Ротавирус как: ᐈ Ротавирус: симптомы, лечение ~【Киев】

Содержание

Ротавирус не дремлет — Медицинский центр «Айболит» в Казани

Обычно в осенне-зимний период больше всего мы боимся заразиться гриппом. Однако не спит в это время и другой враг – так называемый кишечный грипп, или ротавирус, особенно опасный для маленьких детей. Рассказать о ротавирусной инфекции мы попросили нашего врача-педиатра,  Назмееву Эльмиру Шайхулловну.

– Если раньше вспышки ротавирусной инфекции наблюдались в основном в летнее время, то сейчас заболевание приобрело всесезонный характер. Заразиться ротавирусом крайне легко, так как передается инфекция контактным путем: через грязные руки, дверные ручки, поручни и игрушки, а также употребление пищи из посуды зараженного и т.д. Зимой ротавирус может проникнуть в организм в том числе через свежие фрукты.

Это коварное заболевание грозит абсолютно всем, однако если организм взрослого человека может перенести ротавирус как обычное пищевое расстройство (снижение аппетита, жидкий стул, небольшое повышение температуры), а порой и вовсе бессимптомно, то детский организм подвергается серьезной опасности из-за сильнейшей интоксикации и стремительно развивающегося обезвоживания. Причем чем младше ребенок, тем опаснее для него инфекция.

Симптомы

От попадания вируса в организм до появления первых симптомов обычно проходит не более 2-3 суток, острый период длится до 3-5 суток. В это время возникают тошнота, рвота, диарея, газообразование, повышение температуры тела, сухость кожных покровов. Могут наблюдаться и такие симптомы, как покраснение глаз и зева, насморк, першение в горле, кашель.

Однако надо понимать, что симптоматика в каждом отдельном случае может отличаться, так как вирус мутирует, переходя от человека к человеку. Тем не менее при ротавирусе у детей всегда отмечается болезненный живот при пальпации, а также общая слабость и гиподинамия. У грудничков может западать родничок.

Лечение

Препаратов, действие которых направлено на уничтожение ротавирусов, не существует, поэтому лечебные мероприятия направлены на борьбу с симптомами. Как правило, назначаются регидратационные, абсорбирующие, противовирусные, противодиарейные антибактериальные средства, ферментные препараты, про- и пребиотики.

ВАЖНО: тактику лечения может выбирать только врач! До прихода доктора можно дать ребенку сорбенты и обязательно восполнять потерю жидкости.  

При отсутствии аппетита не стоит кормить ребенка насильно. Питье и еда должны быть дробными. Диета включает в себя кашки на воде, легкие супы на втором бульоне, сушки, сухарики. Следует исключить из рациона фрукты, овощи и все молочные продукты.

Борьба с обезвоживанием

Самый опасный спутник ротавирусной инфекции – это обезвоживание (дегидратация), которое на фоне частой рвоты и диареи может развиться у ребенка молниеносно. Между тем потеря всего 10% жидкости для малышей фатальна!

Для отпаивания ребенка можно использовать простую воду и водно-солевой раствор. Давать питье следует часто и маленькими порциями – поначалу буквально по чайной ложке каждые 3-5 минут во избежание новых приступов рвоты. Иногда бывает необходима госпитализация, особенно если речь идет о детях до двух лет.

Профилактика

Соблюдение правил личной гигиены, тщательная обработка фруктов и овощей, кипячение воды – все это является лучшей профилактикой ротавирусной инфекции. Снизить вероятность заражения помогают прививки. В МЦ «Айболит» мы используем американскую пероральную вакцину «РотаТек», применяющуюся трехкратно у детей в возрасте до восьми месяцев.

Желаю всем крепкого здоровья!

Ротавирус — сделать прививку в Москве в ЦКБ РАН

Ротавирус – возбудитель острой кишечной инфекции, наиболее часто встречающейся у детей первых пяти лет жизни. Основной путь передачи инфекции – фекально-оральный, также встречаются — воздушно-капельный и контактно-бытовой способы.

Наряду с легким течением ротавирусной инфекции, в 2-3% случаев возможны смертельные исходы, прежде всего среди младенцев первого полугодия жизни вследствие развития быстрого обезвоживания.

Инкубационный период заболевания составляет от 15 час до 7 дней. Болеют не только дети, но и взрослые, и пожилые люди. Заболевание начинается с повышения температуры до 39°С, появления рвоты, боли в животе и водянистой диареи. Продолжительность симптомов может занимать от 3 до 9 дней.

Ребенок не может самостоятельно потреблять воду, а полученную жидкость не удерживает – теряет вместе со рвотой или жидким стулом. Потеря массы тела свыше 9% уже является жизнеугрожающей. Дети, перенесшие ротавирусную инфекцию, имеют высокий риск развития во взрослом возрасте таких тяжелых заболеваний, как сахарный диабет, болезнь Крона, неспецифический язвенный колит.

Перенесённая инфекция обеспечивает кратковременную защиту, после которой возможен повторный эпизод заболевания, но в более легкой форме.

Лечение среднетяжелых и тяжелых форм заболевания, а также любых случаев у грудничков первых месяцев жизни требует госпитализации в стационар, внутривенных введений водно-солевых растворов, приёма препаратов, направленных на нормализацию микрофлоры кишечника и др.

К сожалению, соблюдение санитарно-гигиенических мероприятий (тщательное мытье рук, использование индивидуальной посуды, предметов обихода) полноценно не защищает от данного заболевания. Болеют жители как в развитых, так и развивающихся странах. Наиболее эффективной защитой от ротавирусной инфекции является вакцинация.

На территории Российской Федерации используется пятивалентная вакцина Ротатек®, которая должна вводиться трехкратно с интервалом в 4-8 недель, что обеспечивает защиту от тяжелого течения гастроэнтерита на 98%. Существует возрастное ограничение: первая доза должна быть назначена с 6 недель до 3 месяцев жизни, последняя – не позже 32 недель жизни. Длительность приобретенного иммунитета, по разным данным, может достигать 7 лет. Причем, защита опосредованно сказывается на всех членах семьи. Результаты исследований указывают, что значительно реже заболевают ротавирусным гастроэнтеритом родители и старшие братья и сестры среди вакцинированных малышей.

Вакцинацию против ротавирусной инфекции удобно применять в виде сладкой «микстуры» в ротик малыша, а также совмещать с другими прививками, входящими в Национальный календарь профилактических прививок.

Успейте предупредить опасную кишечную инфекцию!!!

Осторожно!!! Ротавирус!!! — Ошколе.РУ

ВНИМАНИЕ, РОТАВИРУСНАЯ ИНФЕКЦИЯ!!!

Ежегодно в мире регистрируется более 25 миллионов случаев этого заболевания. Болезнь может протекать по-разному, и у большинства людей не требует приема специальных лекарств. Однако для того, чтобы не оказаться в инфекционной больнице в обществе капельниц, нужно знать первые симптомы этого заболевания, основные правила борьбы с ней и опасные признаки, которые требуют немедленного вызова врача.

Что такое ротавирусная инфекция?

Другое название этого заболевания — «кишечный грипп». Многие знают его именно по этому определению, которое не является официальным, однако очень точно отражает основную его суть. Причиной болезни являются вирусы, которые при микроскопическом изучении очень напоминают колесо. Именно отсюда болезнь и получила свое название, ведь «рота» — по-латински и есть «колесо». Они чрезвычайно устойчивы во внешней среде и легко переносят низкие температуры. Поэтому вспышки данного инфекционного заболевания регистрируют чаще в холодное время года (с октября по апрель).

Как происходит заражение ротавирусной инфекцией?

Это заболевание еще называют болезнью «грязных рук», ведь вирусные частицы проникают в организм фекально-оральным путем. Контагиозность (или заразность) заболевания крайне высока, именно поэтому, если один из членов семьи заболел, то вероятность того, что ротавирус подкосит здоровье всех остальных, приближается к 100%.

Если больной ребенок (или находящийся в стадии инкубации вируса) посетил детский сад, то есть большой риск того, что уже через 2-3 дня воспитатели в этой группе останутся без работы, если вообще сами смогут на нее прийти. Риск распространения инфекции в школе несколько ниже, ведь дети в ней общаются не так тесно, как в дошкольных учреждениях, отсутствует совместный дневной сон, общие игрушки, да и школьники более аккуратно соблюдают правила личной гигиены.

Кто более уязвим в отношении этой болезни?

Ротавирус не щадит ни молодых, ни старых. Можно совершенно уверенно утверждать, что к возрасту 5 лет каждый ребенок хотя бы раз в жизни перенес эпизод этого заболевания. После выздоровления у больного формируется иммунитет, однако он распространяется только на данную разновидность вируса, который обладает способностью постоянно видоизменяться. Поэтому, в отличие от кори или ветрянки, ротавирусной инфекцией можно болеть ежегодно, однако каждый последующий случай будет несколько легче, чем предыдущий.

По этой причине тяжелее всего переносится самый первый эпизод ротавирусной инфекции, который случается обычно в младшем дошкольном возрасте. Очень часто неправильные действия родителей становятся причиной того, что скорая помощь доставляет их вместе с малышами в инфекционное отделение детских больниц для инфузионной терапии, а в тяжелых случаях — даже в реанимацию. Взрослые люди обычно переносят болезнь легче, и вероятной причиной этого является то, что более высокая по сравнению с детьми кислотность желудочного сока пагубно действует на вирусные частицы и они не могут добраться до своей излюбленной локализации — тонкого кишечника. Однако есть особо уязвимые категории лиц, для которых ротавирусная инфекция может стать реальной угрозой:

Беременные и кормящие женщины,
Пожилые люди, страдающие хроническими болезнями,
Люди с заболеваниями, угнетающими активность иммунной системы, или принимающие иммуносупрессанты (кортикостероиды, цитостатики, после химиотерапии).

Как распознать ротавирусную инфекцию?

При общении с людьми, которые заболели кишечным гриппом, выясняется, что многие из них за 2-3 дня до начала симптомов побывали в гостях или пообщались с людьми, у которых недавно были аналогичные проявления. Поэтому в большинстве случаев причина резкого ухудшения состояния становится понятна тогда, когда предотвратить болезнь уже невозможно.

Начало заболевания почти всегда острое: больше половины людей отмечают внезапное повышение температуры до высоких цифр, головную боль, озноб, потливость, слабость, ломоту в мышцах и суставах. Одновременно с этим начинается выраженная рвота, несколько позднее к ней присоединяется диарея. Частота этих эпизодов может достигать 20-30 в сутки. Через несколько часов подобного времяпрепровождения человек начинает испытывать резкую слабость, которая даже не всегда дает ему возможность добежать до уборной комнаты. Для ротавирусной инфекции характерным признаком являются особенности каловых масс: они становятся водянистыми, пенистыми и имеют специфический сладковатый запах.

Однако совокупность симптомов индивидуальна, и даже у членов одной семьи проявления болезни могут быть разными: у одних есть температура, а у других — нет, у одних есть сильная диарея, а у других — лишь ощущение дискомфорта в животе.

Обычно острый период заболевания длится 2-3 суток, после чего состояние стабилизируется, рвота и диарея прекращаются и начинается стадия восстановления. Для уязвимых категорий опасный период может быть дольше и достигать 7 суток. На его длительность, прежде всего, влияет правильность выполнения основных лечебных мероприятий, которые были проведены самим больным (если он вообще в состоянии себе помочь) или его близкими.

Какие лекарства эффективны против ротавирусной инфекции?

Специфических лекарств, которые бы уничтожали сами вирусные частицы, не существует. Поэтому единственный, кто может с ними справиться — это собственный иммунитет больного человека. Иногда он делает это легко, а иногда ему нужно помочь. Главная опасность ротавирусной инфекции — это риск обезвоживания, ведь с рвотой и диареей больной теряет жидкость и важные электролиты (калий, магний, натрий, кальций). К примеру, выраженная мышечная слабость и боли в сердце, которые нередко появляются уже на 2 сутки болезни, обусловлены не только интоксикацией, но и потерей калия. Это очень опасно для малышей первых 2-3 лет жизни, ведь обезвоживание у них наступает гораздо быстрее, чем у взрослых людей.

Поэтому главное правило, касающееся лечения ротавирусной инфекции и которое должны знать люди, а особенно родители, это то, что необходимо любым возможным способом пытаться восстановить объем потерянной жидкости. Обычная питьевая негазированная вода не решит проблему, так как она не содержит электролитов. Поэтому нужно всегда иметь дома средства для пероральной регидратации: Регидрон, Гастролит, Гидровит, Нормогидрон или физиологический раствор. Причем приобрести их лучше до начала ротавирусной инфекции, так как, если ее симптомы уже настигли, бежать в аптеку зачастую просто нет никакой возможности.

Если так случилось, что человек не позаботился об этом заранее, данный раствор можно приготовить дома. Для этого нужно:

1 ложка поваренной соли,
1 ложка соды пищевой,
2 ложки сахара,
1 литр чистой питьевой воды.
Помимо этого, можно использовать лекарства, которые помогут остановить диарею и рвоту.

Когда нужно вызывать неотложку?

И, тем не менее, далеко не всегда удается справиться с этой болезнью самостоятельно. Например, маленькие дети при обезвоживании или в тяжелом состоянии довольно часто отказываются пить вообще, и влить в них жидкость оказывается большой проблемой. В таком случае риск осложнений становится очень высоким. Ситуации, когда немедленно нужен врач:

Нарушение сознания, от легкого оглушения до потери,
Больной стал апатичен, вял, отказывается вступать в контакт
Отсутствие мочи более суток,
Больной не может пить или отказывается,
Если есть сопутствующие тяжелые болезни,
Диарея и рвота длятся дольше 2 суток,
Ребенок первого года жизни — в этом случае всегда вызывается скорая помощь.

Ротавирус по прозвищу «Кишечный грипп». Как уберечь ребенка от такой компании?

Ротавирусная инфекция — инфекционное заболевание, которое проявляется сочетанием кишечного и респираторного синдрома. Вызывается эта инфекция ротавирусом из семейства реовирусов. Чаще ротавирусная инфекция встречается у детей, заражению особенно подвержены дети от 6 месяцев до 5 лет.

Сезонность у этой инфекции зимне-весенний период, но спорадические вспышки регистрируются на протяжении всего года. Для данной инфекции характерна высокая контагиозность.

Ротавирус также преследует нас на морских курортах. Отели, бассейны и другие места скопления людей – среда, которая способствует его быстрому распространению.


Симптомами ротавируса чаще бывают:

Особенно опасен недуг для детей младшего возраста, так как у них часто развиваются осложнения в виде обезвоживания, сердечно-сосудистой и почечной недостаточности, наиболее частым осложнением после перенесенной инфекции являются дисбактериоз кишечника, гастрит, энтероколит.

При ротавирусной инфекции важна ранняя диагностика и своевременно начатая терапия — этиотропное, патогенетическое, симптоматическое лечение.

Профилактика ротавирусной инфекции включает в себя:

  • соблюдение правил личной гигиены

  • раннее выявление и изоляция заболевшего

  • мероприятия в очаге инфекции.

Еще одна превентивная мера — вакцинация против ротавирусной инфекции.

Вакцинацию от ротавирусной инфекции можно начинать детям с 6-недельного возраста. Первую вакцину ребенок должен получить в возрасте от 6 недель до 3 месяцев. Вакцинация проводится трехкратно, с интервалом в 1 месяц. Если по каким-либо причинам интервалы между вакцинациями увеличиваются, то последнюю, третью вакцинацию, желательно провести не позднее 8-месячного возраста.

В нашей клинике применяется вакцина РотаТек (Merck), которая защищает от 5-ти самых опасных типов ротавируса.

Перед вакцинацией врач-педиатр проводит обязательный профилактический осмотр ребенка.



Ротавирус (Rotavirus, диарейный синдром), антигенный тест (Rotavirus Direct Detection by latex agglutination)

Метод определения Однофазный иммунохроматографический

Исследуемый материал Кал

Доступен выезд на дом

Определение антигена ротавируса в кале.

Ротавирус открыт Р. Бишоп в 1973 г. В 1979 г. ВОЗ утверждён термин «ротавирус». Относится к семейству Reoviridae, роду Rotavirus. От латинского rota колесо: вирусы под электронным микроскопом выглядят как маленькие колёсики с толстой втулкой, короткими спицами и тонким ободом. Размеры частиц от 65 до 75 µ. Из 9 серологических типов у человека встречаются типы 1 — 4 и 8 — 9. Во внешней среде устойчив; быстро погибает при кипячении. Заболевание — ротавирусная инфекция — широко распространено. Болеют чаще дети в возрасте до 3 лет, преимущественно в зимне-осенний период. 30 — 50% всех случаев поноса, требующих госпитализации и проведения инфузионной терапии, обусловлено этим вирусом. Нередко заболевают и взрослые с ослабленным иммунитетом. Заболевание передаётся только от человека к человеку фекально-оральным путём. Инкубационный период — от 15 часов до 7 суток. Повышается температура, достигая 38°С и выше. 

Типичные симптомы — поражения органов пищеварения: обильный жидкий водянистый стул без примеси слизи и крови, но с резким запахом. Часто бывает рвота. Может развиться обезвоживание, в тяжёлых случаях требующее интенсивной терапии регидратации. В начале болезни может быть лейкоцитоз, который в периоде разгара сменяется лейкопенией. Дифференцируют ротавирусную инфекцию от холеры, дизентерии, эшерихиоза, гастроинтестинальных форм сальмонеллёза, кишечного иерсиниоза, протозойных заболеваний (лямблиоз, криптоспоридиоз, балантидиаз).

Витебский зональный центр гигиены и эпидемиологии

Ротавирусная инфекция.

С острыми кишечными инфекциями сталкиваются люди любого возраста, но наиболее тяжело их переносят маленькие дети и ослабленные другими недугами больные. Возбудителями заболеваний пищеварительного тракта могут быть различные бактерии и вирусы, однако чаще  гастроэнтериты в холодный период года  вызывают именно ротавирусы. За 2016 год ротавирусной инфекцией переболели 324 жителя г. Витебска и 36 жителей Витебского района, из них 316 детей.  За январь текущего года диагноз ротавирусной инфекции выставлен 44 больным.

Ротавирусная инфекция – острая вирусная болезнь, при которой развивается гастроэнтерит, выраженная интоксикация и обезвоживание организма, а также различные респираторные симптомы. Наиболее подвержены данному заболеванию маленькие дети. Передается ротавирусная инфекция преимущественно фекально-оральным путем, относительно возможности других механизмов инфицирования (в особенности воздушно-капельного) ведутся исследования. Ротавирусы представляют собой микроскопические частицы похожие по форме на колесо, очень устойчивые к условиям внешней среды. Выделяют 9 типов ротавирусов. Как показали исследования, опасные для людей штаммы вирусов циркулируют обычно с сентября по март.

