглютинации и гемолиза секвестрированных эритроцитов. В связи с образованием фибриновых тромбов в периферическом кровотоке еще больше нарушается тканевая перфузия.
Развивается тяжелый локальный метаболичесий ацидоз с дистрофией и некрозом тканей. Одновременно при лабораторных исследованиях регистрируется прогрессирующая коагулопатия потребления, которая в этой стадии шока также может явиться источником тяжелого кровотечения; 4) необратимый шок. Как реакция на ДВС происходит активация фибринолитической системы. Сгустки лизируются и не препятствуют кровотоку, но изменения в органах к этому времени уже необратимы.

 

Описанная фазность изменений представлена в работах С. Hardaway и соавт. (1967) и др. Некоторые авторы выделяют только три фазы нарушений микроциркуляции: вазоконстрикцию, дублированные нарушения со спазмом одних и дилатацией других сосудов и периферическую вазодилатацию [Соловьев Г. М., Радзивил Г. Г., 1973].

 

Выделение описанных фаз шока в значительной мере условно, так как в любой из них изменения периферического кровообращения носят смешанный характер. В связи с этим, выделяя патофизиологические стадии шока, следует иметь в виду лишь преимущественное соответствие состояния микроциркуляции той или иной фазе.

 

Периферический вазоспазм при геморрагическом шоке способствует: 1) прогрессирующему ухудшению реологических свойств крови, замедлению кровотока вплоть до стаза; 2) возникновению гипоксии, тяжелого метаболического ацидоза, дистрофии и некроза тканей; 3) гемолизу секвестрированных эритроцитов и развитию синдрома

 

две.

 

Ухудшение реологических свойств крови при шоке проявляется повышением ее вязкости и уменьшением текучести. В результате этого часть крови выключается из активной циркуляции: кровь задерживается (секвестрируется) в периферических сосудах, форменные элементы разрушаются. Этот процесс протекает следующим образом. При замедленном течении крови через разветвления мелких сосудов происходит ее расслоение на плазму и эритроциты, заполняющие разные капилляры. Теряя плазму, эритроциты теряют способность к передвижению и скапливаются в виде медленно циркулирующих, а затем нециркулирующих образований. Находясь в состоянии стаза, они агрегируют и в дальнейшем лизируются, высвобождая связанный с их стромой кровяной тромбо-пластин. Поступление в кровоток тромбопластина вызывает процесс внутрисосудистого свертывания крови. Выпадающие при этом нити фибрина опутывают глыбки эритроцитов, образуя «сладжи» — комочки, оседающие в капиллярах и еще больше нарушающие однородность структуры крови. Важную роль в развитии сладжинг-фе-номена играют два взаимосвязанных явления — снижение скорости кровотока и увеличение вязкости крови. Вязкость крови во время беременности повышается, что обусловлено увеличением в крови содержания прокоагулянтов, которые относятся в основном к крупномолекулярным белкам.

 

С помощью своевременно проведенных лечебных мероприятий можно добиться возвращения (редепонирование) части секвестрированных эритроцитов в кровоток. Однако функция их в значительной степени нарушена, эритроциты легко разрушаются, что способствует развитию анемии и дефицита ОЦК у больных в восстановительном периоде.

 

Процесс аутогемодилюции при гёморрагическом шоке осуществляется в основном за счет внеклеточной внесо-судистой жидкости. Внеклеточная жидкость составляет 20% массы тела и включает внесосудистую (интерстициальная) и внутрисосудистую жидкость, границей между которыми является сосудистая стенка. Вне- и внутрисосудистая жидкость соответственно составляет 15% (10,5 л) и 5% (3,5 л) массы тела. Г. Кеслер и соавт. (1968) указывают, что с анатомической точки зрения внеклеточная жидкость содержится в кровеносных и лимфатических сосудах, а также в межтканевых пространствах. С функциональной точки зрения внеклеточная жидкость представляет собой единое целое и ее состав, в частности концентрация белков и микроэлементов, практически одинаков.

 

Установлено, что организм выживает при сохранении 35% объема эритроцитов, в то же время потеря 30% объема плазмы ведет к смерти [Вейль М., Шубин Г., 1971], поэтому аутогемодилюции за счет внесосудистой жидкости является важным компенсаторным механизмом при кро-вопотере. Удержанию жидкости в кровеносном русле способствует нормальное коллоидно-осмотическое давление, которое в значительной степени поддерживается альбуминами — белками с небольшой молекулярной массой (60 000— 70 000). При кровотечении теряется большое количество альбуминов, поэтому при значительных кровопотерях возможности аутогемодилюции невелики, а инфузии слишком больших количеств растворов без одновременной коррекции гипоальбуминемии могут способствовать развитию тканевого отека.

 

Нарушение взаимоотношений между внутри- и внеклеточным объемом жидкости при шоке наряду с нарушениями периферического кровотока способствует прогрессивному ухудшению тканевого метаболизма. Нарастает тканевая гипоксия, вследствие этого происходит превращение аэробного типа окисления в анаэробный с развитием метаболического ацидоза. Следует подчеркнуть, что даже небольшие кровопотери приводят к метаболическому ацидозу, если кислотно-основное состояние (КОС) организма несколько нарушено в связи с каким-либо существующим ранее заболеванием. Так, у беременных с нефропатией II—III степени обычно развивается метаболический ацидоз (SB 19,3 ммоль/л, BE — 6,0 ммоль/л), который компенсируется респираторным алкалозом (pH 7,40, Рсог 27,8 мм рт. ст.). Однако даже физиологическая кровопотеря во время родов способствует углублению ацидоза (pH 7,31, BE — 7,3 ммоль/л, SB 18,7 ммоль/л) у этих беременных вследствие снижения респираторного алкалоза (РС0! 35—40 мм рт. ст.) и других причин. Таким образом, у родильниц с тяжелыми формами позднего токсикоза существует потенциальная опасность быстрой декомпенсации КОС при патологической кровопотере и других стрессовых ситуациях. Такую же группу риска составляют беременные и роженицы с приобретенными пороками сердца, железодефицитной анемией, артериальной гипотонией и некоторыми другими соматическими заболеваниями.

 

Защитной реакцией на гипоксию является мобилизация глюкозы из гликогеновых депо. Однако вследствие нарушенного метаболизма процессы гликолиза увеличивают степень ацидоза. При прогрессирующем шоке увеличивается проницаемость клеточных мембран, что способствует уменьшению в клетках количества ферментов в результате их выделения в кровь.

 

Имеются данные об активной роли простагландинов в развитии шока; С. Moschetta и соавт. (1979) установили, что в результате стресса фосфолипиды тромбоцитов подвергаются метаболизму, вследствие чего образуются простагландины, тромбоксаны и простациклины. Тром-боксаны усиливают агрегацию тромбоцитов, одновременно с простагландинами оказывают сосудосуживающее действие. Как известно, в процессе родов повышается содержание эндогенных простагландинов, что может быть одним из факторов, способствующих развитию шока у родильниц.

 

Вывести больных из тяжелого геморрагического шока можно при соответствующем интенсивном лечении, но дальнейший прогноз зависит от обширности, тяжести и длительности повреждения жизненно важных органов, сохранения, хотя бы частично, их анатомической и функциональной полноценности (сохранение критических резервов органа). Различные органы поражаются при шоке неодинаково. При геморрагическом шоке отмечается тяжелое поражение легких с развитием острой легочной недостаточности в виде «шокового легкого». Развитию «шокового легкого» способствует ряд причин: невысокие критические резервы органа, функционирование легочного кровообращения в системе низкого давления, наиболее тяжело страдающей при шоке, процессы внутрисосудистого свертывания крови с оседанием микросгустков в легочных капиллярах, массивные гемотрансфузии, при которых также происходит оседание микросгустков консервированной крови в легочных сосудах, и др. Морфологические изменения «шокового легкого» проявляются в виде его уплотнения, возникновения множественных петехиальных кровоизлияний, чередования эмфизематозных и ателектатических участков, в результате чего образуется «мраморное» легкое или оно по своему виду напоминает печень. При разрезе легкого с него стекает умеренное количество жидкости, (отек).

 

При геморрагическом шоке наблюдаются также резкое уменьшение почечного кровотока, гипоксия почечной ткани, внутрисосудистые отложения фибрина, острый некроз канальцев с развитием острой почечной недостаточности или «шоковой почки».

 

В ответ на развитие геморрагического шока немедленно происходит уменьшение кровообращения в портальной системе и, следовательно, уменьшение печеночного кровотока. Клетки печени очень чувствительны к гипоксии, поэтому тяжесть поражения печени при шоке зависит как от продолжительности периода артериальной гипотензии, так и от исходного состояния органа: очень неблагоприятно развитие шока на фоне нарушенной функции печени (поздний токсикоз). F

В Ташкенте внучка избила и зарезала родного деда за то, что он не дал ей 50 евро

Узбекистан, Ташкент – АН Podrobno.uz. В Ташкенте внучка избила и зарезала родного деда за то, что он не дал ей 50 евро, сообщает корреспондент Podrobno.uz со ссылкой на газету «На посту» при МВД.

Все произошло в квартире пенсионера в Юнусабадском районе столицы. Днем ранее девушка потребовала у него 50 евро, но получила отрицательный ответ. Это вызвало у нее приступ гнева, который вылился в скандал.

Не добившись своего, она затаила злобу, и когда пожилой человек заснул на диване, ударила его по голове тупым твердым предметом. Она в буквальном смысле пыталась выбить из родного деда 50 евро, но в ответ на каждый новый удар слышала «нет».

В ярости девушка побежала на кухню, вооружилась ножом и стала наносить старику удары в грудь и живот. Раненый пенсионер дополз до ванной комнаты, пытаясь закрыться в ней от нападавшей. Внучка вошла следом и, как ей показалось, добила мужчину.

Позже, скрывшись с места преступления, она сообщила о случившемся в правоохранительные органы.

На теле пенсионера были обнаружены телесные повреждения в виде закрытой черепно-мозговой травмы, рваной раны в височной области головы, проникающих колото-резаных ран передней стенки живота, левой и правой частей легких грудной клетки, колото-резаных ран головы и левой руки. Были отмечены также постгеморрагический шок 3-4-й степеней, внутреннее и наружное кровотечение, сотрясение головного мозга.

После получения информации о произошедшем на место преступления выехали сотрудники органов внутренних дел и бригада скорой помощи. В момент госпитализации мужчина был еще жив, однако, несмотря на оказанную медицинскую помощь, он скончался от полученных телесных повреждений.

Согласно заключению судебно-психиатрической экспертизы, девушка страдает хронической параноидной шизофренией. Это психическое расстройство в момент совершения преступления лишило ее способности осознавать фактический характер и общественную опасность своих действий и руководить ими.

Девушка не могла правильно воспринимать обстоятельства, имеющие значение для уголовного дела, участвовать в следственных и судебных действиях и давать правильные показания. Как представляющую социальную опасность, девушку отправили на лечение в соответствующее медицинское учреждение, с интенсивным режимом наблюдения.

Ее вина была полностью доказана. Уголовное дело передано в суд.


New Page 1

New Page 1

Обратно

   

Кровотечения из верхних отделов ЖКТ составляют 70-80% всех абдоминальный кровотечений и 50% из них составляют кровотечения, вызванные язвенной болезнью.

Патофизиология.

    Острая кровопотеря при ЖКК сопровождается развитием несоответствия между уменьшенным объемом циркулирующей крови (ОЦК) и объемом сосудистого русла, что приводит к падению общего периферического сопротивления (ОПС), снижению ударного объема сердца (УOC) и минутного объема кровообращения (МОК), падению артериального давления (АД). . Так возникают нарушения центральной гемодинамики. В результате падения АД, снижения скорости кровотока, повышения вязкости крови и образования в ней агрегатов эритроцитов нарушается микроциркуляция, изменяется транскапиллярный обмен. От этого в первую очередь страдают белковообразовательная и антитоксическая функции печени, нарушается продукция факторов гемостаза — фибриногена и протромбина, повышается фибринолитическая активность крови. Нарушения микроциркуляции ведут к нарушениям функции почек, легких, головного мозга.

    Защитные реакции организма направлены прежде всего на восстановление центральной гемодинамики. Надпочечники реагируют на гиповолемию и ишемию выделением катехоламинов, вызывающих генерализованный спазм сосудов. Эта реакция ликвидирует дефицит заполнения сосудистого русла и восстанавливает ОПС и УОС, что способствует нормализации АД. Возникающая тахикардия увеличивает МОК. Далее развивается реакция аутогемодилюции, в результате чего из интерстициальных депо в кровь поступает жидкость, которая восполняет дефицит ОЦК и разжижает застойную, сгущенную кровь. Центральная гемодинамика стабилизируется, восстанавливаются реологические свойства крови, нормализуются микроциркуляция и транскапиллярный обмен. НО так происходит лишь при кровопотере до 15% ОЦК. При больших кровопотерях организм не справляется  с кровопотерей и происходит декомпенсация гемодинамики.

Клиника.