Как передается ротавирусная инфекция? Источник ротавируса – больной человек, который выделяет возбудитель с фекалиями, причем заразный период (на протяжении которого вирус обнаруживается в испражнениях) длится всю болезнь и еще около 10 дней после ее окончания. Кроме этого, источником инфекции может быть и совершенно здоровый носитель.

Симптомы ротавирусной инфекции. От заражения вирусом до развития болезни проходит в среднем 1-3 дня – это инкубационный период. После него у больного появляются основные признаки ротавирусной инфекции: повышенная температура, повторная рвота, диарея до 10 и более раз в сутки, метеоризм, спазмы и боль в животе, сильное урчание, интоксикация – слабость, бледность, отсутствие аппетита, катаральные явления – насморк, покраснение горла, покашливание, конъюнктивит. Стул при ротавирусной инфекции сначала имеет кашицеобразный характер, позже становится водянистым, резко и неприятно пахнущим. Если болезнь протекает тяжело, с обильной рвотой и многократной диареей, у больного могут появиться признаки  обезвоживания. На то, сколько длится ротавирусный гастроэнтерит, влияет возраст больного, состояние его организма и наличие сопутствующей патологии. Тяжелые формы недуга и осложнения могут развиться у новорожденных и детей до 1 года, пожилых людей, лиц с хроническими заболеваниями кишечника. При неосложненном течении ротавирусного гастроэнтерита острый период длится 5-7 дней, процесс выздоровления еще около 5 дней.

Ротавирусная инфекция у детей. Практически каждый ребенок до 5 лет переболевает ротавирусным заболеванием. Причем впервые это чаще всего происходит в возрасте от полугода до 12 месяцев, когда у грудничка «заканчиваются» материнские антитела, и начинает формироваться своя иммунная защита. Особенностями течения ротавирусного гастроэнтерита у детей до 1 года являются очень быстрое развитие обезвоживания и сильная интоксикация, поэтому появление рвоты и даже незначительных кишечных расстройств в этом возрасте требует незамедлительной консультации врача. Что характерно для детей, болезнь может иметь две фазы: респираторную и кишечную. При этом гастроэнтерит развивается после угасания катаральных симптомов.

Диагностика. Часто диагноз ставится на основании симптомов и жалоб больного. При этом наиболее достоверный метод диагностики ротавирусной инфекции – это специфический анализ кала. Многих родителей больных малышей интересует вопрос о том, как отличить ротавирус от отравления, поскольку симптоматика этих состояний схожа. Основная разница заключается в наличии катаральных явлений при ротавирусном заболевании, а также характерной сезонности (осенне-зимней), что для пищевых отравлений не свойственно. Впрочем, самостоятельно ставить диагноз не стоит, и в любом случае необходима консультация доктора, тем более, если заболел ребенок.

Можно ли повторно заболеть? Можно и неоднократно, что как раз часто встречается среди детей. С возрастом желудочно-кишечный тракт становится устойчивее к бактериям и вирусам, а иммунная система – крепче, поэтому взрослые болеют ротавирсуным гастроэнтеритом реже, хотя все зависит от состояния здоровья человека и индивидуальных особенностей пищеварения.

Как не заразиться? Основные правила: чаще мыть руки, приучать детей к обязательному соблюдению гигиены; пить кипяченую воду; обрабатывать кипятком детскую посуду и пустышки, периодически мыть игрушки с мылом. Если в семье кто-то заболел, провести тщательную влажную уборку, обработать дверные ручки, поверхности дезинфицирующими средствами, обязательно изолировать больных от здорового окружения.

Ротавирус в кале

Ротавирус (ротавирусная инфекция) — широко распространённое заболевание. Чаще всего болеют дети в возрасте до 3 лет, преимущественно в зимне-осенний период. Треть/половина случаев поноса у детей, требующих госпитализации и проведения инфузионной терапии, обусловлена ротавирусом. Также инфекцию могут подхватить и взрослые с ослабленным иммунитетом. Болезнь передаётся только от человека к человеку фекально-оральным путём. Инкубационный период составляет 15 часов–7 суток.

Типичные симптомы — повышение температуры от 38 °С и выше, поражения органов пищеварения: обильный жидкий водянистый стул без примеси слизи и крови, но с резким запахом, рвота, обезвоживание. В начале болезни может быть лейкоцитоз, который в периоде разгара сменяется лейкопенией. Дифференцируют ротавирусную инфекцию от холеры, дизентерии, эшерихиоза, гастроинтестинальных форм сальмонеллёза, кишечного иерсиниоза, протозойных заболеваний (лямблиоз, криптоспоридиоз, балантидиаз).

Показания:

  • диарея у детей до трёх лет;
  • диарея у детей старше трёх лет и у взрослых, контактировавших с больным (ротавирус) ребёнком;
  • дифференциальная диагностика заболеваний, характеризующихся диареей;
  • контроль эффективности терапии;
  • требования эпидемиологов в связи с эпидемиологической ситуацией.
Подготовка


Кал собирается в количестве не более 1/3 объёма контейнера. Хранение при температуре … +2+8. Материал необходимо доставить в медицинский офис в течение 24 часов.

Кал собирается после самопроизвольной дефекации в одноразовый пластиковый контейнер с герметичной крышкой и ложечкой-шпателем для отбора пробы. Следует избегать примеси к калу мочи и отделяемого половых органов.

Ограничение!

Так как через неделю с момента заражения число паразитов в фекалиях снижается, делая образцы менее реактивными, образцы кала для анализа должны быть собраны в течение одной недели с момента появления симптомов заболевания.

Интерпретация результатов
Единицы измерения: качественное определение.

Референсные значения: отрицательный результат.

Появление конских штаммов G3 в качестве доминирующего ротавируса среди детей в возрасте до пяти лет с диареей в Сабахе, Малайзия, в 2018–2019 гг.

Abstract

Ротавирусная инфекция представляет собой дилемму для развивающихся стран, включая Малайзию. Хотя коммерческие ротавирусные вакцины доступны, они не включены в национальную программу иммунизации Малайзии. Недостаток данных о распределении генотипов ротавирусов может быть частично виноват в этом политическом решении, потому что нет данных о распределении генотипов ротавирусов в Малайзии за последние 20 лет.С января 2018 года по март 2019 года мы провели исследование для выяснения бремени ротавируса и распределения генотипов в районах Кота-Кинабалу и Кунак штата Сабах. Образцы стула были взяты у детей в возрасте до 5 лет, и антиген ротавируса в этих образцах был обнаружен с помощью имеющегося в продаже набора. Электрофорезом геномной РНК определяли электрофорез в полиакриламидном геле. Генотипы G и P определяли с помощью ОТ-ПЦР с использованием типоспецифичных праймеров. Нуклеотидную последовательность ампликонов определяли секвенированием по Сэнгеру, а филогенетический анализ выполняли методом объединения соседей.Ротавирус выявлен у 43 (15,1%) детей с водянистой диареей. Соотношение мужчин и женщин (1,9: 1) среди детей, инфицированных ротавирусом, ясно показало, что это поражает преимущественно мальчиков и детей в возрасте от 12 до 23 месяцев. Идентифицированные генотипы: G3P [8] (74% n = 31), затем G1P [8] (14% n = 6), G12P [6] (7% n = 3), G8P [8] (3% n = 6). = 1) и GxP [8] (3% n = 1). Преобладающим ротавирусом, циркулирующим среди детей, был конский G3P [8] (59,5% n = 25) с коротким электрофорезом. Среди 34 штаммов было идентифицировано одиннадцать электроферотипов, что указывает на значительное разнообразие циркулирующих штаммов.Циркулирующие генотипы также были филогенетически разнообразны и связаны со штаммами из нескольких разных стран. Антигенные эпитопы, присутствующие на VP7 и VP4 Sabahan G3 и конского G3, значительно отличались от эпитопов вакцинного штамма RotaTeq. Наши результаты также показывают, что у штаммов Sabahan происходит значительный генетический обмен. Сабах является домом для ряда различных этнических групп, некоторые из которых в культурном отношении находятся в тесном контакте с животными, что может способствовать эволюции различных штаммов ротавирусов.Сабах также является популярным туристическим направлением, и большое количество туристов из разных стран, возможно, вносит свой вклад в разнообразие циркулирующих генотипов ротавирусов. Учитывая все эти факторы, которые способствуют разнообразию генотипов ротавирусов, постоянное наблюдение за штаммами ротавирусов имеет первостепенное значение для мониторинга эффективности ротавирусных вакцин до и после вакцинации в Сабахе.

Образец цитирования: Amit LN, Mori D, John JL, Chin AZ, Mosiun AK, Jeffree MS, et al.(2021) Появление конских штаммов G3 в качестве доминирующего ротавируса среди детей в возрасте до пяти лет с диареей в Сабахе, Малайзия, в 2018–2019 годах. PLoS ONE 16 (7): e0254784. https://doi.org/10.1371/journal.pone.0254784

Редактор: Кок Кенг Ти, Малайский университет, МАЛАЙЗИЯ

Поступила: 12 января 2021 г .; Принята к печати: 3 июля 2021 г .; Опубликовано: 28 июля 2021 г.

Авторские права: © 2021 Amit et al.Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника.

Доступность данных: Все соответствующие данные находятся в рукописи.

Финансирование: Исследование финансировалось Министерством высшего образования в рамках гранта FRGS (Программа грантов на фундаментальные исследования) (FRGS 0457-2017) (URL: https: // mygrants.gov.my) к KA. Спонсор не играл никакой роли в дизайне исследования, сборе и анализе данных, решении опубликовать или подготовке рукописи.

Конкурирующие интересы: Авторы заявили, что никаких конкурирующих интересов не существует.

Введение

Ротавирус — это необолочечный двухцепочечный РНК-вирус, принадлежащий к семейству Reoviridae [1]. Его геном состоит из 11 генных сегментов, окруженных внутренним ядром, самым внутренним слоем, который соединен с внешним капсидом промежуточным капсидом.Внешний капсид состоит из гликозилированного белка VP7 и белка VP4, чувствительного к остроконечной протеазе [2,3]. Белки VP4 и VP7 содержат эпитопы, которые индуцируют нейтрализующие антитела [4,5]. Эти белки также определяют генотипы P и G, которые объединяются для создания двойной системы классификации ротавирусов. К настоящему времени у ротавирусов идентифицировано 36 генотипов G и 51 P [6]. Генотипы G1, G2, G3, G4, G9, P4, P6 и P8 обычно обнаруживаются в циркулирующих штаммах. В глобальном масштабе G1P [8], G2 [P4], G3P [8], G4P [8], G9P [8] / P [6] и G12P [8] / P [6] являются доминирующими генотипами, обнаруживаемыми во время инфекций человека [ 7,8].Более того, новые ротавирусы с различными генотипами были обнаружены в результате перегруппировки генов ротавирусов человека и животных [9,10].

Ротавирусы также можно классифицировать на основе характера миграции сегментированного генома при электрофорезе в полиакриламидном геле (PAGE), называемом электрофорезом. Существует два основных типа электрофорезов, длинных и коротких, которые различаются скоростью миграции сегмента 10, содержащего ген NSP5. Это происходит в результате вставки AT-богатых последовательностей в 3-концевую некодирующую область сегмента 11 [11], что вызывает инверсию порядка миграции генных сегментов 10 и 11 [8].Существует общая корреляция между типом G / P и электрофорезом. Штаммы G1P [8], G3P [8], G4P [8] и G9P [8] демонстрируют длинный электрофорезный паттерн, тогда как G2P [4] демонстрируют короткий электрофорезный паттерн.

Две коммерчески доступные вакцины, Rotarix и RotaTeq, были рекомендованы Всемирной организацией здравоохранения (ВОЗ) для всех национальных программ иммунизации, особенно для стран Южной и Юго-Восточной Азии и Африки к югу от Сахары [12], после того как они привели к значительному сокращению при тяжелых ротавирусных инфекциях в промышленно развитых странах [13,14].В Малайзии обе ротавирусные вакцины доступны на частном рынке и по состоянию на 15 июля 2019 г. Rotarix — это моновалентная вакцина, полученная из изолята человеческого G1P [8]. RotaTeq является пятивалентным, состоящим из смеси моноассортантов ротавируса крупного рогатого скота, несущих гены, кодирующие человеческие белки G1, G2, G3, G4 и P [8] на генетическом фоне ротавируса крупного рогатого скота G6P [5] [15]. По состоянию на апрель 2018 г. 95 стран включили ротавирусные вакцины в свои национальные программы иммунизации, включая многие страны с низким уровнем доходов [16].Помимо этих вакцин, несколько стран разрабатывают свои собственные ротавирусные вакцины на основе преобладающих генотипов, циркулирующих в этих странах; например, в 2016 году Индия представила Ротавак, моновалентную вакцину, полученную на основе штамма G9P [11] [16,17]. Эта вакцина внесена в список преквалифицированных ВОЗ [16]. В 2018 г. Индия включила Ротасил, поливалентную (G1, G2, G3, G4, G9 и P [8]) ротавирусную вакцину, в свою национальную программу иммунизации [18].

Ротавирус остается наиболее значимым возбудителем острого гастроэнтерита среди детей в возрасте до 5 лет во всем мире и ежегодно становится причиной около 25 миллионов госпитализаций и 450 000 смертей [19].По оценке 2015 г., развивающиеся страны Азии и Африки несут высокое бремя ротавирусной инфекции и на них приходится более 90% смертей [20]. В Малайзии ротавирус является причиной 31 000 госпитализаций, 41 000 амбулаторных посещений, 145 000 эпизодов домашнего гастроэнтерита и 27 смертей в год [21]. Об исследованиях циркулирующих генотипов ротавирусов в Малайзии сообщалось с 1970-х по 2000-е годы [22]. Были идентифицированы общие генотипы ротавирусов, G1P [8], G2P [4], G3P [8] G9P [8], и их преобладание время от времени менялось [22].Однако, начиная с 2000 г., G9P [8] стал преобладающим ротавирусом, идентифицированным в Джохоре (42%) [23], Куала-Лумпуре и Кучинге (73,3%) [23,24]. Непрерывный надзор за генотипическим распределением ротавирусов на региональном уровне имеет решающее значение для обеспечения защиты Rotarix и RotaTeq от циркулирующих штаммов. Однако большинство исследований ротавируса проводилось в западной Малайзии, особенно в Куала-Лумпуре [22–24].

Малайзия состоит из 13 штатов и трех федеральных территорий, в целом разделенных на Западную и Восточную Малайзию (S1 Рис.).Западная Малайзия включает Малайский полуостров. Восточная Малайзия состоит из двух штатов и одной федеральной территории на острове Борнео. Однако восприимчивость к ротавирусу варьируется в разных регионах; например, дети в Восточной Малайзии более уязвимы к диарее, чем дети в Западной Малайзии (8,7 госпитализаций на 1000 детей против 4,3 госпитализаций на 1000 детей). Кроме того, дети из коренного населения чаще госпитализируются (11,6 госпитализаций на 1000 детей) из-за диареи, чем дети других национальностей (2.9–8,0 госпитализаций на 1000 детей) [25].

За исключением одного исследования, проведенного в больнице Королевы Елизаветы, Кота-Кинабалу в 2005–2006 гг., Которое показало, что 16% образцов положительны на ротавирусную инфекцию [26], в штате Сабах исследований не проводилось, несмотря на важность этого вируса и наличие вакцины. Также не было опубликованных исследований распределения генотипов ротавирусов в Малайзии за последние 20 лет. Более того, не было исследований распределения генотипов ротавируса среди детей Сабаха, что имеет решающее значение перед внедрением ротавирусной вакцины.Таким образом, настоящее исследование было проведено для определения циркулирующих генотипов среди детей в возрасте до 5 лет в Сабахе, что может быть полезно для выработки информированной политики по внедрению ротавирусной вакцины в этом штате.

Материалы и методы

Сбор образцов водянистого стула и информация о пациентах

С января 2018 года по март 2019 года образцы водянистого стула были взяты у детей в возрасте до 5 лет с диареей, посещавших женскую и детскую больницу Сабаха, районную больницу Кунак, поликлинику Менггатал и поликлинику Телипок.Районная больница Кунак расположена в районе Кунак, а другие больницы — в районе Кота-Кинабалу. Случай диареи был определен как отхождение трех жидких стула в течение 24-часового периода (27), и для сбора образца использовался удобный метод отбора проб. Перед взятием образцов у опекунов детей было получено письменное информированное согласие. Регистрировались возраст, пол и раса детей. Собранные образцы стула были отправлены по холодильной цепи в лабораторию Университета Малайзии Сабах, Кота-Кинабалу.До использования образцы хранили при -80 ° C.

Одобрение этики

Утверждение

по этике было получено от Национального регистратора медицинских исследований для клиник Telipok и Menggatal (NMRR-16-2245-32787), больницы для женщин и детей Сабаха (NMRR-19-3925-52370) и районной больницы Кунак (NMRR- 20-1324-55178).

Идентификация ротавируса

Образцы стула разводили в десять раз фосфатно-буферным раствором. Ротавирус идентифицировали с помощью коммерческого иммуноферментного анализа в соответствии с инструкциями производителя (Rotaclone, Meridien Diagnostics Inc, Цинциннати, США).

Выделение РНК и определение генотипа G и P ротавируса

Геномную РНК

ротавируса экстрагировали из ротавирус-положительных образцов с использованием мини-набора QIAamp Viral RNA Mini Kit в соответствии с инструкциями производителя (Qiagen GmbH, Hilden, Германия). Гены VP7 и VP4 амплифицировали амплификацией с помощью полимеразной цепной реакции с обратной транскрипцией (ОТ-ПЦР) [27] с использованием AccessQuick RT PCR MasterMix (Promega Corporation, Мэдисон, Висконсин, США). Для генотипирования G использовали праймеры VP7-R, G1, G2, G4 и G8, как описано ранее [28], в то время как для генотипов G3 и G9 использованные праймеры были описаны Gouvea et al., [28]. Праймеры для генотипирования P использовали согласно Gunasena et al. [29]. Соответствующие генотипы определяли, прежде всего, путем оценки молекулярной массы ампликонов после прогона в агарозном геле. Определяли нуклеотидное секвенирование ампликонов; генотипы определялись путем отправки нуклеотидных последовательностей в инструмент генотипирования ротавирусов (https://www.viprbrc.org/brc/rvaGenotyper.spg?method=ShowCleanInputPage&decorator=reo).

Секвенирование нуклеотидов, филогенетический анализ и идентификация нуклеотидов

Нуклеотидную последовательность ампликонов определяли с использованием набора BigDye Terminator Cycle Sequencing Kit (v.3.1; Applied Biosystems, Foster City, CA, USA), в соответствии с инструкциями производителя, и продукт запускали на генетическом анализаторе ABI Prism 3100 (Applied Biosystems). Нуклеотидные последовательности генов VP7 и VP4 штаммов Sabahan и других штаммов, полученные из GenBank, были использованы для филогенетических анализов. Филогенетический анализ был проведен с использованием метода объединения соседей с использованием MEGA X (https://www.megasoftware.net) после выравнивания нуклеотидных последовательностей с использованием CLUSTAL W. Паттерны ветвления были оценены с использованием бутстрап-анализа 1000 повторов.Идентичность нуклеотидов генов VP7 и VP4 разных линий была рассчитана с помощью онлайн-программного обеспечения (www.bioinformatics.org).

Определение электрофореза

Геномную дцРНК экстрагировали из ротавирус-положительных образцов, и электроферотип определяли, подвергая выделенную дцРНК PAGE в соответствии с ранее опубликованным методом [30,31]. Вкратце, 5 мкл экстрагированной дцРНК, смешанной с 5 мкл загрузочного буфера, загружали в каждую дорожку 10% полиакриламидного геля и прогоняли в течение 16 ч при постоянном токе 8 мА.Нумерация электроферотипов была присвоена произвольно и основывалась на отчетливых изменениях в схемах миграции в пределах по крайней мере одной из четырех групп сегментов, то есть сегментов 1-4, 5 и 6, 7-9 или 10 и 11.

Результаты

Всего за период исследования было собрано 285 проб. Соотношение мужчин и женщин составляло 1,5: 1 (153 мужчины, 102 женщины и 30 неопределенных). Их средний возраст составлял 18 месяцев и колебался от 15 дней до 66 месяцев (только одному ребенку было 66 месяцев).Ротавирус был обнаружен в 15,1% (43/285) проб. Соотношение мужчин и женщин среди детей, инфицированных ротавирусом, составляло 1,9: 1. Средний возраст пациентов с ротавирусной диареей составлял 14 месяцев и колебался от 15 дней до 55 месяцев. Ротавирус чаще всего выявляли у детей в возрасте 12–23 месяцев, за которыми следовали дети в возрасте 24–35 месяцев (рис. 1). Ротавирус реже поражал детей в возрасте 6–11 месяцев и 48–59 месяцев.

Сорок два ротавирус-положительных образца были доступны для генотипирования G и P.Преобладающим генотипом G был G3 (74% n = 31), за которым следовали G1 (14% n = 6), G12 (7% n = 3), G8 (2% n = 1) и в одной выборке (2%). генотип G определить не удалось. Генотипы P были идентифицированы в 42 образцах, положительных на ротавирус. Преобладающим генотипом P был P [8], который был обнаружен в 39 (93%) проб, за ним следует P [6] в 3 (7%) проб. Основываясь на комбинациях генотипов G и P, преобладающим генотипом был G3P [8] (74% n = 31), за ним следовал G1P [8] (14% n = 6), G12P [6] (7% n = 3). , G8P [8] (3% n = 1) и GxP [8] (3% n = 1).

Из образцов, подвергнутых PAGE, все 11 сегментов можно было идентифицировать в 34 образцах и определить их электроферотипы. Все 11 сегментов не были видны в остальных образцах, поскольку выход геномной РНК был менее вероятным из-за более низкой концентрации вирусных частиц. Были идентифицированы три коротких и восемь длинных паттернов электрофореза (рис. 2). Среди коротких электроферотипов 11 штаммов принадлежали к S1, 11 — к S2 и 1 — к электроферотипу S3. Среди длинных электроферотипов было по два электроферотипа L1, L2 и L3.Был по одному штамму каждого электроферотипа L4, L5, L6, L7 и L8.

Рис. 2. Электроферотипы ротавирусов, идентифицированные в штате Сабах.

Всего идентифицировано 11 электроферотипов, идентифицировано три коротких (S1 – S3) и восемь длинных (L1 – L8) паттернов электрофореза. Номер штамма и генотип каждого электроферотипа показаны над электроферотипом.

https://doi.org/10.1371/journal.pone.0254784.g002

Филогенетический анализ гена VP7 генотипа G1 показал, что два штамма ротавируса G1 из Сабаха сформировали независимый кластер, но были тесно связаны со штаммами из Индонезии и принадлежали к линии Ic (рис. 3).Штаммы Sabahan генов VP7 имели 99,9% нуклеотидной идентичности между собой и 99,5–99,8% идентичности с индонезийскими штаммами. Один штамм G1 образовал кластер со штаммами из Южной Африки и Вьетнама и принадлежал к линии II. Эти штаммы имели между собой 99,2–99,5% нуклеотидной идентичности. Остальные три штамма из Сабаха также принадлежали к линии II и сгруппированы со штаммом из Пакистана. Нуклеотидная идентичность штаммов из Сабаха составляла 99,8–99,9%. Общее количество штаммов Sabahan — 99.Идентичность нуклеотидов 5–99,6% с пакистанским штаммом.

Рис. 3. Филогенетическое дерево, построенное с использованием нуклеотидных последовательностей гена VP7 штаммов G1.

Человеческий ротавирус Kh310 (G5) использовался в качестве внешней группы. Число рядом с узлом представляет собой значение начальной загрузки, и значения ниже 70% не указаны. Масштабная линейка показывает генетическое расстояние, выраженное в количестве нуклеотидных замен на сайт. Штаммы, идентифицированные в этом исследовании, отмечены закрашенным кружком. Штаммы из Сабаха принадлежат к родословной Ia и II.Нуклеотидные последовательности наших штаммов были отправлены в базы данных банка данных ДНК Японии, Европейской лаборатории молекулярной биологии и GenBank. Номера доступа указаны в начале каждого штамма.

https://doi.org/10.1371/journal.pone.0254784.g003

Филогенетический анализ генов VP7 показал, что наши штаммы G12 P [6] принадлежат к линии III и образуют независимый кластер; эти штаммы имели 100% нуклеотидную идентичность. Штамм из Китая был близок к этому кластеру и разделял 99.6% идентичности со штаммами Sabahan (рис. 4). Единственный штамм G8P [8] из Сабаха сформировал кластер со штаммами из Таиланда, Японии, Вьетнама и Чехии (рис. 5). Эти штаммы имели между собой 99,5–99,7% нуклеотидной идентичности.

Рис. 4. Филогенетическое дерево, построенное с использованием нуклеотидных последовательностей гена VP7 штаммов G12.

Человеческий ротавирус Wa-40-AG (G1) использовался в качестве внешней группы. Число рядом с узлом представляет собой значение начальной загрузки, и значения ниже 70% не указаны.Масштабная линейка показывает генетическое расстояние, выраженное в количестве нуклеотидных замен на сайт. Штаммы, идентифицированные в этом исследовании, отмечены закрашенным кружком. Штаммы из Сабаха принадлежат к линии III. Нуклеотидные последовательности наших штаммов были отправлены в базы данных банка данных ДНК Японии, Европейской лаборатории молекулярной биологии и GenBank. Номера доступа указаны в начале каждого штамма.

https://doi.org/10.1371/journal.pone.0254784.g004

Рис.5.Филогенетическое дерево, построенное с использованием нуклеотидных последовательностей гена VP7 штаммов G8.

Человеческий ротавирус Wa-40-AG (G1) использовался в качестве внешней группы. Число рядом с узлом представляет собой значение начальной загрузки, и значения ниже 70% не указаны. Масштабная линейка показывает генетическое расстояние, выраженное в количестве нуклеотидных замен на сайт. Штаммы, идентифицированные в этом исследовании, отмечены закрашенным кружком. Нуклеотидные последовательности наших штаммов были отправлены в базы данных банка данных ДНК Японии, Европейской лаборатории молекулярной биологии и GenBank.Номера доступа указаны в начале каждого штамма.

https://doi.org/10.1371/journal.pone.0254784.g005

Штаммы G3 из Сабаха делятся на линии I и III. Линия I включает лошадиоподобные штаммы G3 (n = 25, 59,5%) человеческого происхождения и от лошадей и других животных, таких как собаки и кошки. Линия III содержит только человеческие штаммы G3 (рис. 6). Конские штаммы G3 из Сабаха были разделены на три группы. В один кластер, хотя штаммы Sabah сгруппированы вместе, они были тесно связаны со штаммами из Японии, Венгрии, Таиланда, Испании, Австралии, Бразилии, США и Индонезии.Штаммы Sabahan имели 99,7–100% и 99–99,8% нуклеотидной идентичности между собой и со штаммами из этих стран, соответственно. Другой кластер содержал один штамм из Сабаха и другие из Индонезии, Таиланда и Японии. Эти штаммы имели между собой 99,2–99,6% нуклеотидной идентичности. Третий кластер содержал только штаммы из Сабаха и имел между собой 99,5–100% нуклеотидной идентичности. Штаммы линии III были разделены на два кластера; один содержал только штаммы из Сабаха (99.8–100% идентичности нуклеотидов), другой — штаммы из Китая (идентичность нуклеотидов 99,4–100%).

Рис. 6. Филогенетическое дерево, построенное с использованием нуклеотидных последовательностей гена VP7 штаммов G3.

Человеческий ротавирус Wa-40-AG (G1) использовался в качестве внешней группы. Число рядом с узлом представляет собой значение начальной загрузки, и значения ниже 70% не указаны. Масштабная линейка показывает генетическое расстояние, выраженное в количестве нуклеотидных замен на сайт. Штаммы, идентифицированные в этом исследовании, отмечены закрашенным кружком.Штаммы из Сабаха принадлежат к линиям передачи I и III. Нуклеотидные последовательности наших штаммов были отправлены в базы данных банка данных ДНК Японии, Европейской лаборатории молекулярной биологии и GenBank. Номера доступа указаны в начале каждого штамма.

https://doi.org/10.1371/journal.pone.0254784.g006

Ген VP4 ротавирусов P [8] принадлежал к линии III (рис. 7). Было обнаружено два кластера, содержащих только конские ротавирусы G3 из Сабаха.Штаммы в этих двух кластерах также образовывали кластеры на филогенетическом дереве VP7. Первый кластер тесно связан со штаммами из Японии, Таиланда и Венгрии, как в дереве VP7. Ген VP4 штаммов Sabahan имеет 100% и 99,5% нуклеотидную идентичность как между собой, так и со штаммом из Японии. Второй кластер был очень тесно связан со штаммами из Китая, но был независимым кластером в дереве VP7. Ген VP4 штаммов Sabahan имеет 99,4–100% и 99,1–99,6% нуклеотидных идентичностей как между собой, так и со штаммом из Китая.Независимый кластер был образован тремя G3, которые также содержали конский G3 (штамм MS18). Эти штаммы имели между собой 99,9–100% нуклеотидную идентичность. Другой кластер содержал три G3 и один конский G3 (KN4) и штаммы из Индии. Ген VP4 штаммов Sabahan имеет 99,9–100% и 99,6–99,9% нуклеотидной идентичности между собой и с индийскими штаммами. Конский G3 сформировал кластер с этими индийскими штаммами на филогенетическом дереве VP7. Ген VP4 штамма P [8] G1 образовывал три кластера.В одном кластере ротавирус G1P [8] из Сабаха оказался в кластере с южноафриканским ротавирусом G1P [8]. Эти штаммы имели 99,6% нуклеотидную идентичность. Этот южноафриканский штамм был тем же, что и этот штамм Sabahan, кластеризованный на филогенетическом дереве VP7. Другой кластер был образован двумя штаммами G1 от Sabah со 100% нуклеотидной идентичностью и был очень близок к штамму G3P [8] из Японии, что указывает на возможное общее происхождение гена VP4 P [8] для этих ротавирусов G1 и G3. . Кроме того, еще один кластер был сформирован из трех ротавирусов G1P [8] из Сабаха, которые были очень близки к индийскому и пакистанскому ротавирусу G1P [8].Ген VP4 штаммов Sabahan имеет 99,9–100% и 98,1–98,9% нуклеотидных идентичностей как между собой, так и со штаммом из Пакистана. Филогенетическое дерево VP7 этих G1 также было близко к другому пакистанскому штамму G1P [8]. Два штамма G8P [8] и GxP [8] из Сабаха сформировали независимый кластер, но были очень близки к штамму G8P [8] из Сингапура; однако на филогенетическом дереве VP7 этот штамм Sabahan G8 объединен со штаммами из Японии, Вьетнама и Чехии. Ген VP4 штаммов Sabahan имеет 99 общих генов.6% и 99,4–99,5% нуклеотидных идентичностей между собой и со штаммом из Сингапура. Штаммы G8P [8] и GxP [8] были очень похожи друг на друга, что указывает на возможность другого штамма G8.

Рис. 7. Филогенетическое дерево, построенное с использованием нуклеотидных последовательностей гена VP4 штаммов P [8].

Человеческий ротавирус DS-1 (P [4]) использовался в качестве внешней группы. Число рядом с узлом представляет собой значение начальной загрузки, и значения ниже 70% не указаны. Масштабная линейка показывает генетическое расстояние, выраженное в количестве нуклеотидных замен на сайт.Штаммы, идентифицированные в этом исследовании, отмечены закрашенным кружком. Все сорта из Сабаха принадлежат к линии III. Нуклеотидные последовательности наших штаммов были отправлены в базы данных банка данных ДНК Японии, Европейской лаборатории молекулярной биологии и GenBank. Номера доступа указаны в начале каждого штамма.

https://doi.org/10.1371/journal.pone.0254784.g007

P [6], принадлежащий к линии I наших штаммов G12P [6], был близок к таковому у человеческих штаммов G12P [6] из Пакистана, и Китай (рис. 8).Штаммы Sabahan имели 98,5–99,8% и 97,8–99,3% нуклеотидной идентичности между собой и с пакистанскими и китайскими штаммами, соответственно. Китайский штамм был тем же, что и штамм Sabahan в филогенетическом дереве VP7.

Рис. 8. Филогенетическое дерево, построенное с использованием нуклеотидных последовательностей гена VP4 штаммов P [6].

Человеческий ротавирус Wa (P [8]) использовался в качестве внешней группы. Число рядом с узлом представляет собой значение начальной загрузки, и значения ниже 70% не указаны.Масштабная линейка показывает генетическое расстояние, выраженное в количестве нуклеотидных замен на сайт. Штаммы, идентифицированные в этом исследовании, отмечены закрашенным кружком. Все штаммы из Sabah принадлежат к линии I. Нуклеотидные последовательности наших штаммов были представлены в базах данных банка данных ДНК Японии, Европейской лаборатории молекулярной биологии и GenBank. Номера доступа указаны в начале каждого штамма.

https://doi.org/10.1371/journal.pone.0254784.g008

В настоящем исследовании мы сравнили антигенные эпитопы VP7 и VP4 (VP8 *) штаммов Sabahan G3 и конского G3 с эпитопами штаммов Вакцинный штамм RotaTeq (WI78-8).Среди 29 аминокислотных остатков, составляющих антигенные эпитопы VP7, у наших штаммов было обнаружено семь различий (рис. 9). Только у лошадиноподобных штаммов G3 одна замена (T87I) произошла в области 7-1a. В эпитопе 7-1b конских штаммов G3 и G3 были обнаружены четыре замены (A212T, N213T, K238D / K238N, D242A) и три замены (A212T, K238N, D242N) соответственно. В эпитопе 7–2 конских штаммов G3 и G3 обнаружены две (A221T и L148M) и одна замена (A221D) соответственно.

Рис. 9. Сравнение антигенных остатков VP7, присутствующих в штаммах генотипа G3 RotaTeq и штаммах, циркулирующих в Сабахе, Малайзия.

Соответствующие антигенные эпитопы показаны над номерами остатков. Аминокислотные остатки в штаммах Sabahan, которые отличались от таковых в вакцинных штаммах, выделены желтым цветом.

https://doi.org/10.1371/journal.pone.0254784.g009

Из 25 аминокислотных остатков, составляющих антигенные эпитопы VP4, у наших штаммов было обнаружено шесть различий (рис. 10).Внутри эпитопа 8–1 штаммов G3 и конского G3 были обнаружены две замены (S146G, D196S) и три замены (S146G, N150S, D196S / D196G) соответственно. В эпитопе 8–2 замены не обнаружено. В эпитопе 8–3 обнаружена одна замена (N113D) у конских штаммов G3 и G3. В эпитопе 8–4 штаммов G3 и лошадиноподобных штаммов G3 были обнаружены одна (T88I) и две замены (T88I и N89S) соответственно.

Рис. 10. Сравнение антигенных остатков VP4, присутствующих в штаммах генотипа G3 RotaTeq и штаммах, циркулирующих в Сабахе, Малайзия.

Соответствующие антигенные эпитопы показаны над номерами остатков. Аминокислотные остатки в штаммах Sabahan, которые отличались от таковых в вакцинных штаммах, выделены желтым цветом.

https://doi.org/10.1371/journal.pone.0254784.g010

Обсуждение

Генотипы ротавирусов G1 – G4, G9 и G12 в сочетании с P [8], P [6] и P [4] являются причиной более 90% случаев ротавирусной диареи во всем мире [18]. Спорадическая частота инфицирования редкими генотипами, такими как G5, G6, G8, G10, G11, P [1], P [3], P [9], P [10], P [19], P [14] и P [ 25] [11,18,27,32–36].В целом характер распределения ротавирусов по G и P колеблется от места к месту и из года в год [37]. Исследования, проведенные в Малайзии с 1977 по 2010 год, показали, что кодоминантными являются G1P [8] и G4P [8], за которыми следуют G9P [8], G2P [4] и G3P [8] [22]. Хотя G3 никогда не был преобладающим генотипом в этих исследованиях, они не включали Sabah. В настоящем исследовании мы обнаружили, что конский G3P [8] является преобладающим (59,5%) генотипом, циркулирующим в Сабахе.

Филогенетический анализ ясно показывает, что несколько штаммов как человеческого G3P [8], так и конского G3P [8] циркулируют среди детей в Сабахе, что указывает на присутствие штаммов, обнаруженных только в Сабахе, и других штаммов, которые, возможно, проникли в Сабах из разных источников. , после чего произошло локальное распространение, и они распространились по штату.В период нашего исследования (2018–2019 гг.) Человеческий G3P [8] был доминирующим генотипом в Бангладеш; эти штаммы были филогенетически родственны индийским штаммам, циркулировавшим в 2015–2017 годах [38,39]. В Пакистане и Мьянме человеческий G3P [8] также преобладал в 2016 и 2017 годах соответственно [6,40]. Однако эти штаммы не были связаны с штаммами из Сабаха; скорее, последние не зависели от эфира или были связаны с китайскими штаммами.