    Клиническая картина во многом зависит от величины и скорости кровопотери, совершенства компенсаторных механизмов и др. факторов.

    Различают прямые и непрямые признаки желудочного кровотечения.

    К прямым признакам относится рвота кровь. и мелена.

Характер рвотных масс зависит от величины и скорости кровотечения. При большом и быстром кровотечении рвота алой кровью, иногда со сгустками, при менее обильных и медленных кровотечениях — рвота «кофейной гущей». Боли, если они были до кровотечения, обычно стихают.

    Мелена — патогномоничный признак желудочного кровотечения, но поздний. Она проявляется обычно через 8-12 часов после начала кровотечения.

    К непрямым признакам относятся головокружение, общая слабость, липкий пот, сердцебиение. При тяжелом кровотечении развивается постгеморрагический шок с соответствующей клиникой. Роль непрямых признаков кровотечения особенно возрастает при отсутствии рвоты кровью.

Оценка величины кровопотери и необходимости неотложной терапии.

Степень кровопотери оценивается по нескольким критериям.

1. Наиболее точным методом является определение объема циркулирующей крови (ОЦК) и вычисление его дефицита по сравнению с нормативным, вычисленным по номограмме.

2. По изменению гематокрита. Этот метод достаточно точный и простой, но, к сожалению, позволяет вычислить кровопотерю только спустя 6-8 часов после кровотечения.

3. По артериальному давлению. Потеря 10-15% ОЦК не вызывает падения артериального давления, и оно не изменяется при ортостатической пробе (измерение давления в горизонтальном и вертикальном положении тела). Это период компенсации. При большей кровопотери (период частичной компенсации) артериальное давление умеренно снижено (до 80 мм рт.ст.), а ортостатическая проба вызывает дополнительное падение артериального давления. При артериальном давлении ниже 80 мм рт.ст ортостатическая проба не проводится, так как опасна для жизни (период декомпенсации).

4. Определение шокового индекса (ШИ) Альговера.

Он определяется по формуле:

ЧСС в мин. / Систол АД в мм рт.ст.

При отсутствии кровопотери ШИ равен 0. 5; повышение ШИ до 1.0 соответствует дефициту ОЦК 30%; 1.5 — дефицит ОЦК 50%.

5. Изменения ЧСС не могут быть критерием степени кровопотери.

 

Определение степени тяжести желудочно-кишечного кровотечения в зависимости от объема кровопотери и дефицита ОЦК

Степень тяжести Объем кровопотери в л. Дефицит ОЦК в %
Первая степень

1 — 1.5

до 20%

Вторая степень

1.5 — 2.5

20 — 40

третья степень

>2.5

40 — 70

Роль фиброгастродуоденоскопии в определении источника кровотечения и его купирования.

    ФГС имеет решающее значение для выявления источника кровотечения, его особенностей (Смотри здесь).

В 90 % всех случаев желудочного кровотечения при язвенной болезни удается стойко остановить его путем применения специальных эндоскопических методик. При вариантах кровотечения Forrest 1a, Forrest 1b, Forrest 2a обычно применяют лазерную или электрокоагуляцию сосуда в сочетании с обкалыванием склерозирующими или сосудосуживающими препаратами препаратами — поливканола, этанола, адреналина. В последнее время все чаще для остановки кровотечения используют специальные эндоскопические зажимы — эндоклипсы.

Лечение

1. Компенсация кровопотери и восстановление гемодинамики

— переливание одногрупной крови и ее компонентов:

Кровь переливают если уровень гемоглобина крови менее 100 г/л.

Количество крови, необходимое для вливания, определяют в дозах (1 доза=500мл крови) по формуле:

Количество доз крови = 10 — Hb в г/%

— переливание кровозаменителей и растворов.

 Обычно применяют полиглюкин, реополиглюкин, физиологический раствор, раствор Рингер-Лока и др.

2 Меры по остановке кровотечения.

Если кровотечение продолжается, то после мер по стабилизации гемодинамики или одновременно с ними устанавливают источник кровотечения и принимают меры по его остановке.

В 90% случаев используют эндоскопические методы остановки кровотечения (смотри предыдущий раздел). В 10% случаев , когда эндоскопические методы неэффективны или невозможны, применяют оперативные методы — перевязка сосудов или резекция желудка.

3 Лечение основного заболевания:

— применение ингибиторов протонной помпы;

— применение Н2-блокаторов.

Обратно

 

Геморрагический шок: предыстория, патофизиология, эпидемиология

Автор

Джон Удеани, доктор медицины, FAAEM  доцент кафедры неотложной медицины, Университет медицины и науки Чарльза Дрю, Калифорнийский университет, Лос-Анджелес, Медицинская школа Дэвида Геффена

Джон Удеани, доктор медицины, FAAEM является членом следующие медицинские общества: Американская академия неотложной медицины, Американский колледж врачей неотложной помощи

Раскрытие информации: Нечего раскрывать.

Редакционная коллегия специалистов

Франсиско Талавера, PharmD, PhD Адъюнкт-профессор Фармацевтического колледжа Медицинского центра Университета Небраски; Главный редактор Medscape Drug Reference

Раскрытие информации: Получал зарплату от Medscape за трудоустройство. для: Медскейп.

Роберт Л. Шеридан, MD  помощник начальника штаба, заведующий отделением ожоговой хирургии, больница Шрайнерс Бернс; Адъюнкт-профессор хирургии, отделение хирургии, отделение травм и ожогов, Массачусетская больница общего профиля и Гарвардская медицинская школа

Роберт Л. Шеридан, доктор медицины, является членом следующих медицинских обществ: Американская академия педиатрии, Американская ассоциация хирургии травм , Американская ассоциация ожогов, Американский колледж хирургов

Раскрытие информации: Нечего раскрывать.

Главный редактор

Джон Гейбель, доктор медицины, магистр наук, доктор наук, AGAF  Вице-председатель и профессор кафедры хирургии, отделение желудочно-кишечной медицины, профессор кафедры клеточной и молекулярной физиологии, Медицинский факультет Йельского университета; Директор хирургических исследований, отделение хирургии, Йельская больница Нью-Хейвен; член Американской гастроэнтерологической ассоциации; Fellow of the Royal Society of Medicine

John Geibel, MD, MSc, DSc, AGAF является членом следующих медицинских обществ: Американская гастроэнтерологическая ассоциация, Американское физиологическое общество, Американское общество нефрологов, Ассоциация академической хирургии, Международное общество нефрологов , Нью-Йоркская академия наук, Общество хирургии пищеварительного тракта

Раскрытие информации: Нечего раскрывать.

Дополнительные участники

Льюис Дж. Каплан, доктор медицинских наук, FACS, FCCM, FCCP  Профессор хирургии, отделение травм, реанимации и неотложной хирургии, отделение хирургии, Медицинская школа Перельмана Пенсильванского университета; Начальник секции хирургической интенсивной терапии Медицинского центра по делам ветеранов Филадельфии

Льюис Дж. Каплан, доктор медицинских наук, FACS, FCCM, FCCP является членом следующих медицинских обществ: Американская ассоциация хирургии травм, Американский колледж хирургов, Ассоциация академических Хирургия, Ассоциация хирургического образования, Медицинское общество штата Коннектикут, Восточная ассоциация хирургии травм, Международное общество травматологической анестезии и интенсивной терапии, Общество развития системы переливания крови, Общество медицины критических состояний, Общество хирургических инфекций

Раскрытие информации: ничего расскрыть.

Ингибирующее действие дренирования мезентериальной лимфы после геморрагического шока на HMGB1 и RAGE в почках мышей ,2 Было показано, что возврат мезентериальной лимфы после геморрагического шока (PHSML) участвует в вызванных геморрагическим шоком полиорганных повреждениях и дисфункциях.

ОПП за счет подавления воспалительной реакции и окислительного стресса6,7, улучшения энергетического метаболизма7,8 и отмены активности 5-липоксигеназы.9 Эти результаты указывают на то, что возврат PHSML является решающим фактором, влияющим на процесс индуцированного геморрагическим шоком ОПП. Однако точный механизм, ответственный за неблагоприятный эффект возврата PHSML, который приводит к ОПП, остается неизвестным.

Группа высокой подвижности 1 (HMGB1) высвобождается из активированных врожденных иммунных клеток или некротических клеток и действует как важный медиатор сепсиса и локального воспаления.10 Kao et al.11 сообщили, что геморрагический шок и реанимация вызывают острое повреждение легких ( ALI) и повышение уровня циркулирующего HMGB1.Ингибирование HMGB1 ослабляет ALI у мышей с HS/R. Рецептор конечных продуктов усиленного гликирования (RAGE) участвует в патогенезе чрезмерного воспаления.12 Геморрагический шок и реанимация могут индуцировать бактериальную транслокацию, повышать интерлейкин (IL)-6 и снижать IL-10 в плазме при RAGE(+/ +), но не у мышей RAGE(-/-), что свидетельствует о том, что активация RAGE-зависимой передачи сигналов является ключевым фактором, ведущим к дисфункции барьера слизистой оболочки кишечника после геморрагического шока. PHSML при ОПП, индуцированном геморрагическим шоком, полностью не выяснена.Поэтому, чтобы проверить участие HMGB1 и RAGE в воспалительных реакциях, вызванных PHSML, было проведено текущее исследование для изучения уровней мРНК и белка HMGB1 и RAGE в почках после геморрагического шока с дренированием PHSML или без него.

Методы

Животные

Восемнадцать здоровых самцов мышей линии C57BL/6J весом от 20 до 28 г были приобретены в Центре разведения лабораторных животных Китайской академии медицинских наук (Пекин, Китай).Все процедуры на животных, выполненные для этого исследования, были рассмотрены и одобрены нашим институциональным комитетом по уходу и использованию животных, Комитетом по уходу за лабораторными животными Хэбэйского Северного университета. Все мыши голодали в течение 12 часов и имели свободный доступ к воде перед экспериментом, и их страдания во время эксперимента были сведены к минимуму. Эти мыши были случайным образом разделены на следующие группы: группа имитации, группа шока и группа шока + дренажа, по шесть мышей в каждой группе.

Животная модель

После общей анестезии с внутрибрюшинным введением 1% пентобарбитала натрия (7 мг/100 г, Merck, Германия) правая бедренная артерия была асептически изолирована, катетеризирована с введением гепарина натрия (50 ЕД/100 г) для антикоагуляции и подключен к системе сбора биологических сигналов PowerLab (ADInstruments, Белла Виста, Новый Южный Уэльс, Австралия) для непрерывного мониторинга среднего артериального давления (САД).Затем контралатеральную бедренную артерию изолировали, катетеризировали и подключали к автоматическому аппарату для забора-вливания (NE-1000; New Era Pump Systems Inc., Farmingdale, NY) для взятия крови и реанимации жидкости. Впоследствии всем мышам была проведена абдоминальная хирургия для отделения брыжеечного лимфатического протока от окружающих соединительных тканей для дренирования брыжеечной лимфы или ложного дренирования. После 30-минутного периода стабилизации у мышей в группах шока и шока + дренирования быстро производили кровотечение из левой бедренной артерии с помощью автоматического аппарата для отвода-вливания, так что среднее артериальное давление упало до 40 мм рт. ст. в течение 10 мин.Среднее артериальное давление поддерживалось на этом уровне в течение 90 мин за счет забора или реперфузии потерянной крови по мере необходимости. После гипотонии пролитую кровь плюс равный объем раствора Рингера затем перфузировали в течение 30 мин через левую бедренную артерию в соответствии с предыдущими отчетами.14–16 САД наблюдали в течение 3 ч после окончания инфузии. В группе шок + дренирование после завершения реанимации мезентериальный лимфатический проток был канюлирован и брыжеечная лимфа дренирована до 3 часов. Мышей в фиктивной группе анестезировали и канюлировали, как описано ранее, но кровоизлияние и реанимацию не проводили.

Сбор почечной ткани

Через 3 часа после реанимации или в соответствующие моменты времени три правые почки были собраны и иммигрированы в пробирку для ЭП с 1 мл стабилизирующего реагента РНК (Qiagen, Nasdaq, NY) и заморожены при температуре -75°С. C для дальнейшего количественного анализа полимеразной цепной реакции с обратной транскрипцией в реальном времени (qRT-PCR), остальные правые почки использовали для других экспериментов. Кроме того, левая почка была получена от каждой мыши в разных группах и хранилась при  -75 °C в холодильнике (Thermo Electron, Waltham, MA) для твердофазного иммуноферментного анализа (ELISA).

Анализ qRT-PCR

Тотальную РНК экстрагировали из ткани правой почки в соответствии с инструкциями Trizol (Beyotime Biotechnology Research Institute, Пекин, Китай). Концентрацию образца общей РНК определяли путем определения значений A260 и A280 с использованием ультрафиолетового спектрофотометра (PE) Lambda 35 (Waltham, MA) и доводили до 1 мкг / мкл для анализа qRT-PCR. Реакционная система RT, состоящая из 10 × Fast RT Buffer 2 мкл, смеси ферментов RT 1 мкл, смеси праймеров FQ-RT 1 мкл и обработанного диэтилпирокарбонатом (DEPC) H 2 O 5 мкл, была добавлена ​​в реакционную систему для удаления г ДНК, состоящая из РНК 1 мкл, 5 х 1 г ДНК-буфера 2 мкл и обработанного DEPC H 2 O 7 мкл.Набор FastQuant RT (с гДНазой) был приобретен в компании TianGen Biotechnology (Пекин, Китай). Реакцию проводили при 42°С в течение 15 мин и при 95°С в течение 3 мин, после чего продукт кДНК помещали в холодильник для криоконсервации при 20°С. Праймеры для амплификации qRT-PCR включали смысловой (5′ ACAGAGCGGAGAGAGTGAGGGG 3′) и антисмысловой (5′ GGGTGCTTCTTCTTGTGCTC 3′) HMGB1, смысловой RAGE (5′ AGTCAG AGGAAGCGGAGATG 3′) и антисмысловой (5′ CTGGTTGGAGAAGGAAGTGC 3′). Между тем, GAPDH был установлен в качестве внутреннего эталона (PMM04).Эти праймеры были приобретены в Исследовательском институте биотехнологии ShengGong (Шанхай, Китай). Реакционная система состояла из SYBR Green PCR Master Mix 10 мкл, 5 мкМ смыслового праймера 2 мкл, 5 мкМ антисмыслового праймера 2 мкл, кДНК 6 мкл (1:50). Реакцию проводили с помощью флуоресцентной количественной RT-PCR машины (ABI, Лос-Анджелес, Калифорния), и условия реакции были следующими: предварительная денатурация при 95°C 3 мин, денатурация при 95°C 30 с, отжиг при 60°C 30 с в HMGB1 и отжиг при 59°C 30 с в RAGE, 72°C в течение 1 мин, пройдя через 38 циклов. Уровень экспрессии каждого гена-мишени рассчитывали с использованием метода относительного количественного определения с экспрессией гена GAPDH в соответствии с инструкцией производителя.

Анализ ELISA

Ткань левой почки гомогенизировали в физиологическом растворе 1:9 (масса/объем) со стеклянным гомогенизатором в течение 1 минуты и центрифугировали при 850 g при 0–4 °C в течение 20 минут с использованием суперцентрифуги Labofuge 400R ( Thermo Fisher Scientific, Сан-Хосе, Калифорния), в то время как надосадочную жидкость отделяли для анализа ELISA с использованием наборов ELISA для мышей (антитела были приобретены у R&D Systems, Миннеаполис, Миннесота), и концентрации HMGB1, RAGE, IL-1β , и IL-18 определяли в соответствии с протоколами производителя после изготовления стандартных кривых ( y  = 0.156 x  − 0,021 x 2  + 0,001 x 3 , r 8 2 9008; y = 0,0004343 x + 0,000000239 x 2 — 0,000000000011 x 3 , R 2 = 0,9992; y = 0,014 x — 0,000055 x 2 + 0,000000565 x 3 , R 2 = 0,9995; г  = 0. 015 x — 0.0001218 x 2 + 0,000000919 x 3 , R 2 = 0,9997, соответственно). Концентрацию белка в почечном гомогенате количественно определяли колориметрическим методом с бриллиантовым синим кумасси (набор, приобретенный в Исследовательском институте биотехнологии Beyotime, Пекин, Китай), и результаты нормализовали по уровням белка.

Статистический анализ

В текущем исследовании данные экспрессии HMGB1 и RAGE были представлены как среднее ± ± SE, дата уровней HMGB1, RAGE, IL-1β и IL-18 была представлена ​​как среднее значение ± SD.Статистический анализ был выполнен с помощью SPSS 16.0 для окон (Polar Engineering and Consulting Inc., Чикаго, Иллинойс). Между группами использовался однофакторный дисперсионный анализ, а внутри групп применялся критерий Стьюдента-Ньюмена-Кеулса или критерий Тэмхэма 2. p  < 0,05 считалось статистически значимым.

Результаты

Дренаж PHSML снижает уровень HMGB1 в почечной ткани у мышей после геморрагического шока

Как показано на рис. 1, после геморрагического шока у мышей наблюдается повышение экспрессии мРНК и содержания HMGB1 в почечной ткани ( p  < 0.05, против фиктивного). Между тем, дренирование PHSML значительно снижало экспрессию и уровень мРНК HMGB1 ( p  < 0,05 по сравнению с шоком) и не имело статистических различий по сравнению с таковым в группе имитации ( p  > 0,05).

Ингибирующий эффект постгеморрагического шокового мезентериального лимфодренажа на HMGB1 и RAGE в почках мышейБрыжеечный лимфатический дренаж после геморрагического шока снижает уровень высокоподвижного белка группы box-1 (HMGB1) в почечной ткани у мышей после геморрагического шока. (A) Кривые плавления мРНК GAPDH (A1) и HMGB1 (A2) и график амплификации мРНК HMGB1 и GAPDH (A3). (B) Экспрессия мРНК HMGB1 в почечной ткани (среднее ± SE, n = 3). (C) Концентрация HMGB1 в почечной ткани (среднее ± SD, n = 5). * p < 0,05 по сравнению с группой имитации, # p < 0,05 по сравнению с группой шока.

Рис. 1. Брыжеечный лимфатический дренаж после геморрагического шока снижает уровень высокоподвижного белка группы box-1 (HMGB1) в почечной ткани у мышей после геморрагического шока. (A) Кривые плавления мРНК GAPDH (A1) и HMGB1 (A2) и график амплификации мРНК HMGB1 и GAPDH (A3). (B) Экспрессия мРНК HMGB1 в почечной ткани (среднее ± SE, n = 3). (C) Концентрация HMGB1 в почечной ткани (среднее ± SD, n = 5). * p < 0,05 по сравнению с фиктивной группой, # p < 0.05 против ударной группы.

Дренаж PHSML снижает уровень RAGE в почечной ткани у мышей после геморрагического шока

Через 3 часа после реанимации экспрессия мРНК RAGE и уровень белка в почках мышей в группе шока были значительно повышены по сравнению с таковыми в группе имитации ( p  < 0,05), который был обращен к уровням в группе имитации после обработки дренажа PHSML ( p  < 0,05) (рис. 2).

Ингибирующее действие постгеморрагического шокового брыжеечного лимфодренажа на HMGB1 и RAGE в почках мышей https://doi. org/10.3109/0886022X.2015.1105026

Опубликовано в Интернете:
29 октября 2015 г.

Рисунок 2. Брыжеечный лимфодренаж после геморрагического шока снижает уровень рецепторов конечных продуктов гликирования (RAGE) в почечной ткани у мышей после геморрагического шока. (A) Кривые плавления мРНК GAPDH (A1) и RAGE (A2) и график амплификации мРНК RAGE и GAPDH (A3). (B) Экспрессия мРНК RAGE в почечной ткани (среднее ± SE, n = 3). (C) Концентрация RAGE в почечной ткани (среднее ± SD, n = 5).* p < 0,05 по сравнению с группой имитации, # p < 0,05 по сравнению с группой шока.

Дренаж PHSML снижает уровни IL-1

β и IL-18 в почечной ткани у мышей после геморрагического шока группа показала аналогичные изменения с HMGB1 и RAGE, указанные выше, по сравнению с таковой в группе имитации ( p  < 0,05). В то же время дренирование PHSML подавляло вызванное геморрагическим шоком снижение уровней IL-1β и IL-18 в шоковых почках ( p  < 0.05) и отсутствие очевидных различий с фиктивной группой ( p  > 0,05).

Ингибирующий эффект постгеморрагического шокового мезентериального лимфодренажа на HMGB1 и RAGE в почках мышей мезентериальный лимфатический дренаж снижает уровни интерлейкина-1β (IL-1β) (A) и IL-18 (B) в почечной ткани у мышей после геморрагического шока (среднее ± SD, n = 5).* p < 0,05 по сравнению с группой имитации, # p < 0,05 по сравнению с группой шока.

Рис. 3. Дренаж брыжеечной лимфы после геморрагического шока снижает уровни интерлейкина-1β (IL-1β) (A) и IL-18 (B) в почечной ткани у мышей после геморрагического шока (среднее  ± SD, n =5). * p < 0,05 по сравнению с группой имитации, # p < 0,05 по сравнению с группой шока.

Обсуждение

В настоящем исследовании мы наблюдали влияние дренажа PHSML на экспрессию HMGB1 и RAGE в почках после геморрагического шока.Мы обнаружили, что дренирование PHSML может ослаблять экспрессию HMGB1 и RAGE в почках с геморрагическим шоком как на уровне мРНК, так и на уровне белка, что сопровождается падением почечных уровней IL-1β и IL-18. Эти результаты показывают, что как HMGB1, так и RAGE участвуют или опосредуют воспалительные реакции, индуцированные возвращением PHSML, во время геморрагического шока.

При развитии и прогрессировании геморрагического шока фактор некроза опухоли α (ФНОα) характеризуется сначала повышением, а затем постепенным снижением.Хотя содержание TNFα вернулось к нормальным уровням, воспалительный каскад все еще существует и даже более выражен. Эти данные свидетельствуют о том, что существуют и другие воспалительные факторы, участвующие в позднем воспалительном каскаде во время геморрагического шока. Экспериментальные и клинические исследования показали, что HMGB1 участвует в различных формах воспалительных реакций и рассматривается как потенциальный «поздний» медиатор воспаления. для развития воспалительного каскада, который включает активацию Toll-подобного рецептора 2 (TLR2) и сигнальных путей, опосредованных TLR4; при этом вырабатывается и смывается множество воспалительных факторов.Эти повышенные воспалительные факторы могут вызывать повреждения органов, включая ОПП и острое повреждение легких после геморрагического шока. Тем не менее, остается неясным, имеет ли ОПП, основной источник расстройств внутренней среды, аналогичные изменения в эпизоде ​​геморрагического шока. Чтобы достичь этого, в настоящем исследовании наблюдали мРНК и белок HMGB1 в почках после геморрагического шока и реанимации. Мы обнаружили, что геморрагический шок вызывает активацию мРНК и белка HMGB1 в почках, что позволяет предположить, что повышенный уровень HMGB1 может играть ключевую роль в индуцированном геморрагическим шоком ОПП. Кроме того, мы продемонстрировали, что дренирование PHSML ослабляет активацию HMGB1 в шоковых почках как на уровне мРНК, так и на уровне белка. Эти результаты свидетельствуют о том, что HMGB1 ответственен за ОПП, индуцированный возвратом PHSML, другими словами, ослабление дренажа PHSML при ОПП связано со снижением регуляции HMGB1. Взятые вместе, эти находки говорят в пользу механизма, с помощью которого шоковая лимфа возвращается в кровоток, что приводит к повреждению органов. Недавно Wang et al.20 обнаружили, что ингибитор HMGB1 этилпируват (EP) подавляет уровни мРНК и белка HMGB1, ингибирует сигнальные пути TLR4 в линиях эпителиальных клеток кишечника человека (клетки SW480), активированных стимуляцией LPS.Однако, может ли EP играть аналогичную роль с дренированием PHSML при ослаблении ОПП, это требует дальнейшего изучения в будущем.

В сочетании с HMGB1, RAGE, один из поверхностных рецепторов в цитомембране, также может запускать развитие воспалительного каскада, включая транслокацию митоген-активируемых протеинкиназ (MAPK), TLR4 и NF-κB. 21–25 Предыдущие исследования показали, что RAGE может опосредовать активацию HMGB1 передачи сигналов TLR4 и TLR2 и развитие ALI после геморрагического шока.15,16,18 Настоящее исследование показало, что как мРНК, так и белковая экспрессия RAGE увеличивается в почках с геморрагическим шоком и что это увеличение устраняется дренированием PHSML. Эти результаты показывают, что возникновение ОПП связано с изменением HMGB1-RAGE, а сигнальный путь HMGB1-RAGE со сниженной регуляцией отвечает за положительные эффекты дренирования PHSML при ОПП, вызванной геморрагическим шоком. IL-1β и IL-18 являются ключевыми провоспалительными медиаторами, продуцируемыми активацией HMGB1-RAGE после геморрагического шока и опосредуют воспалительный каскад при различных патологических состояниях, включая геморрагический шок.Сообщалось, что как нейтрализующие антитела, так и нокаут гена HMGB1 снижают уровни IL-1β и IL-18 в тканях легких, сосудистых эндотелиальных клетках и макрофагах после геморрагического шока и снижают воспалительную реакцию в легких. 18,19 В настоящее время исследования мы также измерили уровни IL-1β и IL-18 в почках и обнаружили, что изменения экспрессии HMGB1-RAGE сопровождаются изменениями уровня IL-1β и IL-18 в тех же направлениях в почках. после геморрагического шока с дренированием PHSML или без него.Однако в текущем исследовании экспрессия мРНК IL-1β и IL-18 не наблюдалась. Следовательно, будущие исследования должны дополнительно изучить роль водосборного бассейна PHSML на экспрессию мРНК. Кроме того, мы обнаружили, что дренирование PHSML снижает уровень белка TNF-α, классического медиатора воспаления во время геморрагического шока, в почках крыс в предыдущем исследовании9. Поэтому в настоящем исследовании экспрессия белка TNF-α не измерялась. Несмотря на все это, текущие результаты показывают, что HMGB1 и RAGE могут быть важными медиаторами, ответственными за воспалительные реакции, вызванные возвращением PHSML.