Сабаханских конских ротавирусов G3P [8] демонстрировали короткие электроферотипы, аналогичные таковым из тайского конского G3P [8], который доминировал в 2015 и 2016 годах [37].Однако только один из наших штаммов попал в кластер с этим штаммом на филогенетическом дереве. Другой наш конский G3P [8] принадлежал к независимым кластерам, что указывает на то, что предки этих кластеров, возможно, проникли в Сабах в прошлом и эволюционировали. Конский G3P [8] с короткими электроферотипами появился в Австралии и Таиланде в 2013 г., в Испании и Венгрии в 2015 г., а также в Бразилии, Индонезии и Японии в 2016 г. [37]. Анализ последовательности всего генома показал, что эти подобные лошадиным G3P [8] с короткими электроферотипами имели основание, подобное DS-1; я.например, созвездие G3P [8] -I2-R2-C2-M2-A2-N1 / 2-T2-E2-h3 [37]. В соседних районах Индонезии, Центральная Ява и Джокьякарта, конское созвездие G3P [8] с G3P [8] -I2-R2-C2-M2-A2-N1 / 2-T2-E2-h3 стало доминирующим и было обнаружено в образцы 2014 и 2015 гг. [41]. Исследование, проведенное в Сурабае, Индонезия, выявило два различных конских штамма G3P [8] и G3P [6] с короткими электроферотипами, циркулировавшими в 2015–2016 годах [42]. Примечательно, что тайские лошадиные штаммы обладали различными генами NSP4: одним коровьим, а другим человеческим [37].Поскольку мы не уверены, к какому из этих штаммов принадлежат наши штаммы, в будущем можно будет провести анализ последовательности всего генома конских штаммов G3, чтобы прояснить события реассортировки.

Хотя конский G3P [8] был обнаружен в нескольких странах, уровень обнаружения варьируется. Несколько конских штаммов G3P [8] были обнаружены в Германии, Венгрии, Японии и США [37]. В Австралии и Испании уровень обнаружения был умеренным — от 14,4 до 37,4%. Конский G3 [P8] преобладал в Бразилии [42,43], Индонезии [44] и Таиланде в течение сезонов 2016–2017 годов [37].В Австралии преобладание конского G3P [8] объясняется высоким уровнем охвата вакциной Rotarix, вызванным селективным давлением вакцины [45]. Преобладание конского G3P [8] в Таиланде и Венгрии также объясняется селективным давлением, вызванным вакцинами, хотя Rotarix доступен только на частном рынке и имеет более низкий национальный охват в этих двух странах [45]. Более того, доминирование конского G3P [8] в Испании также объясняется селективным давлением, индуцированным вакциной, хотя RotaTeq в основном использовался там [45].В Малайзии национальный охват использованием ротавирусной вакцины неизвестен [46]. Поскольку испытания в Малайзии не проводились, неясно, насколько эффективны эти вакцины в местных условиях.

Чтобы пролить свет на эффективность вакцины, мы сравнили антигенные эпитопы наших штаммов G3 и конского G3 с эпитопами вакцинного штамма RotaTeq G3 и идентифицировали ряд замен. Хотя количество замен в эпитопе 7-1a было небольшим, несколько замен было обнаружено в эпитопе 7-1b (aa208-223), что могло привести к десятикратному увеличению устойчивости к связыванию нейтрализующего антитела [47] .Известно также, что замена K238N в этом эпитопе связана с потенциальным сайтом гликозилирования, связанным с N [48], что может предотвратить нейтрализующую активность антител [49]. Замена (K238N) ранее была идентифицирована в бельгийских [48], иранских [50], российских [51] и тунисских [52] штаммах. Замены аминокислот в остатках 100, 146, 148, 150, 188, 190, 194, 180, 183, 114, 116, 133, 135, 87, 88, 89, как было показано, вызывают ускользание от нейтрализации моноклональными антителами [53] .В этом исследовании штаммы VP4 Sabahan G3 и лошадиного типа G3, которые подверглись заменам на aa146, 150, 88, 89, обладают потенциалом избежать нейтрализации индуцированными вакциной антителами.

Как и во многих других странах, в Малайзии распространенность ротавирусной инфекции варьируется в зависимости от региона. Предыдущие исследования показали, что распространенность ротавирусной инфекции наиболее высока на Пенанге (54%), за ним следуют Кучинг, Саравак (46%) и Куала-Лумпур (22–46%), затем Джохор-Бару, Джохор (18%), с самый низкий в Кота-Кинабалу (16%) [26].Этот предыдущий результат из Кота-Кинабалу согласуется с нашими результатами. Хотя возрастная распространенность ротавирусной инфекции варьируется между развитыми и развивающимися регионами, обычно она встречается у детей в возрасте 4–23 месяцев [27,54–56]. Мы обнаружили большинство ротавирусных инфекций у детей в возрасте 6–23 месяцев (рис. 1), с пиком в возрасте 12–17 месяцев. Эти результаты аналогичны результатам исследования, проведенного в Бангладеш, где ротавирус в основном поражал детей в возрасте 3–23 месяцев и достиг пика в возрасте 6–11 месяцев [11].

Число ротавирусных инфекций было наименьшим у пациентов младше 3 месяцев, предположительно из-за наличия материнских антител в результате грудного вскармливания. Как показало наше исследование, пациенты мужского пола чаще страдают острым ротавирусным гастроэнтеритом [57–59]. Подобно находкам в странах Индийского субконтинента [11,34], G12, обнаруженные в Сабахе, были в сочетании с P [6]. Однако наши штаммы G12 образовали независимый подкластер со штаммами G12P [6] из Китая.Генотип P [6] в основном распространен у свиней [60–62]. Исследования показали, что необычные ротавирусы с генотипом P [6] появились в человеческих популяциях в результате генетической перегруппировки ротавирусов человека и свиней [36]. Филогенетический анализ также показал, что штаммы Sabahan P [6] были похожи на штаммы P [6] человека, а не на штаммы P [6] свиней, хотя P [6] человека первоначально был получен из штаммов P [6] свиней.

Генотип G9P [8] является пятым по распространенности генотипом G в мире и одним из распространенных циркулирующих генотипов в развивающихся странах [63,64].В настоящем исследовании G9 выявлено не было; однако генотип G9 был идентифицирован ранее как преобладающий генотип в Джохоре, Западная Малайзия [23].

Еще одним важным открытием в этом исследовании является идентификация штамма G8P [8]. Неожиданное появление штамма ротавируса G8 впервые в Малайзии повысило эпидемиологическое значение этого штамма. Первоначально G8 была определена в соседней Индонезии [65], а затем в других странах [66–69], но никогда не регистрировалась в Малайзии.В Африке детские инфекции, вызываемые штаммами G8, более распространены, составляя 5–20% штаммов, и часто связаны с P [6], P [4] или P [8] [70]. Идентификация близкородственных штаммов G8P [8] во Вьетнаме, Японии и Таиланде указывает на их распространение в Азии [69,71,72], предполагая общее происхождение. Согласно анализу последовательности VP7, штаммы G8 из Азии родственны штаммам животных и более отдалены штаммам G8 из Африки, где исторически этот генотип выявлялся чаще [69].Фактически, полногеномный анализ репрезентативного штамма G8, полученного во время вспышки 2014 года в Японии, показал, что он возник в результате пересортировки сегментов генома ротавирусов человека, овец и крупного рогатого скота [73]. Было высказано предположение, что высокий охват вакцинацией сыграл значительную роль в недавнем появлении штаммов G8 в Австралии [45].

Обнаружение 11 различных электроферотипов среди 34 электроферотипированных образцов в нашем исследовании может указывать на значительное разнообразие ротавирусов, циркулирующих в Сабахе, по сравнению с Турцией (5/38) [27], Шри-Ланкой (18/74) [35], Гонконгом ( 35/432) [74], Бутан (10/38) [34] и Бангладеш (15/88) [11].Хотя причина высокого разнообразия ротавирусов в Сабахе неизвестна, это указывает на высокую скорость взаимодействия между различными штаммами, которые могут быть ответственны за реассортантные штаммы. Это предположение подтверждается также филогенетическим анализом генов VP7 и VP4 различных штаммов. Некоторые из компонентов VP7 и VP4 произошли от одних и тех же штаммов, в то время как произошли от разных штаммов, что указывает на перегруппировку генов. Факторы, лежащие в основе высокого разнообразия штаммов и необычного распределения генотипов, обнаруженных в Сабахе, сложны.

Большое количество иммигрантов без документов из соседних Индонезии и Филиппин. Эти перемещения людей могут способствовать разнообразию генофонда ротавирусов Сабахана. Кроме того, в Сабахе проживают 32 разные этнические группы с разным образом жизни. Некоторые из них, особенно в сельской местности, находятся в тесном контакте с животными, что создает возможности для видов прыжков. Поэтому постоянное наблюдение за циркулирующими штаммами ротавирусов в штате Сабах важно не только для мониторинга распределения генотипов до и после вакцинации, но и для мониторинга появления новых реассортантных штаммов.

Выводы

В Сабахе ротавирус поражал в основном детей в возрасте до двух лет. Преобладающим ротавирусом, циркулирующим среди детей в этом исследовании, был конский G3P [8] с коротким электрофорезом. Среди других генотипов, циркулирующих среди детей Сабаха, были G3P [8], G1P [8], G12P [6] и G8P [8]. Циркулирующие генотипы были филогенетически разнообразны и связаны со штаммами из разных стран. Ряд электроферотипов был также обнаружен среди штаммов ротавируса Sabahan.Эти результаты показывают, что у штаммов из Сабаха происходит значительный генетический обмен. По сравнению со штаммом вакцины RotaTeq антигенные эпитопы, присутствующие на VP7 и VP4 Sabahan G3 и лошадиного типа G3, значительно различались. Постоянное наблюдение за штаммами ротавирусов необходимо для мониторинга генотипов циркулирующих ротавирусов до и после внедрения ротавирусной вакцины в Сабах.

Благодарности

Авторы хотели бы поблагодарить Генерального директора Министерства здравоохранения Малайзии за разрешение опубликовать эту статью.

Ссылки

  1. 1. Кинг А.М., Лефковиц Э., Адамс М.Дж., Карстенс Э.Б., редакторы. Таксономия вирусов: девятый доклад Международного комитета по таксономии вирусов. Эльзевир; 2011.
  2. 2. Schoondermark-van de Ven E, Van Ranst M, de Bruin W., van den Hurk P, Zeller M, Matthijnssens J, et al. Колония кроликов инфицирована бычьим штаммом ротавируса G6P [11]. Vet Microbiol. 2013. 166 (1–2): 154–64. pmid: 23830050
  3. 3. Харрисон SC, Дормитцер PR.Структура и функция частицы ротавируса. В: Svensson L, Desselberger U, редакторы. Вирусный гастроэнтерит. Академическая пресса; 2016. С. 89–102.
  4. 4. Хосино Ю., Серено М.М., Мидтун К., Флорес Дж., Капикян А.З., Чанок Р.М. Независимое разделение двух антигенных специфичностей (VP3 и VP7), участвующих в нейтрализации инфекционности ротавируса. Proc Natl Acad Sci USA. 1985. 82 (24): 8701–4. pmid: 3001716
  5. 5. Эстес МК, Коэн Дж. Э. Структура и функция гена ротавируса.Microbiol Rev.1989; 53 (4): 410–49. pmid: 2556635
  6. 6. Садик А., Бостан Н., Бохари Х., Маттейнссенс Дж., Йинда К.С., Раза С. и др. Молекулярная характеристика генотипов ротавирусов группы А человека, циркулирующих в Равалпинди, Исламабад, Пакистан, в 2015–2016 гг. ПлоС один. 2019; 14 (7): e0220387. pmid: 31361761
  7. 7. Тамим С., Хасан Ф., Маттейнссенс Дж., Шариф С., Шаукат С., Алам М.М. и др. Эпидемиология и филогенетический анализ генов VP7 и VP4 ротавирусов, циркулировавших в Равалпинди, Пакистан, в 2010 г.Заразить Genet Evol. 2013; 14: 161–8. pmid: 23187023
  8. 8. Ахмед К., Накагоми Т., Накагоми О. Выделение и молекулярная характеристика природного реассортанта гена неструктурного белка 5 (NSP5) ротавируса группы А серотипа G2P [4] с длинным рисунком РНК. J Med Virol. 2005. 77 (2): 323–30. pmid: 16121367
  9. 9. Theamboonlers A, Maiklang O, Thongmee T, Chieochansin T, Vuthitanachot V, Poovorawan Y. Полный анализ генома редкого человеческого ротавируса G3P [9], выдающего себя за штамм, подобный AU-1.SpringerPlus. 2013; 2 (1): 569. pmid: 24255863
  10. 10. Накагоми Т., Нгуен М.К., Гаучан П., Агбемабизе К.А., Канеко М., До LP и др. Эволюция реассортантных штаммов ротавируса А с двойным геном DS-1-подобных G1P [8], вызывающих гастроэнтерит у детей во Вьетнаме в 2012/2013 гг. Arch Virol. 2017; 162 (3): 739–48. pmid: 27878638
  11. 11. Ахмед К., Ахмед С., Митуи М.Т., Рахман А., Кабир Л., Ханнан А. и др. Молекулярная характеристика гена VP7 ротавирусов человека из Бангладеш.Гены вирусов. 2010. 40 (3): 347–56. pmid: 20217207
  12. 12. Всемирная организация здравоохранения. Ротавирусные вакцины Позиционный документ ВОЗ — январь 2013 г. Wkly Epidemiol Rec. 2013. 88 (05): 49–64.
  13. 13. Баярд В., ДеАнтонио Р., Контрерас Р., Тинахеро О., Кастрехон М.М., Ортега-Баррия Е. и др. Влияние ротавирусной вакцинации на смертность, связанную с детским гастроэнтеритом, и количество выписанных из больниц в Панаме. Int J Infect Dis. 2012; 16 (2): e94–8. pmid: 22154592
  14. 14. Gastañaduy PA, Curns AT, Parashar UD, Lopman BA.Госпитализация детей старшего возраста и взрослых при гастроэнтерите в США до и после вакцинации против ротавируса младенцев. ДЖАМА. 2013. 310 (8): 851–3. pmid: 23982372
  15. 15. Дессельбергер У. Различия в эффективности ротавирусной вакцины по странам: вероятные причины и способствующие факторы. Возбудители. 2017; 6 (4): 65. pmid: 29231855
  16. 16. Соарес-Вайзер К., Бергман Х., Хеншке Н., Питан Ф., Канлифф Н. Вакцины для предотвращения ротавирусной диареи: используемые вакцины.Кокрановская база данных Sys Rev.2019 (10).
  17. 17. Джордж С., Джаган О.А., Бай С., Чанди С. Генетическое разнообразие штаммов ротавирусов в эпоху вакцинации: пилотное исследование из Центральной Кералы, Индия. J Clin Diagn Res. 2018; 12 (9).
  18. 18. Наяк М.К., Банерджи А., Саркар Р., Митра С., Датта К., Гангули Н. и др. Генетическая характеристика ротавирусов группы А среди детей в восточной Индии в 2014–2016 гг .: Филодинамика совместно циркулирующих генотипов. Вакцина. 2019; 37 (45): 6842–56.pmid: 31543416
  19. 19. Тейт Дж. Э., Бертон А. Х., Боски-Пинто К., Стил А. Д., Дуке Дж., Парашар Ю. Д.. Оценка смертности детей младше 5 лет от ротавируса в мире за 2008 год до введения всеобщих программ вакцинации против ротавируса: систематический обзор и метаанализ. Lancet Infect Dis. 2012; 12 (2): 136–41. pmid: 22030330
  20. 20. Котлофф КЛ. Бремя и этиология диарейных заболеваний в развивающихся странах. Pediatr Clin North Am.2017; 64 (4): 799–814. pmid: 28734511
  21. 21. Логанатан Т., Нг К.В., Ли В.С., Джит М. Скрытое бремя ротавирусного гастроэнтерита для здоровья и экономики в Малайзии. Pediatr Infect Dis J. 2016; 35 (6): 601–6. pmid: 27008464
  22. 22. Ли В.С., Лим Б.Т., Чай П.Ф., Кирквуд С.Д., Ли Дж.К. Генотипы ротавирусов в Малайзии и всеобщая ротавирусная вакцинация. Hum Vaccin Immunother. 2012. 8 (10): 1401–6. pmid: 23022710
  23. 23. Зурида Х., Кирквуд С.Д., Епископ РФ, Богданович-Сакран Н., Яп К.Л.Молекулярная характеристика и эпидемиология изолятов ротавируса, полученных от детей с диареей в Малайзии. Med J Malaysia. 2009. 64 (3): 193–6. pmid: 20527266
  24. 24. Хунг Л.С., Вонг С.Л., Чан Л.Г., Росли Р., Нг АН, Брези Дж.С. Эпидемиология и характеристика штаммов ротавирусной диареи в Малайзии. Int J Infect Dis. 2006. 10 (6): 470–4. pmid: 17046306
  25. 25. Hsu VP, Rahman HB, Wong SL, Ibrahim LH, Yusoff AF, Chan LG и др. Оценки бремени ротавирусной болезни в Малайзии.J Infect Dis. 2005; 192 (Приложение_1): S80–6. pmid: 16088810
  26. 26. Goh CT, Cheah PK, Soo TL, Lee WS. Эпидемиология и бремя детской ротавирусной инфекции в специализированной больнице в Сабахе, Малайзия. Med J Malaysia. 2009. 64 (2): 146–9. pmid: 20058575
  27. 27. Боздай Г., Доган Б., Далджик Б., Бостанджи И., Сари С., Батталоглу Н.О. и др. Разнообразие ротавируса человека G9 среди детей в Турции. J Med Virol. 2008. 80 (4): 733–40. pmid: 18297696
  28. 28.Гувеа В., Гласс Р.И., Вудс П., Танигучи К., Кларк Х.Ф., Форрестер Б. и др. Амплификация с помощью полимеразной цепной реакции и типирование нуклеиновой кислоты ротавируса в образцах стула. J Clin Microbiol. 1990. 28 (2): 276–82. pmid: 2155916
  29. 29. Гунасена С.У., Накагоми О.С., Исегава Ю.Ю., Кага Е.И., Накагоми Т., Стил А.Д. и др. Относительная частота аллелей гена VP4 среди ротавирусов человека восстановилась за 10-летний период (1982–1991) у японских детей с диареей. J Clin Microbiol.1993. 31 (8): 2195–7. pmid: 8396591
  30. 30. Ватанабе М., Накагоми Т., Кошимура Ю., Накагоми О. Прямые доказательства реассортации сегментов генома между одновременно циркулирующими штаммами ротавируса человека. Arch Virol. 2001. 146 (3): 557–70. pmid: 11338390
  31. 31. Koshimura Y, Nakagomi T., Nakagomi O. Относительная частота G-серотипов ротавирусов, выявленных у госпитализированных детей с диареей: 10-летний обзор (1987–1996 гг.) В Японии с обзором данных, собранных во всем мире.Microbiol Immunol. 2000. 44 (6): 499–510. pmid: 10941933
  32. 32. Ахмед К., Ань Д.Д., Накагоми О. Ротавирус G5P [6] у ребенка с диареей, Вьетнам. Emerg Infect Dis. 2007; 13 (8): 1232. pmid: 17953100
  33. 33. Uchida R, Pandey BD, Sherchand JB, Ahmed K, Yokoo M, Nakagomi T. и др. Молекулярная эпидемиология ротавирусной диареи среди детей и взрослых в Непале: обнаружение штаммов G12 с P [6] или P [8] и штаммом G11P [25]. J Clin Microbiol. 2006. 44 (10): 3499–505.pmid: 17021073
  34. 34. Вангчук С., Митуи М.Т., Церинг К., Яхиро Т., Бандхари П., Зангмо С. и др. Преобладание новых генотипов G9 и G12 и полиморфизм VP7 и VP4 ротавирусов от бутанских детей с тяжелой диареей до введения вакцины. ПлоС один. 2014; 9 (10): e110795. pmid: 25330070
  35. 35. Ахмед К., Батувантхудаве Р., Чандрасена Т.Н., Митуи М.Т., Раджиндраджит С., Галагода Г. и др. Ротавирусные инфекции с множеством новых генотипов в Шри-Ланке.Arch Virol. 2010. 155 (1): 71–5. pmid: 19921392
  36. 36. Яхиро Т., Такаки М., Чандрасена Т.Н., Раджиндраджит С., Иха Х, Ахмед К. Реассортантный ротавирус человека и свиньи, вызванный множественными реассортантными событиями у шри-ланкийского ребенка с диареей. Заразить Genet Evol. 2018; 65: 170–86. pmid: 30055329
  37. 37. Тачароенмуанг Р., Комото С., Гунтапонг Р., Упачаи С., Сингчай П., Ид Т. и др. Высокая распространенность ротавируса G3P [8], похожего на лошадей, у детей и взрослых с острым гастроэнтеритом в Таиланде.J Med Virol. 2020; 92 (2): 174–86. pmid: 31498444
  38. 38. Мазид Р., Аунг М.С., Пол С.К., Ахмад Ф.У., Алам М., Али М.А. и др. Возрождение и преобладание ротавирусов человека G3P [8] на севере центральной части Бангладеш, 2018–2019 гг. Новые микробы. Новый зараз. 2020; 33: 100621. pmid: 31