Таким образом, геморрагический шок вызывает повышенную экспрессию HMGB1 и RAGE параллельно с повышенными уровнями IL-1β и IL-18, которые участвуют в ОПП, вызывающей геморрагический шок. Положительный эффект дренирования PHSML связан с его подавлением HMGB1, RAGE и, таким образом, снижением уровней IL-1β и IL-18. В будущем мы должны дополнительно изучить роль внутривенной инъекции PHSML на активацию и экспрессию путей HMGB1, RAGE, NF-kB в почках мышей, получавших ингибитор HMGB1, такой как этилпируват, HMGB1 A-box, и выявленные причинно-следственная связь между блокировкой PHSML и путем HMGB1.

. (A) Кривые плавления мРНК GAPDH (A1) и RAGE (A2) и график амплификации мРНК RAGE и GAPDH (A3). (B) Экспрессия мРНК RAGE в почечной ткани (среднее ± SE, n = 3). (C) Концентрация RAGE в почечной ткани (среднее ± SD, n = 5).* p < 0,05 по сравнению с группой имитации, # p < 0,05 по сравнению с группой шока.

определение постгеморрагического в The Free Dictionary

Roze и соавт. [22] обнаружили, что среди выживших после ВЖК постгеморрагическая дилатация желудочков является фактором риска низкого интеллекта и плохих манипулятивных способностей в возрасте 4-12 лет. Ее состояние критическое из-за постгеморрагической анемии. Различные формы поражения белого вещества, включая «асимметрию бокового желудочка», «увеличение бокового желудочка», «двустороннее увеличение бокового желудочка» (определяемое как увеличение бокового желудочка без желудочковой асимметрии), «постгеморрагическую гидроцефалию», «диффузную перивентрикулярную лейкомаляцию» и «кистозная перивентрикулярная лейкомаляция (порэнцефалия)», наблюдаемая у отдельных пациентов (n = 61), перечислены в таблице 1. Таким образом, более широкий подход, нацеленный на несколько воспалительных действий, достигаемый при лечении МСК, является разумным и доказал свою эффективность на модели грызунов в отношении всех соответствующих патологий головного мозга, включая астроглиоз, миелинизацию, индукцию гибели клеток и предотвращение постгеморрагической гидроцефалии. Наконец, мы оценивали, присутствовали ли какие-либо эндотоксины в кровотоке до или после геморрагического шока. В своей серии они выявили более высокие результаты хирургического успеха ETV с CPC, если возраст превышал 3 месяца (50% по сравнению с 18.2%), масса тела превышала 3 кг (47% против 20%), а анатомические данные в препонтинной цистерне были нормальными по сравнению с рубцеванием (47,5% против 12,5%) при постгеморрагической гидроцефалии у недоношенных детей [16]. солитарные костные кисты до сих пор неизвестны; некоторые авторы предложили посттравматическую или постгеморрагическую этиологию, которая могла бы объяснить расположение позвонков, особенно у пожилых людей. Силлиман, «Брыжеечная лимфа ответственна за системное праймирование нейтрофилов после геморрагического шока», Journal of Trauma — Injury, Infection and Critical Care, vol.Изменения в белковых регуляторах развития нервной системы в спинномозговой жидкости детей с постгеморрагической гидроцефалией недоношенных. еще не сообщалось. Здесь у пациента развилась легочная пневмония, постгеморрагическая анемия и абстинентный синдром, регрессировавшие на фоне специфического лечения.

Группа VIB Са(2+)-независимая фосфолипаза А(2γ) связана с острым повреждением легких после травмы и геморрагического шока | Интернет-исследования в области здравоохранения и окружающей среды (HERO)

ПРЕДПОСЫЛКИ: Медиаторы кишечного происхождения попадают через брыжеечный лимфатический проток в большой круг кровообращения после травмы/геморрагического шока (Т/Ш), что приводит к острому повреждению легких (ОПЛ)/синдрому полиорганной дисфункции.Фосфолипаза А2 (PLA(2)) является ключевым ферментом для производства липидных медиаторов в постгеморрагическом шоке брыжеечной лимфе (PHSML). Однако точные функции подтипа PLA(2), такие как цитозольная PLA(2), секреторная PLA(2) и Ca-независимая PLA(2), в острой фазе воспаления остаются неясными. Наше предыдущее исследование показало, что активация Ca-независимой PLA(2γ) группы VIB (PLA(2γ)) может быть связана с повышением уровня лизофосфатидилхолина (LPC) в PHSML. Таким образом, наша цель состояла в том, чтобы проверить роль iPLA(2γ) в продукции 2-полиненасыщенных видов LPC и патогенез T/HS-индуцированного ALI с использованием iPLA(2γ)-специфического ингибитора, R-(E)-6. -(бромэтилен)-3-(1-нафталинил)-2H-тетрагидропиран-2-он (R-BEL).

МЕТОДЫ: самцов крыс Sprague-Dawley анестезировали и канюлировали в кровеносные сосуды и брыжеечный лимфатический проток. Животных в группе T/HS подвергали срединной лапаротомии плюс геморрагический шок (среднее артериальное давление, 35 мм рт. ст., 30 минут) и 2-часовую реанимацию с пролитой кровью и 2-кратным физиологическим раствором. Крысам с травмой/ложным шоком проводили идентичную процедуру без кровоизлияния. R-BEL или DMSO вводили за 30 минут до T/HS или травмы/ложного шока. Полиненасыщенные LPC и арахидоновую кислоту в PHSML анализировали с помощью жидкостной хроматографии/масс-спектрометрии с ионизацией электрораспылением.Кроме того, ALI оценивали по проницаемости сосудов легких, активности миелопероксидазы и гистологии.

РЕЗУЛЬТАТЫ: T/HS увеличили 2-полиненасыщенные LPC и арахидоновую кислоту в PHSML. Предварительная обработка R-BEL значительно снизила эти липиды, а также ингибировала ALI.

ЗАКЛЮЧЕНИЕ: Фермент iPLA(2γ), возможно, участвует в патогенезе ОПЛ после Т/ГС через мезентериальный лимфатический путь.

Повреждение легких и диафрагмы при различных уровнях кислорода и режимах вентиляции Постгеморрагический шок

Геморрагический шок является основной причиной заболеваемости и смертности в США.S. Вооруженные силы в контексте боевых ранений, полученных в ходе операций «Ирак» и «Несокрушимая свобода». Профилактика и лечение поврежденной легочной ткани и дисфункции диафрагмы являются приоритетными задачами военного медперсонала. Основной стратегией лечения, применимой к пациентам с геморрагическим шоком, является улучшение доставки кислорода к тканям. Текущая практика медсестер заключается в том, чтобы максимизировать концентрацию кислорода во вдыхаемом воздухе. Однако слишком высокая концентрация вдыхаемого кислорода может быть токсичной, тогда как слишком низкая концентрация может вызвать тканевую гипоксию.Таким образом, наше исследование поможет военным медсестрам определить оптимальную концентрацию кислорода с дофамином и без него после геморрагического шока. Эти эксперименты могут улучшить работу как легких, так и диафрагмы, что крайне важно для улучшения ухода за ранеными военнослужащими. Военнослужащим, перенесшим тяжелый геморрагический шок, может потребоваться контролируемая механическая вентиляция легких, что может привести к повреждению легких, вызванному вентилятором. Понимание влияния трех различных режимов контроля на повреждение легких было бы важным дополнением к протоколам искусственной вентиляции легких.

Два из пяти Приоритетов Программы исследований сестринского дела TriService нацелены на это исследование. Первым приоритетом является здоровья военного развертывания . Наше исследование поможет определить оптимальную концентрацию кислорода и режим управляемой искусственной вентиляции легких для использования военнослужащими во время развертывания, если они испытывают геморрагический шок. Наше исследование также будет касаться приоритета получения знаний, связанных с военной сестринской практикой ; он определяет количество свободных радикалов кислорода и степень апоптоза, образующихся в легких и диафрагме.Эта новая информация необходима для предотвращения тканевой токсичности и осуществления важных клинических вмешательств после кровоизлияния.

Это исследование расширит совокупность научных знаний , предоставив данные, необходимые военнослужащим для оптимизации оксигенации и предотвращения дальнейшего повреждения легких и диафрагмы. Уменьшение количества свободных радикалов уменьшит риск гипероксического повреждения легких, респираторного дистресс-синдрома у взрослых и уменьшит время на искусственной вентиляции легких после геморрагического шока.Мы считаем, что эти данные дадут научное представление о том, почему пациенты с геморрагическим шоком испытывают повреждение легких, вызванное вентилятором. Все предлагаемые эксперименты расширят знания военных медицинских сестер и улучшат их возможности по оказанию надлежащей и качественной сестринской помощи военнослужащим, страдающим геморрагическим шоком.

 

Итоговый отчет

доступен на сайте NTRL по адресу: https://ntrl.ntis.gov/NTRL/dashboard/searchResults/titleDetail/PB2013101…

Модулирование биологической активности мезентериальной лимфатической системы после травматического шока снижает системное воспаление и повреждение органов-мишеней

Аннотация

Введение

Травматический/геморрагический шок (Т/ГШ) вызывает высвобождение провоспалительных медиаторов в мезентериальную лимфу (МЛ), вызывая системную воспалительную реакцию и острое повреждение легких (ОПЛ). Прямая и фармакологическая стимуляция блуждающего нерва предотвращает разрушение кишечного барьера и изменяет биологическую активность МЛ после травмы. Мы предполагаем, что лечение фармакологическими агонистами блуждающего нерва после T/HS ослабит биологическую активность ML и предотвратит ОПЛ.

Методы

ML собирали у самцов крыс Sprague-Dawley после T/HS, травма-симуляционного шока (T/SS) или T/HS с введением фармакологического агониста блуждающего нерва CPSI-121. Образцы МЛ из каждой экспериментальной группы вводили интактным мышам для оценки биологической активности.Образцы крови анализировали на предмет изменений фосфорилирования STAT3 (pSTAT3). Повреждение легких характеризовалось гистологией, проницаемостью и рекрутированием иммунных клеток.

Результаты

лимфы T/HS, введенные интактным мышам, вызывали системный воспалительный ответ, характеризующийся гипотензией и повышенной активностью циркулирующих моноцитов pSTAT3. Инъекция T/HS-лимфы также приводила к ALI, подтвержденному гистологически, проницаемостью легких и повышенным набором легочных макрофагов и нейтрофилов в паренхиму легких. CPSI-121 ослаблял индуцированный T/HS лимфой системный воспалительный ответ и ALI со стабильной гемодинамикой и сходными уровнями моноцитов pSTAT3, гистологией легких, проницаемостью легких и рекрутированием иммунных клеток легких по сравнению с животными, которым инъецировали лимфу из T/SS.

Заключение

Лечение CPSI-121 после T/HS ослабило биологическую активность ML и уменьшило ALI. Учитывая превосходную клиническую осуществимость использования фармакологического подхода к стимуляции блуждающего нерва, CPSI-121 является потенциальной стратегией лечения для ограничения дисфункции органов-мишеней после травмы.

Образец цитирования: Лангнесс С., Костантини Т.В., Моришита К., Элисейри Б.П., Коимбра Р. (2016) Модуляция биологической активности мезентериальной лимфатической системы после травматического шока снижает системное воспаление и повреждение органов-мишеней. ПЛОС ОДИН 11(12): e0168322. https://doi.org/10. 1371/journal.pone.0168322

Редактор: Jerome W. Breslin, USF Health Колледж медицины Морсани, США

Поступила в редакцию: 25 марта 2016 г.; Принято: 29 ноября 2016 г.; Опубликовано: 15 декабря 2016 г.

Авторское право: © 2016 Langness et al.Это статья с открытым доступом, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника.

Доступность данных: Все соответствующие данные содержатся в документе и в файлах вспомогательной информации. Минимальный набор данных доступен в базе данных Figshare (http://dx.doi.org/10.6084/m9.figshare.3411826).

Финансирование: Авторы не получали специального финансирования для этой работы.

Конкурирующие интересы: Авторы заявили об отсутствии конкурирующих интересов.

Введение

Кишечник играет ключевую роль в патогенезе синдрома системного воспалительного ответа (ССВО) и развитии органной дисфункции после травмы/геморрагического шока (Т/ГШ) [1–3]. После T/HS перфузия внутренних органов снижается для сохранения центрального кровообращения [4, 5]. Эта тяжелая вазоконстрикция может привести к ишемическому/реперфузионному повреждению кишечника, нарушая целостность кишечного барьера и допуская транслокацию бактерий и антигенов [6, 7].Эта «транслокация» долгое время считалась инициирующим событием в патогенезе SIRS, однако недавние исследования поставили эту теорию под сомнение.

Мур и др. брали образцы воротной вены у пациентов с травмой во время диагностической лапаротомии и не смогли идентифицировать бактерии или эндотоксины у пациентов, у которых в конечном итоге развился синдром полиорганной дисфункции (СПОН) [8]. Новые теории сосредоточены на брыжеечной лимфе (МЛ) как на источнике, провоцирующем развитие SIRS [2, 9]. Эти теории предполагают, что провоспалительные медиаторы вырабатываются в кишечнике после травмы, которые могут высвобождаться в системный кровоток через ML, вызывая и распространяя системный воспалительный ответ [2, 10, 11].

Хотя провоспалительные медиаторы лимфы, вызывающие SIRS, еще предстоит полностью охарактеризовать [12–14], существует достаточно доказательств, демонстрирующих их биологическую активность. Применение МЛ в условиях шока in vitro вызывает дисфункцию эндотелиальных клеток [15–17], активацию нейтрофилов [17–19] и деформацию эритроцитов [10, 20]. Исследования in vivo показали, что ML, вызванный шоком, способствует развитию острого повреждения легких (ALI) [21–23] и сердечной дисфункции [24, 25], и что эти эффекты устраняются перевязкой брыжеечного протока до повреждения [16]. , 26].

Стимуляция блуждающего нерва (ВНС) усиливает холинергический противовоспалительный рефлекс [27] и ограничивает воспалительную реакцию после травмы [28–30]. Механизм, с помощью которого ВНС ослабляет воспаление, является многофакторным и включает снижение воспалительного потенциала МЛ после травмы [31, 32]. Предыдущая работа в нашей лаборатории продемонстрировала, что CPSI-121, фармакологический агонист блуждающего нерва, способен ослаблять биологическую активность ML [33]. Мы стремились определить, будет ли ML от животных, получавших CPSI-121, ограничивать SIRS и развитие дисфункции органов-мишеней после T/HS.

Материалы и методы

Модель T/HS

самца крыс Sprague-Dawley весом 280–300 г (Harlan Laboratories, Placentia, CA) анестезировали кетамином (75 мг/кг; Fort Dodge Animal Health, Fort Dodge, IA) и ксилазином (10 мг/кг; Sigma Chemical, Сент-Луис, Миссури), а левую бедренную артерию и вену канюлировали полиэтиленовой трубкой (PE-50). Самцов крыс использовали, чтобы свести к минимуму искажающее влияние половых гормонов на воспалительный процесс после травмы [34, 35].Среднее артериальное давление (САД) постоянно контролировали с помощью бедренного артериального катетера (Philips V24/26, Андовер, Массачусетс), а температуру тела поддерживали на уровне 37 o °С с помощью грелки. Травматический/имитационный шок (Т/ШС) вызывали путем выполнения правой медиальной висцеральной ротации через срединный лапаротомный разрез [33]. Геморрагический шок после травмы (ГШШ) индуцировали путем забора крови из катетера бедренной вены до снижения САД до 35 мм рт. ст. и поддерживали его в течение 60 минут [21].В конце T/HS животных реанимировали с помощью пролитой крови + двукратного объема пролитой крови в физиологическом растворе в течение 2 часов (Baxter, Deerfield, IL). Отдельную группу животных обрабатывали CPSI-121 (Ferring, San Diego, CA), разведенным в стерильной воде, сразу после индукции T/HS. CPSI-121 вводили внутривенно в дозе 1 мг/кг на основании наших предыдущих экспериментов, демонстрирующих защиту кишечного барьера после травмы с использованием этой дозы [36]. N = 4 для всех экспериментальных групп.

Коллекция ML

Брыжеечный проток был обнажен и канюлирован полиэтиленовой трубкой (PE-50) перед Т/СС или Т/ГС [37].ML собирали на льду во время фазы T/SS или T/HS (60 минут) и центрифугировали при 2000 об/мин в течение 5 минут при -4°C. Супернатант ML хранили при -80°C для будущего использования.

МЛ Настой

Образцы лимфы от травм T/SS, T/HS и T/HS + CPSI-121 размораживали и вводили интактным самцам мышей C57BL/6 (N = 4 для всех экспериментальных групп) с помощью гепаринизированного (0,1 ЕД/мл) внутреннего яремной канюли (PE-10) со скоростью 1 мл/кг/час в течение 3 часов [32]. Только в тех же условиях ложным животным вводили гепаринизированный физиологический раствор.

Преобразователь сигнала моноцитов и активатор фосфорилирования транскрипции 3 (STAT3) (pSTAT3)

Перед инфузией лимфы в бедренную артерию был помещен гепаринизированный катетер для непрерывного мониторинга артериального давления (Philips V24/26, Андовер, Массачусетс). 100 мкл крови брали до и сразу после инфузии лимфы. Образцы цельной крови лизировали и фиксировали с помощью Lyse/Fix Buffer (BD Phosflow, Cat 548049, NJ) в течение 15 минут при комнатной температуре. После промывки лейкоциты пермеабилизировали буфером Perm/Wash Buffer (BD Phosflow, Cat 554723, NJ) в течение 15 минут, а затем инкубировали с первичным PE-меченым анти-pSTAT3 (BD ​​Biosciences, Cat 61258, 1:50) в буфере FACS.Проточную цитометрию выполняли с помощью Becton Dickinson FACS Calibur. Моноциты идентифицировали на основе характерного прямого и бокового рассеяния, как описано ранее [38]. Медианную флуоресценцию моноцитов pSTAT3 анализировали на кратность изменения после инфузии лимфы.

Коллекция тканей легких

Легкие мышей состоят из четырех правых долей и одной левой доли [39]. Это открытие может быть использовано для проведения различных анализов легких на животное. После завершения инфузии лимфы животных забивали со смещением шейных позвонков.Выполнена кардиопульмонэктомия и перевязаны левая и правая верхние доли на уровне бронха шелковыми нитями. После лигирования в правое предсердие вводили 3 мл холодного PBS для промывания легочной сосудистой сети оставшихся трех долей правого легкого. Среднюю верхнюю долю лигировали для гистологии легкого, а среднюю нижнюю долю лигировали для анализа проточной цитометрии. Затем выделили трахею, чтобы раздуть последнюю правую нижнюю долю 4% параформальдегидом для иммуногистохимии.

Проницаемость легких

Мышам

вводили синий краситель Эвана (EBD) (30 мг/кг в PBS) через бедренный артериальный катетер за 30 минут до окончания 3-часового периода инфузии лимфы, как описано ранее [40]. Левую долю взвешивали во время сбора и через 24 часа. Соотношение масс сравнивали для определения соотношения влажного и сухого материала. Правая верхняя доля была помещена в формамид после лигирования на 24 часа для сбора экстравазационного EBD [41]. Поглощение раствора EBD/формамида (620 нм) измеряли с помощью спектрометра и сравнивали с известными разведениями EBD.

Гистология легких

Правую среднюю верхнюю долю фиксировали в формалине и заливали в парафин. Срезы парафина окрашивали гематоксилином и эозином в Центре гистологии Калифорнийского университета в Сан-Диего ( n = 3 мыши на экспериментальные условия). Исследователь, ослепленный экспериментальными условиями, затем оценил срезы легких в соответствии с системой оценки легочных повреждений, ранее описанной в нашей лаборатории [42]. Вкратце, срезы легких оцениваются от 0 (нормальный) до 3 (тяжелый) в зависимости от степени внутриальвеолярного кровоизлияния, легочного застоя, отека и воспалительной клеточной инфильтрации, чтобы получить максимально возможный балл 12.Оценки повреждения легких были усреднены для каждого экспериментального условия.

Иммуногистохимия

Надутые доли фиксировали в 0,1 моль/л PBS, содержащем 4% параформальдегида, при комнатной температуре в течение 30 минут и помещали в ОКТ. Срезы легкого толщиной 4 мкм делали и фиксировали на предметных стеклах. Затем срезы промывали PBS перед блокированием в течение 30 минут 3% бычьим сывороточным альбумином (BSA, Sigma) и инкубировали в течение ночи с первичным антителом (1:200). Первичные антитела включали козьи анти-MPO и козьи анти-CD68 (Abcore) на отдельных предметных стеклах.Затем срезы обрабатывали вторичным антителом Alexa Fluor 488 (куриный антикозий IgG, Invitrogen, Waltham, MA) и Alexa Fluor 546 (крысиный антикозий IgG, Invitrogen, Waltham, MA). Антитела буферизовали в 1% BSA в течение 1 часа при комнатной температуре после промывки PBS (pH 7,4) в течение 5 минут. Slow Fade (Invitrogen) добавляли перед размещением покровных стекол. Изображения были получены с использованием лазерного сканирующего конфокального микроскопа Olympus Fluoview с согласованными настройками экспозиции при 20-кратном и 40-кратном увеличении.

Проточная цитометрия

После лигирования ткань легкого правой средней нижней доли измельчали ​​и инкубировали в растворе ферментов коллагеназа А/диспаза II при 37°С в течение 20 минут до выделения клеток легкого. Затем легочную ткань пропускали через 70-мкм фильтр и переваривание останавливали 5% раствором эмбриональной телячьей сыворотки. Клетки окрашивали анти-мышиными моноклональными антителами, включая PE Cy7-меченый анти-CD11c (HL3; BD Biosciences, Сан-Хосе, Калифорния), APC Cy7-меченый анти-CD11b (M1/70; BD Biosciences) и APC-меченый анти-MHC II (M5/114.15,2; eBioscience, Сан-Диего, Калифорния). Мышиные легочные макрофаги идентифицировали методами, описанными Vermaelen и Pauwels [43]. Вкратце, расщепленные клетки сначала подвергали гейтированию для CD11c, а макрофаги идентифицировали на основе высокой аутофлуоресценции.

Животные

Это исследование было проведено в строгом соответствии с рекомендациями Руководства по уходу и использованию лабораторных животных Национального института здравоохранения. Протокол был одобрен Институциональным комитетом по уходу и использованию животных (IACUC) Калифорнийского университета в Сан-Диего (номер разрешения: S13020).Все операции проводились либо под кетамином/ксилазином, либо под 1,5% ингаляционным изофлураном, и всех животных внимательно наблюдали на предмет боли, страданий или умирающего вида в соответствии с одобренным протоколом IACUC. Хотя наш протокол призывал к эвтаназии, если животные умирали, у нас не было животных с такими признаками, и поэтому не нужно было усыплять животных до окончания экспериментального протокола.

Статистический анализ

Данные представлены в виде среднего значения ± стандартная ошибка среднего (SEM).Сравнение между группами (экспериментальная по сравнению с плацебо и экспериментальная по сравнению с T/HS + CPSI-121) проводилось с помощью двустороннего непарного t-критерия Стьюдента. Значения P ≤0,05 считались статистически значимыми.

Результаты

Лимфа, полученная из T/HS, вызывает системный воспалительный ответ

У

мышей, которым не вводили лимфу, полученную из T/HS, развился SIRS, о ​​чем свидетельствуют системная гипотензия и активация циркулирующих моноцитов (рис. 1A). Системная гипотензия возникала в течение последнего часа инфузии у животных, подвергшихся Т/ГС, при САД 52–55 мм рт.ст.Никаких гемодинамических изменений не наблюдалось в течение последнего часа инфузии ML от ложных, T/SS или T/HS + CPSI-121 животных (MAP 65–69, 62–67 и 66–73 мм рт. ст., соответственно).

Рис. 1. CPSI-121 предотвращает системный воспалительный ответ на T/HS.

Среднее артериальное давление колебалось в пределах 52–55 мм рт. ст. в течение последнего часа инфузии лимфы T/HS, что было статистически ниже, чем среднее артериальное давление у ложных мышей или мышей, подвергшихся T/SS (64–68 и 66–69 мм рт. ст., соответственно, р<0,05) (А). T/HS + CPSI-121, полученная лимфа, поддерживала среднее артериальное давление во время инфузии лимфы с показаниями среднего артериального давления, аналогичными имитации и T/SS (66-73 мм рт. ст., p = 0.79 против фиктивного). Гистограмма проточной цитометрии, сравнивающая фосфорилирование моноцитов STAT3 (pSTAT3) до (синий) и после инфузии лимфы (красный) (B). T/HS-лимфа приводила к 2,3 ± 0,47-кратному увеличению флуоресценции pSTAT3, что было значительно выше, чем кратные изменения pSTAT3 после инфузии имитации или T/SS-лимфы (1,0 ± 0,31 и 1,43 ± 0,12 соответственно, p<0,05). Лимфа T/HS + CPSI-121 приводила к 1,44 ± 0,31-кратному увеличению флуоресценции pSTAT3, что статистически не отличалось от имитации (p = 0.102) (С).

https://doi.org/10.1371/journal.pone.0168322.g001

Циркулирующие моноциты идентифицировали с помощью проточной цитометрии, а количество pSTAT3, раннего маркера системного воспаления [44], сравнивали до и после инфузии лимфы ( рис. 1В и 1С). В среднем наблюдалось увеличение экспрессии pSTAT3 в 2,3 ± 0,47 раза после инфузии лимфы T/HS. Для сравнения, среднее кратное увеличение экспрессии pSTAT3 после инфузии лимфы при имитации и T/SS составило 1,0 ± 0.31 и 1,43 ± 0,12 соответственно. Повышение уровня pSTAT3 предполагает повышенную активацию циркулирующих моноцитов после инфузии лимфы T/HS. CPSI-121 снижал биологическую активность ML, происходящего из T/HS, и предотвращал развитие SIRS с гемодинамикой и моноцитарной экспрессией pSTAT3, сходной с T/SS (среднее кратное изменение 1,44 ± 0,31 после инфузии лимфы).