    1

  39. 39. Банерджи А., Ло М., Индвар П., Деб А. К., Дас С., Манна Б. и др. Рост и распространение ротавирусов G3 в Восточной Индии (2014–2016 гг.): Полный анализ генома выявляет гетерогенность в пределах Wa-подобного геномного созвездия.Заразить Genet Evol. 2018; 63: 158–74. pmid: 29842980
  40. 40. Myat TW, Thu HM, Lin H, Hom NS, Khine WK, Kham MM и др. Эпиднадзор за ротавирусным гастроэнтеритом (2015–2017 гг.): Эпидемиология и генотипы циркулирующих ротавирусов в период внедрения преротавирусной вакцины в Мьянме. Отчет по расследованию вспышек эпидемий, 2019; 12 (3).
  41. 41. Коули Д., Нирвати Х., Донато С.М., Богданович-Сакран Н., Бонифас К., Кирквуд С.Д. и др. Молекулярная характеристика штаммов ротавирусов, выявленных в ходе клинических испытаний вакцины против ротавируса новорожденных человека (RV3-BB) в Индонезии.Вакцина. 2018; 36 (39): 5872–8. pmid: 30145099
  42. 42. Лучс А., Чилли А., Морилло С., Боэн Л., Кармона Р.Д., Тименецкий М.Д. Распространение нового конского штамма ротавируса G3P [8] DS-1-подобного генетического каркаса в Бразилии. J Gen Virol. 2018; 73: 190. pmid: 30457517
  43. 43. Guerra SF, Soares LS, Lobo PS, Júnior ET, Júnior EC, Bezerra DA и др. Обнаружение нового конского ротавируса G3, связанного с острым гастроэнтеритом, в Бразилии. J Gen Virol. 2016 97 (12): 3131–8.pmid: 27
  44. 6
  45. 44. Утсуми Т., Вахьюни Р.М., Доан Ю.Х., Динана З., Соегиджанто С., Фуджи Ю. и др. Конские штаммы ротавируса G3 как преобладающие штаммы среди детей в Индонезии в 2015–2016 годах. Заразить Genet Evol. 2018; 61: 224–8. pmid: 29614325
  46. 45. Maguire JE, Glasgow K, Glass K, Roczo-Farkas S, Bines JE, Sheppeard V и др. Эпидемиология ротавируса и эффективность моновалентной ротавирусной вакцины в Австралии: 2010–2017 гг. Педиатрия. 2019; 144 (4). pmid: 31530719
  47. 46.Всемирная организация здравоохранения. Малайзия: оценки охвата иммунизацией ВОЗ и ЮНИСЕФ: редакция 2019 г. 2021 15 июля. Доступно по адресу: https://www.who.int/immunization/monitoring_surveillance/data/mys.pdf.
  48. 47. Дьял-Смит М.Л., Лаздинс И., Трегер Г.В., Холмс И.Х. Расположение основных антигенных сайтов, участвующих в серотип-специфической нейтрализации ротавируса. Proc Natl Acad Sci USA. 1986. 83 (10): 3465–8. pmid: 2422651
  49. 48. Зеллер М., Паттон Дж. Т., Хейлен Е., Де Костер С., Сиарлет М., Ван Ранст М. и др.Генетический анализ выявил различия в антигенных эпитопах VP7 и VP4 между ротавирусами человека, циркулирующими в Бельгии, и ротавирусами в Rotarix и RotaTeq. J Clin Microbiol. 2012; 50 (3): 966–76. pmid: 22189107
  50. 49. Кирквуд С., Мазендич П.Дж., Колсон Б.С. Характеристики и расположение сайтов перекрестной реакции и серотип-специфической нейтрализации на VP7 ротавирусов G 9 человека. Вирусология. 1993. 196 (1): 79–88. pmid: 8395127
  51. 50. Мотамеди ‐ Рад М., Фарахманд М., Арашкия А., Джалилванд С., Шоджа З.Генотипы VP7 и VP4 ротавирусов, совместно циркулирующих в Иране, с 2015 по 2017 год: сравнение с убедительными последовательностями вакцинных штаммов Rotarix и RotaTeq перед их использованием для всеобщей массовой вакцинации. J Med Virol. 2020; 92 (8): 1110–23. pmid: 31774174
  52. 51. Морозова О.В., Сашина Т.А., Фомина С.Г., Новикова Н.А. Сравнительная характеристика антигенных эпитопов VP7 и VP4 ротавирусов, циркулирующих в России (Нижний Новгород), и вакцин Rotarix и RotaTeq. Arch Virol. 2015; 160 (7): 1693–703.pmid: 25944143
  53. 52. Фредж М.Б., БенХамида-Ребаи М., Хейлен Э., Зеллер М., Мусса А., Касем С. и др. Последовательность и филогенетический анализ штаммов ротавируса человека: сравнение антигенных эпитопов VP7 и VP8 * между тунисскими и вакцинными штаммами до внедрения национальной ротавирусной вакцины. Заразить Genet Evol. 2013; 18: 132–44. pmid: 23684631
  54. 53. Vizzi E, Piñeros OA, Oropeza MD, Naranjo L, Suárez JA, Fernández R, et al. Штаммы ротавируса человека, циркулирующие в Венесуэле после внедрения вакцины: преобладание G2P [4] и повторное появление G1P [8].Вирол Дж. 2017; 14 (1): 58. pmid: 28320411
  55. 54. Веласкес Р., Кальва Дж. Дж., Герреро Л., Масса Д. А., Гласс Р. И., Пикеринг Л. К. и др. Когортное исследование серотипов ротавируса при симптоматических и бессимптомных инфекциях у мексиканских детей. Pediatr Infect Dis J. 1993; 12 (1): 54–61. pmid: 8380235
  56. 55. Пейн Д.К., Стаат М.А., Эдвардс К.М., Силаджи П.Г., Генч Дж. Р., Стокман Л. Дж. И др. Активный популяционный эпиднадзор за тяжелым ротавирусным гастроэнтеритом у детей в США.Педиатрия. 2008. 122 (6): 1235–43. pmid: 1

    40

  57. 56. Аземи М., Бериша М., Исмаили-Джаха В., Колгечи С., Авдиу М., Джакупи Х и др. Социально-демографические, клинико-лабораторные особенности ротавирусного гастроэнтерита у детей, проходящих лечение в педиатрической клинике. Mater Sociomed. 2013; 25 (1): 9. pmid: 23678334
  58. 57. Borade A, Bais AS, Bapat V, Dhongade R. Характеристики ротавирусного гастроэнтерита у госпитализированных детей в Пуне. Индийский J Med Sci. 2010; 64 (5). pmid: 22842320
  59. 58.Джунаид С.А., Уме К., Олабоде А.О., Банда Дж. М.. Заболеваемость ротавирусной инфекцией у детей с гастроэнтеритом, посещающих университетскую больницу Джос, Нигерия. Вирол Дж. 20118 (1): 233. pmid: 21575246
  60. 59. Hegazi MA, Sayed MH, Sindi HH, Bekhit OE, El-Deek BS, Alshoudri FM и др. Остается ли ротавирус главной причиной диарейных заболеваний у госпитализированных педиатрических пациентов после включения ротавирусной вакцины в национальную программу иммунизации Саудовской Аравии? Медицина. 2017; 96 (15) e6574.pmid: 28403085
  61. 60. Martella V, Ciarlet M, Banyai K, Lorusso E, Arista S, Lavazza A и др. Идентификация штаммов ротавируса свиней группы А, несущих новый генотип VP4 (P), в итальянских стадах свиней. J Clin Microbiol. 2007. 45 (2): 577–80. pmid: 17122003
  62. 61. Коллинз П.Дж., Мартелла В., Слеатор Р.Д., Фаннинг С., О’Ши Х. Обнаружение и характеристика ротавируса группы А у бессимптомных поросят в южной Ирландии. Arch Virol. 2010. 155 (8): 1247–59. pmid: 20526785
  63. 62.Папп Х., Ласло Б., Якаб Ф., Ганеш Б., Де Грация С., Маттейнссенс Дж. И др. Обзор штаммов ротавируса группы А, обнаруженных у свиней и крупного рогатого скота. Vet Microbiol. 2013. 165 (3–4): 190–9. pmid: 23642647
  64. 63. Intamaso U, Poomipak W, Chutoam P, Chotchuang P, Sunkkham W., Srisopha S. Распределение генотипов и филогенетический анализ ротавирусов в Таиланде и появление необычных генотипов. Arch Clin Microbiol. 2017; 8 (4): 60–70.
  65. 64. Heylen E, Likele BB, Zeller M, Stevens S, De Coster S, Conceição-Neto N и др.Эпиднадзор за ротавирусами в Кисангани, Демократическая Республика Конго, выявляет большое количество необычных генотипов и генных сегментов животного происхождения у невакцинированных детей с симптомами заболевания. ПлоС один. 2014; 9 (6): e100953. pmid: 24968018
  66. 65. Мацуно С., Хасегава А., Мукояма А., Иноуэ С. Кандидат на новый серотип ротавируса человека. J Virol. 1985. 54 (2): 623–4. pmid: 2985825
  67. 66. Мукерджи А., Маллик С., Деб А.К., Панда С., Чавла-Саркар М. Первый отчет о гастроэнтерите человека, вызванном ротавирусом G8P [4], в Индии: данные о передаче зоонозов от жвачных животных человеку.J Med Virol. 2013. 85 (3): 537–45. pmid: 23280762
  68. 67. Хок С.А., Кобаяши М., Таканаши С., Анвар К.С., Ватанабе Т., Хамрин П. и др. Роль ротавирусной вакцинации в отношении нового штамма ротавируса G8P [8], вызывающего вспышку в центральной Японии. Вакцина. 2018; 36 (1): 43–9. pmid: 29183732
  69. 68. Лусеро Й., О’Райан М., Липароти Дж., Уэрта Н., Мамани Н., Рамани С. и др. Преобладание ротавируса G8P [8] в городе Чили, стране без вакцинации против ротавируса. J Pediatr.2019; 204: 298–300. pmid: 30297290
  70. 69. Кондо К., Цугава Т., Оно М., Охара Т., Фуджибаяси С., Тахара Ю. и др. Клинические и молекулярные характеристики очагового штамма ротавируса человека G8P [8], Япония, 2014 г. Emerg Infect Dis. 2017; 23 (6): 968. pmid: 28518031
  71. 70. Delogu R, Presti AL, Ruggeri FM, Cella E, Giovanetti M, Ciccozzi M и др. Полногеномная характеристика ротавируса G8P [8], который появился у детей с диареей в Хорватии в 2006 г. J Clin Microbiol.2013. 51 (5): 1583–8. pmid: 23426928
  72. 71. Hoa-Tran TN, Nakagomi T., Vu HM, Do LP, Gauchan P, Agbemabiese CA и др. Резкое появление и преобладание во Вьетнаме штаммов ротавируса А, обладающих бычьим G8 на фоне DS-1. Arch Virol. 2016; 161 (2): 479–82. pmid: 26586330
  73. 72. Тачароенмуанг Р., Комото С., Гунтапонг Р., Иде Т., Синчай П., Упачаи С. и др. Полная геномная характеристика новых DS-1-подобных штаммов ротавируса G8P [8], которые появились в Таиланде: перегруппировка сегментов генов ротавирусов крупного рогатого скота и человека в появляющихся реассортантных штаммах DS-1-подобных межгеногрупповых.PLoS One. 2016; 11 (11): e0165826. pmid: 27802339
  74. 73. Agbemabiese CA, Накагоми Т., Доан Ю.Х., Накагоми О. Полногеномная совокупность первого штамма ротавируса G8 человека, обнаруженного в Японии. Заразить Genet Evol. 2015; 35: 184–93. pmid: 26275468
  75. 74. Mitui MT, Chan PK, Nelson EA, Leung TF, Nishizono A, Ahmed K. Совместное доминирование ротавирусов G1 и новых G3 в Гонконге: трехлетнее наблюдение в трех крупных больницах. J Clin Virol. 2011. 50 (4): 325–33.pmid: 21330195

Химерные рекомбинантные ротавирусоподобные частицы как носитель для отображения гетерологичных эпитопов | Virology Journal

Дизайн праймера для инсерционного мутагенеза

Коллекция мутантов, несущих сайт XbaI в желаемых положениях VP6 (штамм SA11), была создана с помощью ПЦР с использованием адекватных праймеров и названа в соответствии с положением вставки в аминокислотной последовательности . Внутренние положения в аминокислотной последовательности штамма VP6 SA11 были выбраны на основе анализа пространственной конформации штамма VP6 RF, депонированного в Protein Data Bank (код PDB: 1qhd), и визуализированы с помощью программного обеспечения WebLab Viewer (Accelrys Software Inc. .). Были отобраны три области, расположенные в петлях, экспонированных на поверхности капсида ротавируса. Эти аминокислотные области были 171-172, 311-312 и 301-308. Для мутагенеза использовали праймеры: L171-for: TT TCTAGA TTGTGATCTATTTAGTGT, L171-rev: GG TCTAGA CATGATAATTTGATGGGC, L311- TCTAGA CCATTCGAACATCAT, L311-rev: A TCTAGA ATTCGGGAATAGTAC, R308-for: CC TCTAGA CCGAATGCACAGCCATTC и R301-rev: TT TCTAGA CATGTTTGAGT.Сайты рестрикции XbaI выделены жирным шрифтом.

Конструирование рекомбинантных бакуловирусов

Полная методология конструирования рекомбинантных бакуловирусов была ранее опубликована в виде руководства [35]. Последовательности VP6 и VP2, использованные в данной работе, происходят от штамма обезьян SA11. Для экспрессии VP2 кодирующую последовательность VP2 сначала субклонировали в pVL1393 (Pharmingen). Для мутантов VP6 продукты ПЦР-амплификации были получены с использованием pBSVP6 (несущей полную кодирующую последовательность VP6, любезно предоставленную Dr.Дж. Блэкхолл) в качестве шаблона. N-концевой и C-концевой фрагменты последовательно клонировали в pVL1393, создавая сайт XbaI на стыке и заменяя два остатка в VP6. Для всех мутантов праймер VP6-for (A AAGCTT AACATGGATGTCCTATA, несущий сайт рестрикции HindIII) был использован в качестве прямого праймера для N-концевого фрагмента и VP6 rev (T GGTACC TCATTTAATGAGCAT, несущий сайт рестрикции KpnI). был использован в качестве обратного праймера для С-концевой части. Как только две части VP6 с сайтами XbaI были клонированы вместе, синтетическая дцДНК была сконструирована путем отжига олигонуклеотидов V5-For и V5-Rev (V5-for: AA TCTAGA GGTAAGCCTATCCCTCTCCTC, V5-revT: AA TCTAGA CGAGAG Сайты рестрикции XbaI выделены жирным шрифтом), а кодирование эпитопа, происходящего от обезьяньего парамиксовируса 5 [29], было введено в рамку.Был сконструирован дополнительный рекомбинантный VP6 (названный VP6-V5N), несущий эпитоп V5 на N-конце (использованные праймеры были: VP6N-for: AA CCCGGG GATGTCCTATACTCTTTG, VP6N-rev: AA TCTAGA TCATTTAATGAGCAT5 для: T CCCGGG AGT ATG GCTAAGCCTATCCCTAACCCTCTCCTC, V5N-rev: T CCCGGG CGTAGAATCGAGACCGAGGAGAGAGGGTT. Сайт рестрикции XmaI выделен жирным шрифтом. Сайт рестрикции XmaI выделен жирным шрифтом. Соответствующие последовательности плазмид для переноса были подтверждены секвенированием, и клетки насекомых Sf9 котрансфицировали 2 мкг каждой плазмиды и 0.5 мкг линейной ДНК AcNPV (Pharmingen) с использованием Cellfectin (Invitrogen). Полученные рекомбинантные бакуловирусы AcVP2, AcVP6, AcVP6 171 / V5 AcVP6 301 / V5 и AcVP6 311 / V5 размножали, как описано ранее [30]. Все рекомбинантные бакуловирусы размножали в клетках Spodoptera frugiperda Sf9 (ATCC), выращенных при 27 ° C в среде TNM-FH (SIGMA) с добавлением 10% фетальной бычьей сыворотки (FBS) и раствора антибиотик-антимикотика (GIBCO).