CPSI-121 ослабляет биологическую активность ML, полученного из T/HS, и ограничивает развитие ALI

ALI характеризуется повышенной проницаемостью легких и клеточным инфильтратом [45].Лимфа, полученная из T / HS, привела к ALI с характерными признаками альвеолярного кровоизлияния и отека дыхательных путей по гистологии и повышенной проницаемости легких из-за соотношения влаги и сухости и абсорбции EBD (рис. 2A–2D). Лимфа, полученная из T/SS и T/HS + CPSI-121, вызывала умеренный отек дыхательных путей при гистологическом исследовании, но имела такую ​​же проницаемость легких, как и имитация.

Рис. 2. Острое повреждение легких развивается после инфузии лимфы T/HS и ослабляется CPSI-121.

Острое повреждение легких (ALI) присутствует в гистологии легкого после инфузии лимфы T/HS, о чем свидетельствует альвеолярное кровоизлияние (незакрашенная стрелка) и утолщение гиалиновой мембраны (закрашенная стрелка) (A).Гистология ложных животных имела нормальные гистологические признаки с тонкими альвеолярными стенками, свободными от клеточного инфильтрата. Инфузия T/SS и T/HS + CPSI-121 привела к сходным результатам гистологии с легким отеком дыхательных путей и клеточной инфильтрацией по сравнению с имитацией, но ослабленными по сравнению с T/HS. Оценка легочного повреждения была значительно выше после инфузии лимфы T/HS (9,17 ± 0,6) по сравнению с имитацией (2,83 ± 0,65, p = 0,0001), T/SS (3,83 ± 0,65, p = 0,0001) или T/HS + CPSI-121. (4,33 ± 0,6, р = 0,0022) инфузия лимфы (Б).Проницаемость легких, еще один маркер ALI, была значительно повышена у животных, которым вводили лимфу, полученную из T/HS, по сравнению с животными, которым вводили ложную, T/SS или T/HS + лимфу, полученную из CPSI-121. Среднее соотношение влажный/сухой состав составило 4,21 ± 0,271 в группе T/HS по сравнению с 1,683 ± 0,531, 2,738 ± 0,533 и 1,362 ± 0,786 в группах имитации, T/SS и T/HS соответственно (C). Точно так же абсорбция синего красителя Эвана была значительно выше в группе T/HS (2,305 ± 0,69) по сравнению с имитацией (0,449 ± 0,33), T/SS (1,051 ± 0.49) и Т/ГС + CPSI-121 (1,004 0078 0,136) (Г).

https://doi.org/10.1371/journal.pone.0168322.g002

CPSI-121 снижает рекрутирование воспалительных клеток, индуцированных T/HS лимфой, в легкие

Легочные макрофаги присутствовали в более высоких концентрациях после инфузии лимфы T/HS по сравнению с имитацией при проточной цитометрии (4,39% ± 0,75 против 1,41% ± 0,49, p = 0,026) (рис. 3). Результаты проточной цитометрии макрофагов коррелировали с окрашиванием IHC на CD68, маркер макрофагов (рис. 4A и 4B).Количество нейтрофилов также повышалось после инфузии лимфы T/HS со средним значением 10,9 клеток/HPF по сравнению с 1,7 клетками/HPF при имитационных инфузиях (p = 0,01) (рис. 4C и 4D). Инфузия Т/СС лимфы не приводила к статистически значимому увеличению уровней макрофагов и нейтрофилов. T/HS + CPSI-121 ослабляли индуцированное T/HS увеличение иммунных клеток в легких с количеством макрофагов и нейтрофилов, сходным с T/SS-лимфой.

Рис. 3. Увеличение числа макрофагов в легких после инфузии лимфы T/HS.

Вливание лимфы T/HS привело к увеличению количества легочных макрофагов, присутствующих при проточной цитометрии (4,39% ± 0,75), по сравнению с имитацией (1,41% ± 0,49, p = 0,026) и инфузией T/SS (1,99% ± 0,51, p = 0,037) (А и В). Лимфа T/HS + CPSI-121 ослабляла увеличение легочных макрофагов с количеством, сходным с T/SS (1,46% ± 0,27).

https://doi.org/10.1371/journal.pone.0168322.g003

Рис. 4. Инфильтрация иммунными клетками легких после инфузии T/HS лимфы.

При иммуногистохимическом исследовании (ИГХ) после инфузии лимфы Т/ГС было обнаружено увеличение числа макрофагов в легких, что продемонстрировано окрашиванием CD68 (А). Инфузия лимфы T/HS привела к среднему значению 19,1 CD68+ клеток/поле большого увеличения (HPF) по сравнению с 4,8 (p = 0,0329) и 5,8 (p = 0,0418) клеток/HPF в симуляции и T/SS соответственно (B). Лимфа T/HS + CPSI-121 имела сходные CD68+ клетки/HPF с T/SS (4,9). Нейтрофилы также присутствовали в повышенном количестве на IHC в образцах легких после инфузии лимфы T/HS (10.9 клеток MPO+/HPF) (C) по сравнению с имитацией (1,7 клеток MPO+/HPF, p = 0,0117) (D). Количество нейтрофилов также было увеличено при инфузии лимфы T/HS по сравнению с T/HS + CPSI-121 (4,6 клеток MPO+/HPF, p = 0,0139).

https://doi.org/10.1371/journal.pone.0168322.g004

Обсуждение

Системная воспалительная реакция, возникающая после травмы, приводит к повреждению отдаленных органов, в первую очередь легких, что наблюдается при ОПЛ или остром респираторном дистресс-синдроме [46]. Продолжающееся или неконтролируемое системное воспаление может в конечном итоге привести к развитию синдрома полиорганной дисфункции (СПОН) [47, 48], который является основной причиной смертности после травмы [49].Патогенез SIRS в настоящее время изучен не полностью, но все больше данных указывает на то, что кишечник и мезентериальная лимфа являются ключевыми медиаторами [1, 50].

Наши результаты подтверждают гипотезу SIRS о кишечной лимфе, поскольку лимфа, полученная от животных T/HS, вызывала SIRS у ранее не подвергавшихся лечению животных, в то время как лимфа, полученная от T/SS, не вызывала этого. Считается, что SIRS является результатом активации множества провоспалительных генов лейкоцитов посредством сложных сигнальных механизмов. Белки STAT представляют собой семейство факторов транскрипции, индуцируемых цитокинами и факторами роста.STAT3 присутствует в различных типах клеток и все больше признается за его роль в воспалительной реакции [44, 51, 52]. В эпителиальных клетках дыхательных путей ЛПС индуцирует сильную активацию STAT3, что коррелирует с увеличением провоспалительных цитокинов TNF-альфа [53]. Более того, фосфорилирование STAT3 необходимо для дифференцировки моноцитов в макрофаги в атеросклеротических бляшках, а ингибирование STAT3 приводит к уменьшению провоспалительных генов [54]. Годильер и др. обнаружили, что STAT3 является маркером раннего системного воспаления, демонстрируя повышенную активацию циркулирующих моноцитов CD14+ после серьезной операции.Кроме того, он обнаружил, что более высокие уровни pSTAT3 коррелируют с более длительным послеоперационным восстановлением [44]. Мы демонстрируем увеличение pSTAT3 в циркулирующих моноцитах после инфузии лимфы T/HS по сравнению с инфузией лимфы T/SS. Кроме того, инфузия T/HS-лимфы также вызывала системную гипотензию, что еще больше поддерживало реакцию SIRS у животных, получавших T/HS-лимфу [55, 56].

T/HS-лимфы также вызывали ALI у ранее не подвергавшихся лечению животных по сравнению с минимальной патологией легких, наблюдаемой у животных, подвергшихся T/SS-лимфе. ОПЛ, характеризующийся гипоксией, отеком и легочными инфильтратами, способствует высокой смертности при СПОН [45, 57].Считается, что отек легких развивается вторично вследствие повышения проницаемости сосудов легких, а также активации и инфильтрации иммунных клеток [58–60]. Мы обнаружили повышенную сосудистую проницаемость в образцах легких животных, которым инъецировали T/HS-лимфу, как в тестах EBD, так и в анализах «мокрый-сухой». Кроме того, в этих образцах легких было повышенное количество макрофагов и нейтрофилов как при проточной цитометрии, так и при ИГХ, что свидетельствует об инфильтрации иммунными клетками. Способность лимфы, полученной из T / HS, продуцировать ALI согласуется с предыдущей работой на моделях in vivo, показывающей аналогичные результаты [11, 21, 22].

В нашем исследовании лечение фармакологическими агонистами блуждающего нерва во время травмы ограничивало развитие SIRS и ALI. Эти результаты согласуются с предыдущей работой нашей и других лабораторий, где VNS способен изменять биологическую активность ML [32, 33, 61]. Хотя точный механизм еще не определен, VNS, по-видимому, изменяет воспалительную реакцию резидентных макрофагов кишечника как один из потенциальных механизмов его противовоспалительного действия [62]. VNS может ингибировать высвобождение провоспалительных сигналов от резидентных макрофагов, что затем снижает воспалительные сигналы, присутствующие при ML.Другой потенциальный механизм, с помощью которого VNS может ограничивать системное воспаление, заключается в изменении клеточного состава ML. Наша лаборатория ранее продемонстрировала результаты T/HS в снижении CD103+ MHC-II+ дендритных клеток при ML [31]. Резидентные дендритные клетки играют важную роль в регуляции воспаления, поскольку они обрабатывают антигены, которые могут присутствовать после разрушения эпителиального барьера, и изменяют баланс Т-регуляторных и Т-эффекторных клеток в брыжеечных лимфатических узлах. VNS предотвращает истощение этих клеток дендритных клеток и смещает воспалительный баланс в сторону толерантных Т-регуляторных клеток.Дальнейшая работа по пониманию того, какие конкретные компоненты ML вызывают биологическую активность, поможет определить механизм, с помощью которого VNS может оказывать защитное действие.

В настоящее время ВНС можно применять с помощью постоянного тока или с помощью фармакологических стратегий. Было показано, что CPSI-121, производное гуанилгидразона, приводит к активации эфферентных волокон блуждающего нерва после системного введения и, таким образом, может использоваться для обеспечения ВНС с помощью фармакологических средств [33]. Хотя точное терапевтическое окно неизвестно, VNS, по-видимому, дает наибольшую пользу через 1–2 часа после травмы [10, 63].Учитывая большую клиническую осуществимость введения фармакологического агента по сравнению с прямой электрической стимуляцией блуждающего нерва, фармакологическая ВНС является привлекательным вариантом, который может дать более высокий терапевтический потенциал. Результаты этой серии экспериментов представляют собой важный шаг вперед в нашем понимании способности блуждающего нерва изменять SIRS после травмы. Предыдущая работа продемонстрировала, что CPSI-121 защищает от травм, частично благодаря восстановлению барьерной функции кишечника [36].В этом исследовании мы добавляем дополнительные доказательства защитных эффектов CPSI-121 благодаря его способности модулировать биологическую активность ML, что, в свою очередь, ограничивает отдаленное повреждение органов. Эти результаты подчеркивают многообещающий потенциал этого фармакологического агониста блуждающего нерва в ограничении кишечного и системного воспаления после тяжелой травмы.

Выводы

T/HS приводит к биологически активным ML, которые повреждают отдаленные органы. Фармакологический стимулятор блуждающего нерва CPSI-121 ослабляет биологическую активность ML сразу после T/HS, уменьшая как системную воспалительную реакцию, так и развитие ОПЛ.Таким образом, CPSI-121 является потенциальной стратегией лечения для ограничения дисфункции органов-мишеней после травмы.

Благодарности

Это исследование было представлено в виде плаката на 74-м -м Ежегодном собрании Американской ассоциации хирургии травм, Лас-Вегас, штат Невада, 8 сентября -го -го, 2015 г.

Вклад авторов

  1. Концептуализация: SL TC RC.
  2. Контроль данных: SL KM.
  3. Формальный анализ: SL KM BE TC RC.
  4. Расследование: СЛ КМ.
  5. Методология: SL KM BE.
  6. Администрация проекта: BE TC RC.
  7. Ресурсы: БЭ.
  8. Программное обеспечение: БЭ.
  9. Надзор: БЭ ТК РК.
  10. Валидация: SL KM.
  11. Визуализация: SL.
  12. Письмо – первоначальный вариант: SL.
  13. Написание – просмотр и редактирование: SL BE TC RC.