Анализ экспрессии мутантов VP6

Клетки Sf9, выращенные в 25 см 2 колб были инфицированы при множественности инфицирования (moi) 5 каждым рекомбинантным бакуловирусом, и через 5 дней после инфицирования (dpi) клетки лизировали кипячением в наличие 500 мкл буфера для крекинга (50 мМ Tris-HCl pH 6.8, 2% SDS, 0,01% бромфенолового синего, 1% 2-меркаптоэтанола, 10% глицерина) и белки разделяли с помощью SDS-PAGE. Рекомбинантные белки детектировали окрашиванием кумасси синим или вестерн-блоттингом с коммерческим моноклональным антителом (MAb), направленным на эпитоп V5 (Invitrogen), или кроличьей поликлональной сывороткой против ротавируса SA11.

Анализ образования тримеров VP6, мультимеров и VLP

Для тестирования способности мутантов VP6 образовывать тримеры инфицированные клетки с разрешением 5 dpi, выращенные в 25 см 2 колбах разрушали в 500 мкл буфера для крекинга (без 2-меркаптоэтанола или DTT), инкубировали при 37 ° C в течение 30 мин и подвергали SDS-PAGE без восстановительных условий [36].Кроме того, инфицированные 5 dpi клетки собирали в буфере TNMC, подвергали трем циклам замораживания-оттаивания, обрабатывали ультразвуком и затем подвергали электрофорезу в нативных условиях [36]. Тримеры детектировали вестерн-блоттингом с эпитопом MAb к V5 или кроличьей поликлональной сывороткой против ротавируса SA11.

Чтобы оценить способность мутантов VP6 мультимеризоваться отдельно или взаимодействовать с VP2 с образованием VLP, клетки Sf9, выращенные в четырех колбах по 175 см2, были инфицированы или совместно инфицированы с moi 5 для каждой версии AcVP6 и moi 8 для AcVP2 и 5 dpi супернатанты собирали, осветляли 10 мин при 1600 × g и VLP осаждали ультрацентрифугированием через 30% (мас. / Мас.) Сахарозную подушку при 70000 × g в течение 90 мин при 10 ° C.Гранулы ресуспендировали в 300 мкл буфера TNMC (10 мМ Трис-HCl pH 7, 150 мМ NaCl, 1 мМ MgCl 2 , 10 мМ CaCl 2 ). Десять мкл разрушали буфером для крекинга и анализировали с помощью SDS-PAGE и вестерн-блоттинга. Рекомбинантные белки были обнаружены кроличьей поликлональной сывороткой против ротавируса SA11 или смесью этой сыворотки и Mab, направленной на V5. Оставшийся материал загружали в градиент CsCl (плотность — 1,32 г, мл -1 ) и центрифугировали 134000 × g в течение 18 ч при 10 ° C.Фракцию, соответствующую VLP, собирали, диализовали против буфера TMNC и концентрировали ультрацентрифугированием при 70000 × g в течение 90 мин при 10 ° C. Гранулы ресуспендировали в 50 мкл буфера TNMC и хранили при 4 ° C для ELISA и электронной микроскопии.

Электронная микроскопия

VLP, полученные ультрацентрифугированием в градиентах CsCl, наносили на медные сетки размером 200 меш, окрашивали 2% уранилацетатом и анализировали с помощью электронной микроскопии (модель JEOL SVC) при 80 кВ.

Чтобы определить экспозицию гетерологичного пептида на поверхности рекомбинантных VLP, было выполнено мечение иммунным золотом. Все инкубации проводились с каплями реагента на полосках парафильма в закрытой камере. Вкратце, рекомбинантные VLP, полученные ультрацентрифугированием в градиентах CsCl, загружали на никелевые сетки и проводили стадию блокирования в течение 30 минут с PBS 1% BSA. После удаления избытка буфера сетки инкубировали с каплей моноклонального анти-V5, разведенного 1/50 в блокирующем буфере, в течение 1 часа при комнатной температуре.После каждого шага сетки промывали пять раз сверхчистой водой. Затем образцы инкубировали с каплей антимышиных антител, конъюгированных с частицами золота 10 нм (SIGMA), разведенными 1/50 в блокирующем буфере. Наконец, сетки окрашивали 2% уранилацетатом и анализировали с помощью электронной микроскопии.

Характеристика рекомбинантных VLP с помощью ELISA

Планшеты для микротитрования (Maxisorp, Nunc, Rochester, NY) были покрыты 50 мкл оптимального разведения (1/2000) кроличьей поликлональной сыворотки против ротавируса-SA11 в карбонатном буфере с pH 9.6 (Na 2 CO 3 15 мМ, NaHCO 3 35 мМ, pH 9,6) инкубацией в течение ночи при 4 ° C. На следующий день выполняли этап блокирования в течение 1 ч при 37 ° C с помощью PBS, 0,05% Tween-20, 5% лошадиной сыворотки (PBS-T-HS) и 5% обезжиренного молока. После каждого этапа планшеты пять раз промывали промывочным буфером (PBS, 0,05% Tween-20). Затем готовили 50 мкл разведения очищенных VP6 / VP2 или рекомбинантных VLP V5 / VP2 171 V5 / VP2 (25 нг / лунку), добавляли его в планшет и инкубировали в течение 1 ч при 37 ° C.После этой инкубации оптимальные разведения сывороток MAb против эпитопа V5 или поликлональных мышей против ротавируса SA11 переносили в планшет для ELISA и инкубировали в течение 1 ч при 37 ° C. Наконец, 50 мкл мкл разведения 1: 2000 антитела, конъюгированного с пероксидазой хрена (KPL, Guildford UK GU2 5GN) в PBS-T-HS, наносили на 1 час при 37 ° C. Затем добавляли 50 мкл раствора субстрата (ABTS 0,5 мг / мл (Sigma-Aldrich, Сент-Луис, Миссури) в 0,1 М цитратном буфере, pH 4,2, содержащем 0,03% перекиси водорода), и после инкубации при комнатной температуре в течение 20 минут определяли показания поглощения при 405 нм.Каждый образец был протестирован в двух экземплярах.

Иммунизация и оценка гуморального иммунного ответа

Для вакцинации использовали самок мышей BALB / c (возраст 6-8 недель). Животные получали две дозы вакцины на масляной основе, состоящей из 300 нг VLPsVP6 171 V5 или 5 мкг мономерного VP6 171 V5, приготовленного с неполным адъювантом Фрейнда (IFA) в дни 1 и 21 путем внутрибрюшинного ( ip) маршрут. Контрольную группу иммунизировали VP6wt. У животных брали кровь в разное время после вакцинации, и у них все время содержался свободный доступ к стерильному корму и воде.

Гуморальный иммунный ответ против эпитопа V5 оценивали с помощью ELISA. Вкратце, рекомбинантный не родственный белок CAT-V5 был продуцирован в E. coli (с использованием вектора экспрессии pRSET) и очищен агарозой Ni-NTA (QIAGEN). Планшеты для микротитрования (Maxisorp, Nunc) покрывали 75 нг / лунку очищенного CAT-V5 в карбонатном буфере pH 9,6 путем инкубации в течение ночи при 4 ° C. На следующий день планшеты блокировали PBS-T-HS и 5% обезжиренным молоком, а затем инкубировали в течение 1 ч при 37 ° C с образцом сыворотки мышей (серийные разведения от 1:50 до 1: 5000) и вторичным антибиотиком. -Мышиные IgG-антитела, конъюгированные с пероксидазой хрена (KPL).Первичные и вторичные антитела разбавляли PBS-T-HS. После каждого этапа планшеты промывали пять раз промывочным буфером. Наконец, реакцию развивали добавлением ABTS 0,5 мг / мл (Sigma-Aldrich, Сент-Луис, Миссури) в 0,1 М цитратном буфере pH 4,2, содержащем 0,03% перекиси водорода, и после инкубации при комнатной температуре определяли значения оптической плотности при 405 нм. температура. Каждый образец был протестирован в двух экземплярах.

Титры выражали как log 10 обратной величины самого высокого разведения сыворотки, что дает значения OD как минимум в два раза выше, чем у контрольных животных.

Границы | Молекулярная эпидемиология и клинические особенности ротавирусной инфекции среди педиатрических пациентов в Восточной Яве, Индонезия, в течение 2015–2018 гг .: динамические изменения генотипов ротавирусов от конского G3 к типичному человеческому G1 / G3

Введение

Острый гастроэнтерит — частая и важная причина детской заболеваемости и смертности в развивающихся странах (Elliott, 2007). Диарея, наиболее частый симптом острого гастроэнтерита, остается третьей ведущей причиной общей заболеваемости и ведущей причиной младенческой смертности в Индонезии, а 38–67% детей с диареей, госпитализированных в больницы Индонезии, были инфицированы ротавирусом группы А (RVA). ) (Соенарто и др., 1981; Судармо и др., 2015; Nirwati et al., 2016). RVA, известная как «зимняя диарея», проявляет отчетливую сезонность в умеренных зонах, тогда как влияние сезона на инфекцию RVA не является экстремальным в тропиках (Levy et al., 2009).

RVA принадлежит к семейству Reoviridae и представляет собой вирус без оболочки, состоящий из 11 сегментов двухцепочечной РНК и кодирующий шесть структурных и шесть неструктурных белков (NSP). RVA классифицируется на типы 35 G и 50 P на основе белков VP7 (гликопротеин) и VP4 (чувствительных к протеазам) (Rojas et al., 2017) соответственно. Генотипы RVA G1P [8], G2P [4], G3P [8], G4P [8], G9P [8] и G12P [8] обычно встречаются во всем мире (Santos and Hoshino, 2005; Dóró et al., 2014) . Эти генотипы также часто выявлялись в Индонезии в 2010–2015 гг. (Sudarmo et al., 2015; Mulyani et al., 2018). Есть также три группы генотипов RVA человека, называемые Wa-подобными (G1-P [8] -I1-R1-C1-M1-A1-N1-T1-E1-h2), DS-1-подобными (G2-P [4] — I2- R2-C2-M2-A2-N2-T2-E2-h3) и менее распространенные AU-1-подобные (G3-P [9] — I3- R3-C3-M3-A3-N3 -T3-E3-h4) (Matthijnssens et al., 2008). G1, G3, G4, G9 и G12 обычно группируются в созвездие, подобное Wa, а G2 и G8 сгруппированы в созвездие, подобное DS-1. Недавно мы сообщили о конских штаммах G3P [8] / P [6] с DS-1-подобным позвоночником (конский G3-P [8] / [6] — I2- R2-C2-M2-A2-N2- T2-E2-h3), возникший в результате редкой перегруппировки людей и лошадей, циркулирующий среди педиатрических стационарных пациентов с острым гастроэнтеритом в частной больнице в пригороде Сурабая, Индонезия (Utsumi et al., 2018). Было установлено, что все протестированные образцы принадлежат к коневодческому генотипу G3, который первоначально был выделен в Австралии и Японии, а затем появился во всем мире (Malasao et al., 2015; Arana et al., 2016; Cowley et al., 2016; Доро и др., 2016; Guerra et al., 2016; Комото и др., 2018; Пич и Либерт, 2018). В отчете из Австралии указано, что конский G3P [8] более распространен в районах, где использовался Rotarix ® (Roczo-Farkas et al., 2016), а другое исследование показало, что конский G3P [ 8] был ответственен за большинство эпизодов тяжелого гастроэнтерита (Cowley et al., 2016).

Два вида вакцин против РВА (Rotarix ® и RotaTeq ® ) были лицензированы в 2006 году, и 84 страны внедрили Rotarix ® или RotaTeq ® в свои национальные программы иммунизации (Abou-Nader et al., 2018). Введение вакцин против RVA в человеческое население может оказывать избирательное давление на циркулирующие штаммы RVA, особенно в поствакцинальную эру (Matthijnssens et al., 2010), хотя существующие вакцины против RVA очень эффективны. Поствакцинальные эпиднадзорные исследования в странах, где широко использовалась вакцина Rotarix ® , показали значительное снижение распространенности RVA и пропорциональный сдвиг генотипа со штаммов G1P [8] на G2P [4] (Dóró et al., 2014; Мухопадхья и др., 2017). Индонезия еще не включила вакцину против RVA в свою национальную программу иммунизации, хотя вакцины от RVA коммерчески доступны с 2011 года. Об охвате и воздействии вакцин против RVA в Индонезии известно немного.

Целью настоящего исследования было оценить изменение распространенности и генотипов RVA и тяжесть RVA-ассоциированного острого гастроэнтерита среди детей, госпитализированных в специализированную больницу в Восточной Яве, Индонезия.

Материалы и методы

Исследуемые популяции и образцы стула

Всего было собрано 432 образца стула у педиатрических пациентов, которые были госпитализированы в государственную больницу с клиническим диагнозом острого гастроэнтерита в период с сентября 2015 года по март 2018 года.Эта больница является специализированной больницей на Восточной Яве, расположенной в Сурабае, втором по величине городе Индонезии. Возраст исследуемой популяции варьировался от 1 месяца до 15 лет и 11 месяцев (средний возраст 12,5 месяцев). Пациенты были разделены на 7 возрастных групп: <6, 6–11, 12–23, 24–35, 36–47, 48–59 и ≥60 месяцев. Критерий острого гастроэнтерита был определен как возникновение водянистого стула ≥3 раз или более жидкого, чем обычно, в день и продолжительностью менее 14 дней. Для оценки сдвига генотипов RVA с 2013 на 2018 год в Восточной Яве были случайным образом включены 4 RVA-положительных образца стула, собранные в 2013 году и 3 в 2014 году у педиатрических пациентов с острым гастроэнтеритом в той же больнице.Ни один из пациентов в этой когорте не был иммунизирован вакциной против RVA. Регистрировались демографические данные (возраст, пол) и клинические особенности (тип стула, рвота, диарея, лихорадка, обезвоживание). Степень обезвоживания определялась с использованием критериев ВОЗ (Всемирная организация здравоохранения [ВОЗ], 2014). Данные о сезонных региональных осадках в Сурабайе были получены из программы ClimatView, организованной Японским метеорологическим агентством, поскольку осадки рассматривались как индикатор сезонности в тропических районах.Письменное информированное согласие было получено от родителей или опекунов всех детей. Протокол исследования был рассмотрен и одобрен этическими комитетами государственной больницы (№ 188) и Университета Эрланга (№ 2054) в Индонезии, а также Университета Кобе (№ 1857) в Японии.

Обнаружение ротавирусов методом иммунохроматографии

Все образцы стула подвергали скринингу на антиген RVA с использованием набора Dipstick «Eiken» Rota (Eiken Chemical, Co., Tokyo, Japan).

Экстракция РНК и генотипирование ОТ-ПЦР

Вирусная РНК экстрагировалась из 140 мкл супернатанта с помощью мини-набора QIAamp Viral RNA (Qiagen, Hilden, Германия).Положительные образцы, определенные как положительные с помощью иммунохроматографического теста, подвергали генотипированию в генах VP7 (G-типирование) и VP4 (P-типирование) с помощью мультиплексной ПЦР с обратной транскрипцией (RT-PCR) с недавно разработанными праймерами для лошадиноподобного G3 в Ген VP7 (Fujii et al., 2019b), а также с праймерами для VP4, которые были разработаны и использованы в нашей лаборатории (таблица 1). Конский G3 в VP7 был типирован с праймером G3e-757F (Таблица 1).

Таблица 1. Набор праймеров для генотипирования VP7.

Секвенирование нуклеотидов и филогенетический анализ

Двадцать три (4 отобраны в 2013 г., 3 отобраны в 2014 г. и 16 отобраны в 2015–2018 гг.) RVA-положительных образца, обнаруженных с помощью ОТ-ПЦР, содержали достаточное количество РНК для дальнейшей характеристики полногенома и были проанализированы с помощью секвенирования следующего поколения (NGS ). Подготовка библиотеки кДНК и секвенирование Illumina MiSeq (Illumina, Сан-Диего, Калифорния, США) выполняли, как описано ранее (Doan et al., 2017). Полноразмерную нуклеотидную последовательность каждого сегмента генома RVA получали с использованием CLC Genomics Workbench v7.0.3 (CLC Bio, Орхус, Дания) с собранными контигами в качестве запрашиваемых последовательностей и 11 сегментами генома эталонной RVA в качестве целевых последовательностей. Генотипы 11 сегментов генома 23 индонезийских штаммов были определены с помощью веб-инструмента классификации RotaC v2.0. Последовательности генома были выровнены с эталонными последовательностями с использованием программного обеспечения CLUSTAL X (версия 1.83), а филогенетические деревья были построены методом объединения соседей. Чтобы подтвердить надежность анализа филогенетического дерева, повторная выборка и реконструкция бутстрапа были выполнены 1000 раз.Эти анализы были выполнены с использованием программного обеспечения молекулярно-эволюционного генетического анализа (MEGA4) (Tamura et al., 2007). Последовательности генов, описанные в настоящем исследовании, депонированы в базе данных GenBank под номерами доступа (LC434517 – LC434532, LC434537 – LC434541, LC430883 – LC430888, LC469324 – LC469341 и LC469398 – LC469603).

Статистический анализ

Статистический анализ проводился с помощью критерия хи-квадрат или точного критерия Фишера для категориальных переменных с использованием SPSS Statistics 17.0 (Advanced Analytics, Inc., Токио, Япония). Результаты считались статистически значимыми при P <0,05.

Результаты

Распространенность RVA

RVA было обнаружено в 137 образцах с помощью иммунохроматографического тестирования, и результаты были подтверждены с помощью ПЦР. Таким образом, 31,7% из 432 педиатрических пациентов с острой диареей были инфицированы RVA. Распространенность RVA-инфекции в 2015, 2016 и 2017 годах составила 31,6, 36,3 и 24,2% соответственно. Взаимосвязь между сезонным распределением инфекции RVA и количеством осадков показана на Рисунке 1.Инфекции RVA наблюдались в течение года и достигли пика в ноябре 2017 г., а затем в июне 2016 г. Примерно 88% (121 из 137) RVA-положительных образцов были получены от детей в возрасте до 2 лет. Инфекция RVA была наиболее распространена в возрастной группе от 6 до 11 месяцев ( P <0,05).