Каталожные номера

  1. 1. Дейч Э.А., Сюй Д., Кайсе В.Л. Роль кишечника в развитии SIRS и MODS, вызванных травмами и шоком: гипотеза кишечно-лимфатической системы, обзор. Фронт биосай. 2006; 11: 520–8. пмид:16146750
  2. 2. Сентил М., Браун М., Сюй Д.З., Лу К., Фекетеова Э., Дейч Э.А. Кишечно-лимфатическая гипотеза синдрома системной воспалительной реакции/синдрома полиорганной дисфункции: подтверждающие исследования на модели свиньи. J Травма. 2006;60(5):958–65; обсуждение 65–7.пмид:16688055
  3. 3. Сулибурк Дж., Хелмер К., Мур Ф., Мерсер Д. Кишечник при синдроме системной воспалительной реакции и сепсисе. Ферментные системы, борющиеся с полиорганной недостаточностью. Евро Surg Res. 2008;40(2):184–9. пмид:17998777
  4. 4. Рансиман В.Б., Сковронски Г.А. Патофизиология геморрагического шока. Интенсивная терапия Анест. 1984;12(3):193–205. пмид:6517266
  5. 5. Варела Дж. Э., Кон С. М., Диас И., Джаннотти Г. Д., Проктор К. Г. Спланхническая перфузия во время отсроченной, гипотензивной или агрессивной реанимации жидкости из-за неконтролируемого кровотечения.Шок. 2003;20(5):476–80. пмид:14560114
  6. 6. Альтшулер А.Е., Рихтер М.Д., Модестино А.Е., Пенн А.Х., Хеллер М.Дж., Шмид-Шонбейн Г.В. Удаление содержимого просвета защищает тонкую кишку во время геморрагического шока, но недостаточно для предотвращения повреждения легких. Physiol Rep. 2013;1(5):e00109. Центральный PMCID PubMed: PMCPMC3841044. пмид:24303180
  7. 7. Бейкер Дж.В., Дейч Э.А., Ли М., Берг Р.Д., Специан Р.Д. Геморрагический шок вызывает транслокацию бактерий из кишечника.J Травма. 1988;28(7):896–906. пмид:3294427
  8. 8. Мур Ф.А., Мур Э.Е., Поггетти Р., Маканена О.Дж., Петерсон В.М., Абернати К.М. и др. Транслокация кишечных бактерий через воротную вену: клиническая перспектива при серьезной травме туловища. J Травма. 1991;31(5):629–36; обсуждение 36–8. пмид:2030509
  9. 9. Moore EE, Moore FA, Franciose RJ, Kim FJ, Biffl WL, Banerjee A. Постишемическая кишка служит грунтовочным слоем для циркулирующих нейтрофилов, которые провоцируют полиорганную недостаточность.J Травма. 1994;37(6):881–7. пмид:7996599
  10. 10. Кондон М., Сентил М., Сюй Д.З., Мейсон Л., Шет С.У., Сполярикс З. и др. Внутривенное введение брыжеечной лимфы, полученной при геморрагическом шоке, снижает деформируемость эритроцитов у крыс. J Травма. 2011;70(2):489–95. Центральный PMCID PubMed: PMCPMC3684280. пмид:21307751
  11. 11. Рейно Д.С., Писаренко В., Паланж Д., Дусе Д., Бониц Р.П., Лу К. и соавт. Травматический геморрагический шок, вызванный повреждением легких, включает индуцированный кишечной лимфой путь TLR4 у мышей.ПЛОС Один. 2011;6(8):e14829. Центральный PMCID PubMed: PMCPMC3150139. пмид:21829592
  12. 12. Д’Алессандро А., Дзецятковска М., Пельц Э.Д., Мур Э.Е., Джордан Дж.Р., Силлиман С.К. и др. Динамические изменения белков брыжеечной лимфы крыс после травмы с использованием масс-спектрометрии без меток. Шок. 2014;42(6):509–17. Центральный PMCID PubMed: PMCPMC4236249. пмид:25243424
  13. 13. Гото-Иноуэ Н., Манабэ Ю., Миятакэ С., Огино С., Моришита А., Хаясака Т. и др. Визуализация динамических изменений в составе липидов, вызванных сокращением, в скелетных мышцах мыши с помощью масс-спектрометрии с лазерной десорбцией / ионизацией с использованием матрицы.Анальный биоанальный хим. 2012; 403(7):1863–71. пмид:22349342
  14. 14. Цинь С., Донг В., Шарп С.М., Шет С.У., Паланж Д.К., Райдер Т. и др. Роль свободных жирных кислот, генерируемых липазой, в превращении мезентериальной лимфы из нецитотоксичной в цитотоксическую жидкость. Am J Physiol Gastrointest Liver Physiol. 2012;303(8):G969–78. Центральный PMCID PubMed: PMCPMC3469691. пмид:22899820
  15. 15. Дейч Э.А., Адамс К.А., Лу К., Сюй Д.З. Мезентериальная лимфа крыс, перенесших травмато-геморрагический шок, повреждает эндотелиальные клетки легочных микрососудов крыс, а также эндотелиальные клетки пупочной вены человека.Шок. 2001;16(4):290–3. пмид:11580112
  16. 16. Сюй ДЗ, Лу Кью, Адамс К.А., Иссекутц А.С., Дейч Э.А. Индуцированная травмой-геморрагическим шоком активация молекул адгезии эндотелиальных клеток притупляется перевязкой брыжеечных лимфатических протоков. Крит Уход Мед. 2004;32(3):760–5. пмид:15090959
  17. 17. Upperman JS, Deitch EA, Guo W, Lu Q, Xu D. Брыжеечная лимфа после геморрагического шока цитотоксична для эндотелиальных клеток и активирует нейтрофилы. Шок. 1998;10(6):407–14. пмид:9872679
  18. 18.Адамс К.А. младший, Хаузер С.Дж., Адамс Дж.М., Фекете З., Сюй Д.З., Самбол Дж.Т. и др. Примирование нейтрофилов, вызванное травмой и кровоизлиянием, предотвращается перевязкой брыжеечных лимфатических протоков. Шок. 2002;18(6):513–7. пмид:12462558
  19. 19. Дейч Э.А., Фекетеова Э., Адамс Дж.М., Форсайт Р.М., Сюй Д.З., Итагаки К. и др. Лимфа от модели геморрагического шока при травме павиана приматов активирует нейтрофилы человека. Шок. 2006;25(5):460–3. пмид:16680010
  20. 20. Заец С.Б., Березина Т.Л., Карузо Дж., Сюй Д.З., Дейч Э.А., Мачиедо Г.В.Лигирование брыжеечных лимфатических протоков предотвращает деформацию и изменение формы эритроцитов в результате шока. J Surg Res. 2003;109(1):51–6. пмид:12591235
  21. 21. Сентил М., Уоткинс А., Барлос Д., Сюй Д.З., Лу К., Абунгу Б. и др. Внутривенная инъекция мезентериальной лимфы от травма-геморрагического шока вызывает повреждение легких, которое зависит от активации пути индуцибельной синтазы оксида азота. Энн Сург. 2007;246(5):822–30. пмид:17968175
  22. 22. Magnotti LJ, Xu DZ, Lu Q, Deitch EA.Брыжеечная лимфа кишечного происхождения: связь между ожогом и повреждением легких. Арка Сур. 1999;134(12):1333–40; обсуждение 40–1. пмид:10593331
  23. 23. Zallen G, Moore EE, Johnson JL, Tamura DY, Ciesla DJ, Silliman CC. Постгеморрагический шок брыжеечной лимфы стимулирует циркулирующие нейтрофилы и провоцирует повреждение легких. J Surg Res. 1999;83(2):83–8. пмид:10329099
  24. 24. Самбол Дж.Т., Уайт Дж., Хортон Дж.В., Дейч Э.А. Индуцированное ожогом нарушение сократительной функции сердца связано с кишечными факторами, транспортируемыми в мезентериальную лимфу.Шок. 2002;18(3):272–6. пмид:12353930
  25. 25. Sambol JT, Lee MA, Caputo FJ, Kawai K, Badami C, Kawai T и другие. Лигирование брыжеечных лимфатических протоков предотвращает сократительную дисфункцию сердца, вызванную травмой/кровотечением. J Appl Physiol (1985). 2009;106(1):57–65. Центральный PMCID PubMed: PMCPMC2636941.
  26. 26. Magnotti LJ, Upperman JS, Xu DZ, Lu Q, Deitch EA. Брыжеечная лимфа, полученная из кишечника, но не портальная кровь, увеличивает проницаемость эндотелиальных клеток и способствует повреждению легких после геморрагического шока.Энн Сург. 1998;228(4):518–27. Центральный PMCID PubMed: PMCPMC1191527. пмид:97
  27. 27. Уллоа Л. Блуждающий нерв и никотиновый противовоспалительный путь. Nat Rev Drug Discov. 2005;4(8):673–84. пмид:16056392
  28. 28. Costantini TW, Bansal V, Krzyzaniak M, Putnam JG, Peterson CY, Loomis WH, et al. Стимуляция блуждающего нерва защищает от ожогового повреждения кишечника за счет активации клеток кишечной глии. Am J Physiol Gastrointest Liver Physiol. 2010; 299(6):G1308–18.Центральный PMCID PubMed: PMCPMC3774266. пмид:20705905
  29. 29. Лопес Н.Е., Кржизаняк М., Костантини Т.В., Де Майо А., Бэрд А., Элисейри Б.П. и соавт. Стимуляция блуждающего нерва блокирует воспалительную реакцию перитонеальных макрофагов после тяжелой ожоговой травмы. Шок. 2012;38(3):294–300. Центральный PMCID PubMed: PMCPMC3422402. пмид:22683732
  30. 30. Рейс Л.Г., Ортис-Помалес Ю.Т., Лопес Н., Чидл Г., де Оливейра П.Г., Элисейри Б. и соавт. Раскрытие нейроэнтеро-легочной оси: стимуляция блуждающего нерва предотвращает острое повреждение легких после геморрагического шока.Жизнь наук. 2013;92(13):783–92. пмид:23439327
  31. 31. Morishita K, Costantini TW, Eliceiri B, Bansal V, Coimbra R. Стимуляция блуждающего нерва модулирует профиль дендритных клеток в брыжеечной лимфе после геморрагического шока. J Травма неотложной помощи Surg. 2014;76(3):610–7; обсуждение 7–8. пмид: 24553526
  32. 32. Леви Г., Фишман Дж. Э., Сюй Д., Чендлер Б. Т., Фекетова Э., Донг В. и др. Парасимпатическая стимуляция через блуждающий нерв предотвращает системную дисфункцию органов, предотвращая повреждение кишечника и лимфатическую токсичность при травме и геморрагическом шоке.Шок. 2013;39(1):39–44. Центральный PMCID PubMed: PMCPMC3547655. пмид:23247120
  33. 33. Morishita K, Costantini TW, Ueno A, Bansal V, Eliceiri B, Coimbra R. Фармакологический подход к стимуляции блуждающего нерва предотвращает токсичность брыжеечной лимфатической системы после геморрагического шока. J Травма неотложной помощи Surg. 2015;78(1):52–8; обсуждение 8–9. пмид:25539203
  34. 34. Xiong Y, Mahmood A, Chopp M. Модели черепно-мозговой травмы на животных. Нат Рев Нейроски. 2013;14(2):128–42. Центральный PMCID PubMed: PMCPMC3951995.пмид:23329160
  35. 35. Альбертсмайер М., Прачке С., Чаудри И., Ангеле М.К. Влияние пола на иммунный ответ и сердечную функцию после кровоизлияния в травму и сепсиса. Висцералмедизин. 2014;30(2):91–6. Центральный PMCID PubMed: PMCPMC4513799. пмид:26288583
  36. 36. Кржизаняк М., Ортис-Помалес Ю., Лопес Н., Рейс Л.Г., Чидл Г., Вольф П. и соавт. CPSI-121 фармакологически предотвращает дисфункцию кишечного барьера после ожога кожи посредством механизма, зависящего от блуждающего нерва.J Травма неотложной помощи Surg. 2012;72(2):355–61; обсуждение 61–3. Центральный PMCID PubMed: PMCPMC4251782. пмид:22327977
  37. 37. Морисита К., Аибоси Дж., Кобаяши Т., Миками С., Йокояма Ю., Огава К. и др. Липидомный анализ мезентериальной лимфы после травмы и геморрагического шока. J Травма неотложной помощи Surg. 2012;72(6):1541–7. пмид:22695419
  38. 38. Локен М.Р., Броснан Дж.М., Бах Б.А., Олт К.А. Установление оптимальных ворот лимфоцитов для иммунофенотипирования методом проточной цитометрии.Цитометрия. 1990;11(4):453–9. пмид:1693112
  39. 39. Kittel B, Ruehl-Fehlert C, Morawietz G, Klapwijk J, Elwell MR, Lenz B, et al. Пересмотренные руководства по забору и обрезке органов у крыс и мышей — Часть 2. Совместная публикация групп RITA и NACAD. Опыт Токсикол Патол. 2004;55(6):413–31. пмид:15384248
  40. 40. Дейч Э.А., Адамс С., Лу К., Сюй Д.З. Изучение во времени защитного эффекта перевязки брыжеечных лимфатических протоков при геморрагическом шоке, вызванном повреждением легких, и токсического воздействия лимфы от шокированных крыс на проницаемость монослоя эндотелиальных клеток.Операция. 2001;129(1):39–47. пмид:11150032
  41. 41. Раду М., Чернофф Дж. Анализ in vivo для проверки проницаемости кровеносных сосудов. J Vis Exp. 2013;(73):e50062. Центральный PMCID PubMed: PMCPMC3639515. пмид:23524912
  42. 42. Deree J, Martins J, de Campos T, Putnam JG, Loomis WH, Wolf P, et al. Пентоксифиллин ослабляет повреждение легких и модулирует активность фактора транскрипции при геморрагическом шоке. J Surg Res. 2007;143(1):99–108. пмид:17950078
  43. 43. Вермален К., Пауэлс Р.Точная и простая дискриминация популяций легочных дендритных клеток и макрофагов мыши с помощью проточной цитометрии: методология и новые идеи. Цитометрия А. 2004;61(2):170–77. пмид:15382026
  44. 44. Годильер Б., Фрагиадакис Г.К., Брюгнер Р.В., Николау М., Финк Р., Тингл М. и др. Клиническое восстановление после хирургического вмешательства коррелирует с одноклеточными иммунными сигнатурами. Sci Transl Med. 2014;6(255):255ra131. Центральный PMCID PubMed: PMCPMC4334126. пмид:25253674
  45. 45. Матуте-Белло Г., Фреверт К.В., Мартин Т.Р.Животные модели острого повреждения легких. Am J Physiol Lung Cell Mol Physiol. 2008;295(3):L379–99. Центральный PMCID PubMed: PMCPMC2536793. пмид:18621912
  46. 46. Лаган А.Л., Мелли Д.Д., Эванс Т.В., Куинлан Г.Дж. Патогенез системного воспалительного синдрома и острого повреждения легких: роль мобилизации железа и декомпартментализации. Am J Physiol Lung Cell Mol Physiol. 2008;294(2):L161–74. пмид:18055843
  47. 47. Кость РК. Иммунологический диссонанс: продолжающаяся эволюция нашего понимания синдрома системной воспалительной реакции (SIRS) и синдрома полиорганной дисфункции (MODS).Энн Интерн Мед. 1996;125(8):680–7. пмид:8849154
  48. 48. Бил А.Л., Серра Ф.Б. Синдром полиорганной недостаточности в 1990-х гг. Системная воспалительная реакция и органная дисфункция. ДЖАМА. 1994;271(3):226–33. пмид:8080494
  49. 49. Minei JP, Cuschieri J, Sperry J, Moore EE, West MA, Harbrecht BG, et al. Изменение картины и последствия полиорганной недостаточности после тупой травмы с геморрагическим шоком. Крит Уход Мед. 2012;40(4):1129–35. Центральный PMCID PubMed: PMCPMC3343366.пмид:22020243
  50. 50. Дейч ЭА. Кишечная лимфа и лимфатические сосуды: источник факторов, приводящих к повреждению и дисфункции органов. Энн Н.Ю. Академия наук. 2010;1207 Приложение 1:E103–11.
  51. 51. Пак Дж.С., Квок С.К., Лим М.А., Ким Э.К., Рю Дж.Г., Ким С.М. и др. STA-21, многообещающий ингибитор STAT-3, который реципрокно регулирует клетки Th27 и Treg, ингибирует остеокластогенез у мышей и людей и облегчает аутоиммунное воспаление в экспериментальной модели ревматоидного артрита. Артрит Ревматолог.2014;66(4):918–29. пмид: 24757144
  52. 52. O’Shea JJ, Plenge R. Сигнальные молекулы JAK и STAT в иммунорегуляции и иммуноопосредованных заболеваниях. Иммунитет. 2012;36(4):542–50. Центральный PMCID PubMed: PMCPMC3499974. пмид:22520847
  53. 53. Симеоне-Пенни М.С., Северньини М., Ту П., Гомер Р.Дж., Мариани Т.Дж., Кон Л. и др. Эпителий дыхательных путей STAT3 необходим для аллергического воспаления в мышиной модели астмы. Дж Иммунол. 2007;178(10):6191–9. пмид:17475846
  54. 54.Vasamsetti SB, Karnewar S, Kanugula AK, Thatipalli AR, Kumar JM, Kotamraju S. Метформин ингибирует дифференцировку моноцитов в макрофаги посредством AMPK-опосредованного ингибирования активации STAT3: потенциальная роль в атеросклерозе. Диабет. 2015;64(6):2028–41. пмид:25552600
  55. 55. Bone RC, Balk RA, Cerra FB, Dellinger RP, Fein AM, Knaus WA и соавт. Определения сепсиса и органной недостаточности и рекомендации по использованию инновационных методов лечения сепсиса. Комитет консенсусной конференции ACCP/SCCM.Американский колледж врачей-пульмонологов/Общество реаниматологии. Грудь. 1992;101(6):1644–55. пмид:1303622
  56. 56. Рангель-Фраусто М.С., Питте Д., Костиган М., Хванг Т., Дэвис К.С., Венцель Р.П. Естественное течение синдрома системной воспалительной реакции (SIRS). Перспективное исследование. ДЖАМА. 1995;273(2):117–23. пмид:7799491
  57. 57. Уэр Л.Б., Маттей М.А. Острый респираторный дистресс-синдром. N Engl J Med. 2000;342(18):1334–49. пмид:10793167
  58. 58.Маттей М.А., Циммерман Г.А. Острое повреждение легких и острый респираторный дистресс-синдром: четыре десятилетия исследований патогенеза и рационального лечения. Am J Respir Cell Mol Biol. 2005;33(4):319–27. Центральный PMCID PubMed: PMCPMC2715340. пмид:16172252
  59. 59. Lamy M, Fallat RJ, Koeniger E, Dietrich HP, Ratliff JL, Eberhart RC, et al. Патологические особенности и механизмы гипоксемии при респираторном дистресс-синдроме взрослых. Ам преподобный Респир Дис. 1976;114(2):267–84. пмид:788563
  60. 60.Циммерман Г.А., Ренцетти А.Д., Хилл Х.Р. Адгезия гранулоцитов в образцах легочной и системной артериальной крови у пациентов с респираторным дистресс-синдромом взрослых. Ам преподобный Респир Дис. 1984;129(5):798–804. пмид:6721278
  61. 61. Моришита К., Коимбра Р., Лангнесс С., Элисейри Б.П., Костантини Т.В. Нейроэнтеральная ось модулирует баланс регуляторных Т-клеток и Т-хелперов 17 в мезентериальном лимфатическом узле после травмы/геморрагического шока. Am J Physiol Gastrointest Liver Physiol.2015;309(3):G202–8. пмид:26045612
  62. 62. де Йонге В.Дж., ван дер Занден Э.П., ФО, Бийлсма М.Ф., ван Вестерлоо Д.Дж., Беннинк Р.Дж. и др. Стимуляция блуждающего нерва ослабляет активацию макрофагов за счет активации сигнального пути Jak2-STAT3. Нат Иммунол. 2005;6(8):844–51. пмид:16025117
  63. 63. Кржизаняк М., Петерсон С., Лумис В., Хагени А.М., Вольф П., Рейс Л. и др. Посттравматическая стимуляция блуждающего нерва защищает от разрушения эпителиального барьера кишечника.J Травма. 2011;70(5):1168–75; обсуждение 75–6. Центральный PMCID PubMed: PMCPMC4241239. пмид: 21610431

Геморрагический шок

Определение (МЕДЛАЙНПЛЮС)

Кровотечение – потеря крови. Это может произойти внутри или вне тела.Кровотечение может быть реакцией на порез или другую рану. Также это может быть следствием повреждения внутренних органов.

Есть много ситуаций, в которых вы можете истекать кровью. Синяк кровоточит под кожей. Некоторые инсульты вызваны кровоизлиянием в мозг. Другие кровотечения, такие как желудочно-кишечные кровотечения, кашель с кровью или вагинальные кровотечения, могут быть симптомом заболевания.

Обычно, когда вы истекаете кровью, ваша кровь образует сгустки, чтобы остановить кровотечение.Сильное кровотечение может потребовать оказания первой помощи или поездки в отделение неотложной помощи. Если у вас нарушение свертываемости крови, ваша кровь обычно не образует сгустков.

Определение (NCI_NCI-ГЛОСС) В медицине потеря крови из поврежденных сосудов. Кровоизлияние может быть внутренним или наружным и обычно сопровождается обильным кровотечением за короткое время.
Определение (NCI) Истечение крови из лопнувшего кровеносного сосуда.
Определение (МСХ) Кровотечение или истечение крови из сосуда.
Определение (CSP) истечение крови из сосудов; кровотечение.
Концепции Патологическая функция ( Т046 )
МШ D006470
МКБ9 459.0
МКБ10 Р58
SnomedCT 123106001, 303123004, 155459009, 195511004, 131148009, 50960005
ЛНЦ ЛА7418-2, ЛА7441-4
Английский Кровоизлияния, Кровотечение, Кровоизлияние, КРОВОТЕЧЕНИЕ БДУ, КРОВОИЗЛИЯ БДУ, Кровотечение БДУ, Кровотечение неуточненное, Кровотечение БДУ, кровоизлияние, кровоизлияние (диагноз), кровотечение (симптом), кровотечение, Экстравазация крови, Кровопотеря (БДУ), Кровотечение неуточненное, Гем, Кровотечение (БДУ), Термин кровотечения, Кровотечение [Болезнь/Обнаружение], проблема с кровотечением, проблемы с кровотечением, кровотечения, кровоизлияния, кровотечение, кровоизлияния, кровопотеря, Кровотечение БДУ (нарушение), Кровотечение (нарушение), Кровотечение БДУ (нарушение) , КРОВОТЕЧЕНИЕ, КРОВОТЕЧЕНИЕ, Экстравазация крови, Кровопотеря, Кровоизлияние, Кровоизлияние (морфологическая аномалия), Кровотечение (нахождение), кровь; экстравазация, экстравазация; кровь, Кровотечение, БДУ, Кровотечение, БДУ, Кровотечение, БДУ, Кровотечение -RETIRED-, кровотечение
Итальянский Stravaso di sangue, Emorragia NAS, Emorragia (NAS), Emorragia terminale, Emorragia, nonspecificata, Fuoriuscita di sangue dai vasi sanguigni, Fuoriuscita di sangue, Perdita ematica, NAS, Sanguinamento, Emorragia
Голландский niet-gespecificeerde bloeding, hem, bloedingsperiode, bloeding, niet-gespecificeerde hemorragie, bloedverlies (NAO), hemorragie NAO, hemorragie (NAO), bloed; экстравазация, экстравазация; кровоточащий, кровоточащий, кровоточащий, кровоточащий, кровоточащий
Французский Геморрагия SAI, Геморрагия, non précisée, Hém, Терминальная геморрагия, Выпот крови SAI, ГЕМОРРАГИЯ SAI, Экстравазация крови, Кровотечение, Saignement
немецкий Blutung, unspezifisch, Hem, Bluten, Blutverlust (NNB), Blutung (NNB), Blutung, term, Blutung NNB, BLUTUNG NNB, Austritt von Blut, Blutung, Hämorrhagie
Португальский Hemorragia NE, Heme, Perda de sangue NE, Hemorragia de termo, HEMORRAGIA NE, Extravasão de sangue, Hemorragia, Sangramento
Испанский Геморрагия крови (NEOM), геморрагия NEOM, геморрагия неспецифическая, Hem, геморрагия (NEOM), геморрагия SE, сангранте (concepto no activo), кровотечение БДУ, геморрагия, SAI, сангранте, геморрагия, SAI (трасторно), кровотечение БДУ, Sangrado, extravasación de sangre, геморрагия (аномалия морфологической), геморрагия (hallazgo), геморрагия, sangrado, Extravasación sanguínea, Hemorragia, Sangramiento
Японский 出血 nos, 出血 (nos), 血液 溢出, ケツエキイツシュツ, シュッケツ, シュッケツ nos, ケツエキイッシュツ, シュッケ ツショウ サイフメイ, 出血, 詳細 不明, 失血, 出血
Шведский Блёднинг
Чехия кровоизлияние, кровоизлияния, Ztrata krve z (NOS), Krevní výron, Krvácení, bliže neurčené, Krvácení (NOS), Krvácení, Hem, Krvácení NOS
Финский Веренвуото
Русский ГЕМОРРАГИИ, КРОВОТЕЧЕНИЯ, КРОВОИЗЛИЯНИИ, ГЕМОРРАГИИ, КРОВОИЗЛИЯ, КРОВОТЕЧЕНИЯ
Хорватский КРВАРЕНЬЕ
Латышский Не переведено[Кровоизлияние]
польский Крвоток
Венгерский Верзес к.

Добавить комментарий

Ваш адрес email не будет опубликован.

Copyright © 2008 - 2022