Рис. 1. Распределение конских штаммов ротавирусов G3P [8] / P [6] (черные столбцы) и глобальных штаммов ротавирусов G1 / G3P [8] / [6] (серые столбцы), собранных в Восточной Яве, Индонезия, между Сентябрь 2015 г. и март 2018 г.Количество ротавирус-положительных образцов выражается в процентах от общего количества ротавирус-положительных образцов за каждый месяц периода отбора образцов.

Распределение, переход генотипов G и P RVA и полных геномных констелляций штаммов RVA

Из 137 педиатрических пациентов с гастроэнтеритом, ассоциированным с RVA, генотип G был определен во всех случаях, а генотип P — в 130 случаях. Сто тридцать семь образцов были разделены на три генотипа G (типичный человеческий G1, G3 и конский G3), а 130 образцов были разделены на два генотипа P (P [6] и P [8]).Конские штаммы G3 были определены как доминирующий генотип (87,6%), за ними следуют G1 человека (9,5%) и G3 человека (2,9%). Среди генотипов P, идентифицированных здесь, P [8] был доминантным генотипом (80,3%), за ним следовал P [6] (14,6%), а 7 штаммов (5,1%) не были типируемыми, поскольку продукты ПЦР не были амплифицированы с помощью ОТ-ПЦР с использованием 2 наборов праймеров и для ПЦР для генотипирования VP4 (таблицы 1, 2). Наиболее распространенной комбинацией G-P был G3P, подобный лошадям [8], составляющий 80,0%, за которым следовал G3P, подобный лошадям [6] (12.4%), G1P [8] человека (8,8%), G3P [6] (1,5%), G3P [8] (1,5%) и G1P [6] (0,7%) (таблица 2). Комбинации G-P из 7 дополнительных образцов, использованных в качестве контроля в этом исследовании, были классифицированы на G3P [8], подобный лошадям (собранные в 2013 г.) и G1P человека [8] (собранные в 2013 и 2014 гг.). Большинство обнаруженных штаммов RVA были сгруппированы с конским G3 в течение 2015–2017 гг., Тогда как генотип G1 человека стал преобладающим в течение 2017–2018 гг. (Таблица 3). В этом исследовании лошадиные штаммы G3 были обнаружены до мая 2017 года, но в июле 2017 года они были полностью заменены типичными человеческими генотипами G1 и G3 (Рисунок 1).

Таблица 2. Общее распределение генотипов штаммов РНК, выявленных у детей с диарейными заболеваниями в Восточной Яве в 2015–2018 гг.

Таблица 3. Годовое распределение генотипов штаммов RVA, выявленных у детей с диарейными заболеваниями в Восточной Яве в 2015–2016 годах.

Созвездие генотипов для 11 сегментов генома 23 репрезентативных штаммов с 2013 по 2018 год показано на рисунке 2. Типичный человеческий G1P [8] и лошадиный G3P [8] с DS-1-подобным остовом были представлены в 2013 и 2014 годах, затем эпидемический генотип был полностью заменен конским G3P [8] / [6] с DS-1-подобным остовом в течение 2015–2017 гг. (май).С июля 2017 года эпидемический генотип динамически изменился с конского G3P [8] / [6] на типичный человеческий G1 / G3P [8] / [6], независимо от группировки генотипов, подобных DS-1 или Wa.

Рисунок 2. Сравнение группировок генотипов по периодам исследования. 23 индонезийских штамма RVA в этом исследовании были проанализированы по полногеномным последовательностям. Зеленый и красный указывают на Wa-подобные и DS-1-подобные генные сегменты соответственно. Генотип P [6] VP4 окрашен в желтый цвет, коричневый цвет используется для обозначения генного сегмента лошадиного происхождения, а синий используется для обозначения генного сегмента бычьего происхождения.

Нуклеотидные последовательности и филогенетический анализ конского G3 и других RVA человека

В гене VP7 репрезентативные штаммы были отнесены к коневодческой линии G3 вместе со штаммами, ранее отмечавшимися как конская G3, в другом месте на востоке Явы (Utsumi et al., 2018) и в других странах, таких как Австралия, Таиланд. , Испания, Япония и Бразилия (Malasao et al., 2015; Arana et al., 2016; Cowley et al., 2016; Doro et al., 2016; Guerra et al., 2016; Komoto et al., 2016) (рисунок 3). Два контрольных штамма, собранные в 2013 году, также были отнесены к коневодческой линии G3 (рис. 3). Остальные репрезентативные штаммы были классифицированы на человеческие генотипы G1 и G3 вместе со штаммами, собранными в 2013 и 2014 годах (рис. 3). Идентичность нуклеотидной последовательности гена VP7 между конскими штаммами G3 в этом исследовании была чрезвычайно высокой (99,0–100%) независимо от генотипа [P]. Кроме того, его идентичность между конскими штаммами G3 в этом исследовании и штаммами в других странах была высокой (98.7–99,6%), предполагая, что родство конского гена G3P [8] VP7 и конского гена G3P [6] VP7 было генетически близким. В гене VP4 репрезентативные штаммы в этом исследовании были разделены на генотипы P [8] и P [6] (рис. 4). В гене VP4 лошадиные штаммы G3 и человеческие G1 / G3 имели тенденцию иметь свою собственную группу в генотипе P [8] с высокой идентичностью нуклеотидов (≥99,1%), соответственно. Идентичность нуклеотидов между группами G3, подобными лошадиным, и группой G1 / G3 человека составляла 74,8–75,6%. Однако штаммы RVA показали высокую нуклеотидную идентичность (92.5–99,9%) в пределах генотипа P [6] независимо от того, типичный ли тип G3 у лошади или типичный человеческий тип G1 / G3. Генотипы, определенные филогенетическим анализом, соответствовали генотипам, определенным с помощью ОТ-ПЦР.

Рисунок 3. Филогенетический анализ гена RVA VP7 (генотип G). Дерево было построено с использованием метода объединения соседей. Значения начальной загрузки (> 70) отображаются в узлах ветвления. Названия штаммов RVA, обнаруженных в этом исследовании в 2015, 2016, 2017, 2018 и 2013–2014 годах, выделены синим, красным, коричневым, фиолетовым и зеленым цветом соответственно.

Рисунок 4. Филогенетический анализ нуклеотидных последовательностей VP4 (генотип P) RVA. Дерево было построено с использованием метода объединения соседей. Значения начальной загрузки (> 70) отображаются в узлах ветвления. Штаммы RVA, обнаруженные в этом исследовании, выделены жирным шрифтом.

Филогенетическое древо, основанное на гене NSP4, показало, что восемь штаммов были классифицированы как штаммы, подобные коровьим, а остальные 15 были классифицированы как штаммы человека (дополнительный рисунок S8), а один (STM387) не был амплифицирован.Эти коровоподобные штаммы были выявлены в 2012–2014 гг. В Австралии, в 2013 г. в Японии и в Индонезии (Malasao et al., 2015; Cowley et al., 2016; Utsumi et al., 2018). Репрезентативные штаммы RVA в генах VP6, VP1–3, NSP1 – NAP3 и NSP5 сформировали кластер с таковыми из лошадиноподобных DS-1-подобных штаммов из других стран (дополнительные рисунки S1 – S9).

Клинические данные и тяжесть инфекции RVA

Демографические и основные клинические характеристики, связанные с тяжестью заболевания, показаны в таблице 4.Типичными симптомами, связанными с острым вирусным гастроэнтеритом, являются диарея, рвота, лихорадка и обезвоживание. Распространенность рвоты, водянистого стула и некоторого обезвоживания была значительно выше у RVA-положительных детей, чем у RVA-отрицательных детей (Таблица 4). Увеличение частоты рвоты (≥5 за 24 часа) было тесно связано с RVA-положительными детьми (54,2%), хотя разница с RVA-отрицательными детьми не была статистически значимой (Таблица 4).

Таблица 4. Клинические особенности, наблюдаемые у детей с диареей, положительных на ротавирусную инфекцию.

Мы проанализировали демографические и клинические особенности среди детей, перенесших гастроэнтерит с конскими штаммами G3 или неконскими штаммами G3 (человеческие G1 и G3). Различия в демографических и клинических характеристиках (возраст, пол, продолжительность и частота диареи, рвоты и обезвоживания) не были статистически значимыми между пациентами с RVA-инфекцией, подобной G3, и пациентами с RVA-инфекцией, подобной G3 (данные не показано).Большинство пациентов, инфицированных RVA, полностью выздоровели или выздоровели, независимо от конского G3 или типичного человеческого G1 / G3. Статистических различий в прогнозе младенцев и детей раннего возраста между лошадиной и типичной человеческой RVA не было, хотя количество выборок было слишком маленьким для сравнения.

Обсуждение

Ранее мы сообщали, что конский штамм G3P [8] / [6] DS-1-подобный RVA был преобладающим (100%) в частной больнице в пригороде Сурабая в 2015–2016 годах (Utsumi et al., 2018). Здесь мы продемонстрировали, что необычный генотип RVA (конский G3P [8] / [6]) также был преобладающим штаммом в этой исследуемой популяции в течение 2015–2018 годов, которые находились в стационаре в национальной специализированной больнице Восточной Явы, расположенной в Сурабае. со сниженной распространенностью (87,6%). Два штамма (D13 и D63), собранные в 2013 г. в том же месте на востоке Явы и включенные в это исследование в качестве контрольных, были отнесены к коневодству G3. Наши результаты показывают, что конские штаммы G3, впервые появившиеся в Индонезии в 2013 году одновременно с первым обнаружением в Австралии и Японии, распространились в восточной части острова Ява в Индонезии.Филогенетический анализ гена VP7 показал, что конские штаммы G3P [8] / P [6] очень гомологичны другим штаммам (99,9–97,3%) из Европы, Азии, Южной Америки и Австралии, о чем сообщили несколько исследовательских групп. как лошадиные штаммы RVA.

Коньоподобный G3P [8] DS-1-подобный штамм был редким реассортантом человека / лошади и сгруппирован со штаммами лошадиного G3 на большом генетическом расстоянии согласно филогенетическому анализу в гене VP7 и был назван конским G3P [8] (Коули и др., 2016). Генотип G3, похожий на лошадиный, был обнаружен в Австралии, Азии, Европе и Южной Америке с 2013 года, и он распространяется по всему миру, включая недавно зарегистрированные случаи из Германии (Pietsch and Liebert, 2018) и США (Perkins et al. ., 2017). Конские штаммы G3P [8] / [6] RVA в Индонезии были связаны с большим количеством случаев гастроэнтерита, а также с случаями в Австралии и Испании (Arana et al., 2016; Cowley et al., 2016). Появление во всем мире конских штаммов, подобных G3 DS-1, поставило вопрос о том, вызывают ли вакцины селективное давление на зоонозные штаммы (Luchs et al., 2019). Важно определить, может ли глобальное появление этих новых реассортантов повлиять на эффективность вакцины против RVA.

Типичные человеческие штаммы G1P [8] / [6] и G3P [8] / [6] (12,4%), но не лошадиные G3, были обнаружены с июля 2017 года в настоящем исследовании. Примечательно, что лошадиные штаммы выявлялись исключительно до мая 2017 г., но в июле 2017 г. они были полностью заменены типичной RVA человека (G1 или G3) (Рисунок 1 и Таблица 3). Не типичный Wa-подобный штамм, но необычный G1P [8] DS-1-подобный и конский G3P [8] DS-1-подобный штаммы совместно циркулировали в течение 2013–2014 годов, тогда как конский G3P [8] / [ 6] DS-1-подобные явно циркулировали в течение 2015–2017 гг., А штаммы G1 / G3P [8] / [6] Wa-like / DS-1-подобные были обнаружены в период с июля 2017 г. по март 2018 г. (рис. 2).Теперь генотипы переместились на типичные человеческие G1P [8] и G3P [8], которые ранее были распространены в Индонезии. Сдвиг генотипа от доминантного G1P [8] Wa-подобного к G2P [4] DS-1-подобному наблюдался в первые 2 года после введения Rotarix ® (Gurgel et al., 2007; Zeller et al., 2010 ; Кирквуд и др., 2011; Мухопадхья и др., 2017). Таким образом, возможно, что внедрение вакцины против RVA в 2011 г. в Индонезии привело к сдвигу генотипа в Индонезии. Однако нет убедительного объяснения этому динамическому переходу, который произошел всего за 2 месяца.Насколько нам известно, это первый отчет о динамических изменениях генотипов ротавирусов от конского G3 к типичному человеческому G1 / G3.

Отчет из Японии показал, что G1P [8] DS-1-подобный штамм был наиболее распространенным в 2012–2014 гг. При охвате вакцинацией 39% в 2012–2013 гг. (Fujii et al., 2019a). В других сообщениях из Словении показано, что наиболее распространенный генотип сместился с G1P [8] на G4P [8] и G2P [4] при охвате вакцинацией 27% в 2007–2013 гг. (Steyer et al., 2014). Наши результаты также предполагают, что вакцинация может повлиять на изменение вирусного штамма даже в стране с низким охватом вакцинацией, такой как Индонезия.Дальнейшие исследования могут дать нам представление о направлении глобальной эпидемии RVA в будущем.

Общая распространенность инфекции RVA в этом исследовании составила 31,7%, что ниже, чем ранее сообщенные данные (40%) в Восточной Яве в 2013 году (Sudarmo et al., 2015). В этой когорте подозревалась коинфекция бактериями, поскольку в 2013 году в этой государственной больнице было обнаружено, что примерно 70% педиатрических пациентов с ротавирусом были инфицированы бактериями (Sudarmo et al., 2015).Предыдущий отчет показал, что общая распространенность инфекции RVA на Яве (Центральная и Западная), Бали и Западной Нуса-Тенгара, Индонезия, составляла 48,7% (2010–2015 гг.), 53,7% (2010 г.), 53,3% (2011 г.), 45,1%. % (2012 г.), 41,7% (2013 г.), 38,7% (2014 г.) и 52,5% (2015 г.) (Mulyani et al., 2018). Эти результаты демонстрируют постепенное снижение общей заболеваемости RVA к 2014 году в этих регионах. Кроме того, распространенность инфекции RVA в этом исследовании (Восточная Ява) была аналогична таковой в Центральной Яве в 2006–2010 годах (Nirwati et al., 2016). Взятые вместе, наши результаты показывают, что вакцинация может повлиять на распространенность инфекции RVA даже в районе с низким охватом вакцинацией. Вакцинация против RVA не была включена в национальную программу иммунизации в Индонезии, хотя вакцины против RVA были коммерчески доступны с 2011 года (Mulyani et al., 2018). Ни один из пациентов в этом исследовании не был иммунизирован вакциной RVA. Охват вакцинами от RVA в Индонезии считается довольно низким, поскольку вакцины от RVA слишком дороги для обычных граждан (Sudarmo et al., 2015). По этой причине при оценке эффективности вакцины против RVA следует тщательно учитывать низкий охват вакцинацией.

Введение вакцинации против RVA может быть тесно связано с отбором штаммов генотипов RVA (Roczo-Farkas et al., 2016; Hoque et al., 2018). Кроме того, в Австралии конский штамм RVA был более распространен в районах, где применялась вакцина Rotarix ® (Roczo-Farkas et al., 2016). Новое исследование младенцев с вакцинами против RVA в частных учреждениях Сурабая показало, что примерно 70% младенцев были иммунизированы вакциной Rotarix ® (Gunawan et al., 2019). Эти результаты повышают вероятность того, что вакцина Rotarix ® связана с появлением конских штаммов и что вакцины против RVA могут вызывать давление отбора, которое благоприятствует определенным генотипам (Roczo-Farkas et al., 2016). Генотип G2P [4], который вновь возник после внедрения вакцины против RVA в определенных регионах (Roczo-Farkas et al., 2017; Khandoker et al., 2018), не был обнаружен в этот период исследования, но в 2013 году он был преобладающим генотипом. в том же месте на Восточной Яве (Sudarmo et al., 2015).

Младенцы и дети с гастроэнтеритом, связанным с RVA, чаще, чем у детей с не ротавирусным гастроэнтеритом, демонстрировали обезвоживание, рвоту и водянистую диарею, которые указывают на тяжесть инфекции RVA (Subekti et al., 2002; Mulyani et al., 2018 ). Уровень инфицирования среди детей младше 2 лет, особенно в возрасте от 6 до 11 месяцев, был значительно выше. Эти результаты хорошо согласуются с результатами предыдущих исследований (Subekti et al., 2002; Sowmyanarayanan et al., 2012; Гупта и др., 2018). Более низкая распространенность у детей старшего возраста может быть связана с приобретенным иммунитетом в результате предыдущих контактов (Velazquez, 2009).

В настоящем исследовании инфекция RVA выявлялась непрерывно в течение всего года без каких-либо сезонных пиков. Это согласуется с исследованием, проведенным в 2010–2015 годах в Индонезии (Mulyani et al., 2018), но несовместимым с исследованием в том же месте в 2001–2004 годах, показывающим пики в сухой сезон (с июня по август) (Wilopo et al. ., 2009). В других странах с умеренным климатом обычно бывают пики RV зимой (сухие и прохладные условия). Эти результаты показывают, что значительное внимание к местным климатическим условиям может помочь нам понять распространенность инфекции RVA (Levy et al., 2009).

Тяжесть симптомов у пациентов с RVA с генотипом G3, подобным лошадям, аналогична таковой у пациентов с RVA с типичными G1 и G3 RVA человека в этом исследовании, что противоречит исследованиям, проведенным в Австралии и Японии, что указывает на то, что G3P [ 8] штамм был связан с большинством эпизодов тяжелого гастроэнтерита (Cowley et al., 2016; Комото и др., 2018). Поскольку количество глобальных штаммов в этом исследовании было ограниченным, необходимо накопить больше данных о степени тяжести в соответствии с каждым генотипом RVA. Кроме того, все педиатрические пациенты с острым гастроэнтеритом в этом исследовании были госпитализированы, что позволяет предположить, что их симптомы были более серьезными, чем у пациентов, не госпитализированных. Поскольку нам не удалось собрать образцы у детей, не госпитализированных, трудно сделать какие-либо выводы о степени тяжести острого гастроэнтерита, ассоциированного с RVA, у детей в зависимости от генотипа.Необходимы дальнейшие исследования с участием как госпитализированных, так и внебольничных случаев ротавирусного гастроэнтерита.

Разнообразие штаммов происходит с течением времени вместе с временными и генетическими изменениями вирусов (Gupta et al., 2018). Накопление знаний об особенностях вирусных штаммов может дать представление о том, какое влияние внедрение ротавирусной вакцинации оказывает на эпидемиологию вируса и циркулирующие генотипы. Таким образом, постоянный мониторинг генотипов ротавирусов, особенно появления любых необычных штаммов ротавирусов, наряду с данными о распространенности и клинических характеристиках, будет иметь решающее значение для оценки бремени болезни и достижения успеха в будущих программах вакцинации в Индонезии.

Заключение

В этом исследовании наблюдали динамическое изменение генотипа ротавируса от конского G3 к типичному человеческому генотипу (G1 или G3). Поскольку тяжелые случаи инфекции RVA были распространены, особенно у детей в возрасте от 6 до 11 месяцев и, в более общем плане, детей младше 2 лет, вакцинация RVA должна быть включена в национальную программу иммунизации Индонезии. Также необходим тщательный мониторинг появления необычных штаммов RVA.

Заявление об этике

Письменное информированное согласие было получено от родителей или опекунов всех детей.Протокол исследования был рассмотрен и одобрен комитетами по этике государственной больницы и Университета Эйрланга в Индонезии, а также Университета Кобе в Японии.

Авторские взносы

AA были собраны данные пациента. SS, RR, AD и DR собрали образцы. ТУ был ответственным за написание рукописи. RW, ZD и LY провели все эксперименты. Итак, J и ML собрали образцы. CM, LD и TA оказали помощь в проведении исследования. YD, YF, HS, KK и IS оказали помощь в исследовании и анализе.И.С. руководил исследованием и помогал составить рукопись. Все авторы критически отредактировали рукопись, прочитали и одобрили представленную версию.

Финансирование

Это исследование было поддержано Японской инициативой глобальной исследовательской сети по инфекционным заболеваниям (J-GRID) Министерства образования, культуры, спорта, науки и технологий Японии, Японского агентства медицинских исследований и разработок (AMED: 18fm0108004h0004), Синриокукай .

Заявление о конфликте интересов

Авторы заявляют, что исследование проводилось при отсутствии каких-либо коммерческих или финансовых отношений, которые могут быть истолкованы как потенциальный конфликт интересов.

Благодарности

Мы искренне благодарим профессора Дато Шри Тахира, профессора Тахира, и Министерство исследований, технологий и высшего образования (RISTEKDIKTI) Индонезии за их совет провести это исследование в Индонезии.

Дополнительные материалы

Дополнительные материалы к этой статье можно найти в Интернете по адресу: https://www.frontiersin.org/articles/10.3389/fmicb.2019.00940/full#supplementary-material

Сноски

  1. www.data.jma.go.jp/gmd/cpd/monitor/climatview/frame.php
  2. http://rotac.regatools.be/

Список литературы

Abou-Nader, A.J., Sauer, M.A., Steele, A.D., Tate, J.E., Atherly, D., Parashar, U.D., et al. (2018). Внедрение и охват ротавирусной вакцины в мире: 2006–2016 гг. Hum. Вакцин. Immunother. 14, 2281–2296. DOI: 10.1080 / 21645515.2018.1470725

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Арана, А., Монтес, М., Джер, К. К., Алькорта, М., Итурриза-Гомара, М., и Силла, Г. (2016). Возникновение и распространение ротавирусов G3P [8], обладающих похожей на лошадей VP7 и DS-1-подобной генетической основой, в Стране Басков (север Испании), 2015 г. Infect. Genet. Evol. 44, 137–144. DOI: 10.1016 / j.meegid.2016.06.048

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Коули Д., Донато К. М., Рочо-Фаркас С. и Кирквуд К. Д. (2016). Появление нового конского реассортантного штамма ротавируса G3P [8], который ассоциируется с гастроэнтеритом у детей Австралии. J. Gen. Virol. 97, 403–410. DOI: 10.1099 / jgv.0.000352

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Доан Ю. Х., Судзуки Ю., Фуджи Ю., Хага К., Фудзимото А., Такай-Тодака Р. и др. (2017). Сложные события перегруппировки необычных штаммов ротавируса G9P [4] в Индии в период с 2011 по 2013 год. Infect. Genet. Evol. 54, 417–428. DOI: 10.1016 / j.meegid.2017.07.025

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Доро, Р., Ласло, Б., Мартелла, В., Лешем, Э., Генч, Дж., Парашар, У. и др. (2014). Обзор глобальных данных о распространенности штаммов ротавируса за шесть лет после лицензирования вакцины: есть ли доказательства отбора штаммов в зависимости от давления вакцины? Заражение. Genet. Evol. 28, 446–461. DOI: 10.1016 / j.meegid.2014.08.017

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Доро Р., Мартон С., Бартокне А. Х., Лендьел Г., Агоч З., Якаб Ф. и др. (2016). Ротавирус G3, подобный лошадям, в Венгрии, 2015 г. — Является ли это новым пандемическим штаммом реассортантной межгеновой группы? Acta Microbiol.Иммунол. Висела. 63, 243–255. DOI: 10.1556 / 030.63.2016.2.8

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Фудзи Ю., Доан Ю. Х., Судзуки Ю., Накагоми Т., Накагоми О. и Катаяма К. (2019a). Изучение полных последовательностей генома эпидемий и эволюции ротавируса А в Японии в 2012-2014 гг. Фронт. Microbiol. 10:38. DOI: 10.3389 / fmicb.2019.00038

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Fujii, Y., Doan, Y.Х., Вахюни, Р. М., Лусида, М. И., Утсуми, Т., Сёдзи, И. и др. (2019b). Совершенствование метода генотипирования ротавирусов с помощью полугнездовой мультиплексной ПЦР с новым набором праймеров. Фронт. Microbiol. 10: 647. DOI: 10.3389 / fmicb.2019.00647

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Герра, С.Ф., Соарес, Л.С., Лобо, П.С., Пенья, Э.Т., Соуза, Е.С., Безерра, Д.А., и др. (2016). Обнаружение нового конского ротавируса G3, связанного с острым гастроэнтеритом, в Бразилии. J. Gen. Virol. 97, 3131–3138. DOI: 10.1099 / jgv.0.000626

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Гунаван, Э., Утсуми, Т., Вахюни, Р. М., Динана, З., Судармо, С. М., Сёдзи, И., и др. (2019). Поствакцинальные бессимптомные ротавирусные инфекции: профильное исследование детей в Сурабае, Индонезия. J. Infect. Общественное здравоохранение [Epub перед печатью].

PubMed Аннотация | Google Scholar

Гупта, С., Кришнан, А., Шарма, С., Кумар, П., Анеха, С., и Рэй, П. (2018). Изменение структуры распространенности, генетического разнообразия и смешанных инфекций вирусов, связанных с острым гастроэнтеритом, у педиатрических пациентов в Нью-Дели, Индия. J. Med. Virol. 90, 469–476. DOI: 10.1002 / jmv.24980

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Гургель, Р. К., Куэвас, Л. Е., Виейра, С. К., Баррос, В. К., Фонтес, П. Б., Салустино, Э. Ф. и др. (2007). Преобладание ротавируса P [4] G2 в вакцинированной популяции, Бразилия. Emerg. Заразить. Дис. 13, 1571–1573. DOI: 10.3201 / eid1310.070412

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Хоке, С. А., Кобаяши, М., Таканаши, С., Анвар, К. С., Ватанабе, Т., Хамрин, П., и др. (2018). Роль ротавирусной вакцинации в отношении развивающегося штамма ротавируса G8P [8], вызывающего вспышку в центральной Японии. Вакцина 36, 43–49. DOI: 10.1016 / j.vaccine.2017

CrossRef Полный текст | Google Scholar

Хандокер, Н., Thongprachum, A., Takanashi, S., Okitsu, S., Nishimura, S., Kikuta, H., et al. (2018). Молекулярная эпидемиология ротавирусного гастроэнтерита в Японии в 2014–2015 гг .: характеристика вновь появляющегося G2P [4] после внедрения ротавирусной вакцины. J. Med. Virol. 90, 1040–1046. DOI: 10.1002 / jmv.25067

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Кирквуд, К. Д., Бонифас, К., Барнс, Г. Л., и Бишоп, Р. Ф. (2011). Распространение генотипов ротавирусов после введения ротавирусных вакцин Rotarix ® и RotaTeq ® в национальную программу иммунизации Австралии. Pediatr. Заразить. Дис. 30, S48 – S53. DOI: 10.1097 / INF.0b013e3181fefd90

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Комото, С., Иде, Т., Негоро, М., Танака, Т., Асада, К., Умемото, М. и др. (2018). Характеристика необычных DS-1-подобных штаммов ротавируса G3P [8] у детей с диареей в Японии. J. Med. Virol. 90, 890–898. DOI: 10.1002 / jmv.25016

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Комото, С., Tacharoenmuang, R., Guntapong, R., Ide, T., Tsuji, T., Yoshikawa, T., et al. (2016). Перегруппировка сегментов генов ротавирусов человека и животных в новых DS-1-подобных штаммах ротавируса G1P [8]. PLoS One 11: e0148416. DOI: 10.1371 / journal.pone.0148416

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Леви К., Хаббард А. Э. и Айзенберг Дж. Н. (2009). Сезонность ротавирусной болезни в тропиках: систематический обзор и метаанализ. Внутр. Дж.Эпидемиол. 38, 1487–1496. DOI: 10.1093 / ije / dyn260

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Luchs, A., da Costa, A.C., Cilli, A., Komninakis, S.C.V., Carmona, R.C.C., Boen, L., et al. (2019). Распространение нового конского штамма ротавируса G3P [8] DS-1-подобного генетического каркаса в Бразилии и идентификация потенциальных генетических вариантов. J. Gen. Virol. 100, 7–25. DOI: 10.1099 / jgv.0.001171

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Маласао, Р., Сайто, М., Судзуки, А., Имагава, Т., Нукива-Сома, Н., Тохма, К. и др. (2015). Человеческий ротавирус G3P [4], полученный в Японии в 2013 году, возможно, возник в результате реассортации ротавирусов человека и лошадей. Гены вирусов 50, 129–133. DOI: 10.1007 / s11262-014-1135-z

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Matthijnssens, J., Ciarlet, M., Heiman, E., Arijs, I., Delbeke, T., McDonald S.M., et al. (2008). Классификация ротавирусов на основе полного генома выявляет общее происхождение штаммов ротавирусов Wa-Like и свиней, а также штаммов DS-1-подобных и ротавирусов крупного рогатого скота. J. Virol. 82, 3204–3219. DOI: 10.1128 / JVI.02257-07

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Matthijnssens, J., Heylen, E., Zeller, M., Rahman, M., Lemey, P., and Van Ranst, M. (2010). Филодинамический анализ генотипов ротавирусов G9 и G12 подчеркивает их потенциал для быстрого глобального распространения. Мол. Биол. Evol. 27, 2431–2436. DOI: 10.1093 / molbev / msq137

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Мухопадхья, И., Мердок, Х., Берри, С., Хант, А., Итурриза-Гомара, М., Смит-Палмер, А. и др. (2017). Изменение молекулярной эпидемиологии ротавирусной инфекции после внедрения моновалентной ротавирусной вакцинации в Шотландии. Вакцина 35, 156–163. DOI: 10.1016 / j.vaccine.2016.11.028

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Муляни, Н. С., Прасетьо, Д., Карьяна, И. П. Г., Сукарди, В., Дамаянти, В., Ангграини, Д., и др. (2018). Диарея среди госпитализированных детей в возрасте до пяти лет: призыв к включению ротавирусной вакцины в национальную программу иммунизации в Индонезии. Vaccine 36, 7826–7831. DOI: 10.1016 / j.vaccine.2018.05.031

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Нирвати, Х., Вибава, Т., Аман, А. Т., Вахаб, А., и Соенарто, Ю. (2016). Обнаружение штаммов ротавируса группы А, циркулирующих среди детей с острой диареей в Индонезии. Springerplus 5:97. DOI: 10.1186 / s40064-016-1724-5

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Perkins, C., Mijatovic-Rustempasic, S., Уорд М. Л., Кортезе М. М. и Боуэн М. Д. (2017). Геномная характеристика первого конского штамма ротавируса G3P [8], обнаруженного в США. Genome Announc. 5: e1341-17. DOI: 10.1128 / genomeA.01341-17

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Питч К., Либерт У. Г. (2018). Молекулярная характеристика различных конских штаммов ротавируса G3 из Германии. Заражение. Genet. Evol. 57, 46–50. DOI: 10.1016 / j.meegid.2017

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Рочо-Фаркас, С., Кирквуд, К. Д., Байнс, Дж. Э., Группа кишечных вирусов, Детский научно-исследовательский институт Мердока и Королевская детская больница (2017). Австралийская программа эпиднадзора за ротавирусами: годовой отчет, 2016 г. Commun. Дис. Intell. Q. Rep. 41, E455 – E471.

Google Scholar

Рочо-Фаркас, С., Кирквуд, К. Д., Байнс, Дж. Э. и Австралийская группа по надзору за ротавирусами (2016).Годовой отчет Австралийской программы эпиднадзора за ротавирусами, 2015 г. Commun. Дис. Intell. Q. Rep. 40, E527 – E538.

Google Scholar

Рохас, М. А., Гонсалвес, Дж. Л. С., Диас, Х. Г., Манчего, А. и Сантос, Н. (2017). Идентификация двух новых генотипов ротавируса A, G35 и P [50], из фекалий перуанских альпаков. Заражение. Genet. Evol. 55, 71–74. DOI: 10.1016 / j.meegid.2017.08.019

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Сантос, Н.и Хосино Ю. (2005). Глобальное распространение серотипов / генотипов ротавируса и его значение для разработки и внедрения эффективной ротавирусной вакцины. Rev. Med. Virol. 15, 29–56. DOI: 10.1002 / RMV.448

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Soenarto, Y., Sebodo, T., Ridho, R., Alrasjid, H., Rohde, J. E., Bugg, H.C., et al. (1981). Острая диарея и ротавирусная инфекция у новорожденных и детей в Джокьякарте, Индонезия, с июня 1978 г. по июнь 1979 г. J. Clin. Microbiol. 14, 123–129.

PubMed Аннотация | Google Scholar

Sowmyanarayanan, T. V., Ramani, S., Sarkar, R., Arumugam, R., Warier, J. P., Moses, P. D., et al. (2012). Тяжесть ротавирусного гастроэнтерита у индийских детей, нуждающихся в госпитализации. Вакцина 30 (Приложение 1), A167 – A172. DOI: 10.1016 / j.vaccine.2011.07.145

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Штайер, А., Сагадин, М., Коленц, М., и Poljšak-Prijatelj, M. (2014). Молекулярная характеристика штаммов ротавирусов в период до и после вакцинации в стране с низким охватом вакцинацией: пример Словении. Заражение. Genet. Evol. 28, 413–425. DOI: 10.1016 / j.meegid.2014.06.021

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Subekti, D., Lesmana, M., Tjaniadi, P., Safari, N., Frazier, E., Simanjuntak, C., et al. (2002). Заболеваемость норволк-подобными вирусами, ротавирусом и аденовирусной инфекцией у пациентов с острым гастроэнтеритом в Джакарте, Индонезия. FEMS Immunol. Med. Microbiol. 33, 27–33. DOI: 10.1111 / j.1574-695X.2002.tb00568.x

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Судармо, С. М., Шигемура, К., Атия, А. Ф., Осава, К., Вардана, О. П., Дарма, А., и др. (2015). Генотипирование и клинические факторы детской диареи, вызванной ротавирусами: однолетнее наблюдение в Сурабае, Индонезия. Gut Pathog. 7: 3. DOI: 10.1186 / s13099-015-0048-2

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Тамура, К., Дадли, Дж., Ней, М., и Кумар, С. (2007). MEGA4: программа молекулярно-эволюционного генетического анализа (MEGA) версии 4.0. Мол. Биол. Evol. 24, 1596–1599. DOI: 10.1093 / molbev / msm092

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Уцуми Т., Вахьюни Р. М., Доан Ю. Х., Динана З., Соэджянто С., Фуджи Ю. и др. (2018). Конские штаммы ротавируса G3 как преобладающие штаммы среди детей в Индонезии в 2015-2016 гг. Заражение. Genet. Evol. 61, 224–228.DOI: 10.1016 / j.meegid.2018.03.027

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Вилопо, С. А., Соенарто, Ю., Брези, Дж. С., Толиб, А., Амина, С., Кахьоно, А., и др. (2009). Эпиднадзор за ротавирусами для определения бремени болезни и эпидемиологии на Яве, Индонезия, с августа 2001 г. по апрель 2004 г. Vaccine 27 (Suppl. 5), F61 – F66. DOI: 10.1016 / j.vaccine.2009.09.004

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Всемирная организация здравоохранения [ВОЗ] (2014 г.). Курс дистанционного обучения Модуль 4: Диарея. Комплексное ведение детских болезней.

Зеллер М., Рахман М., Хейлен Э., Де Костер С., Де Вос С., Арийс И. и др. (2010). Заболеваемость ротавирусами и распределение генотипов до и после внедрения национальной ротавирусной вакцины в Бельгии. Vaccine 28, 7507–7513. DOI: 10.1016 / j.vaccine.2010.09.004

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Может ли геном ротавируса стать ключевым элементом вакцины против COVID-19 для детей? Исследователи IU говорят, что да.: Новости в IU: Университет Индианы

БЛУМИНГТОН, Индиана — С тех пор, как пандемия поразила Соединенные Штаты более года назад, вирусолог из Блумингтона из Индианского университета Джон Паттон, аспирантка Аша Филип и другие работали над вакциной от COVID-19. для детей раннего возраста, на основе хорошо зарекомендовавшей себя детской вакцины против распространенной болезни ротавируса.

В настоящее время нет доступных вакцин против COVID-19, разрешенных для использования у детей младше 16 лет.

Путем обратной инженерии генома ротавируса, который служил вектором для уже знакомого нам шипового белка SARS-CoV-2, исследование команде удалось создать генетически стабильные рекомбинантные ротавирусы, которые содержат части белка-шипа, что может привести к созданию комбинированной вакцины против ротавируса и COVID-19 для замены широко используемых в настоящее время ротавирусных вакцин.

«Наши результаты открывают возможность создания штаммов ротавирусных вакцин, способных защищать не только от ротавируса, но и от COVID-19», — сказал Филип.

Паттон — профессор биологии и кафедра вирусологии Блатта в Колледже искусств и наук в Блумингтонском университете. Филип — доктор философии. студент лаборатории Паттона и ведущий автор исследования.

Предварительные результаты их исследования были опубликованы в препринте «Ротавирус как платформа экспрессии шипованного белка SARS-CoV-2» на платформе с открытым доступом bioRxiv и в рамках пилотного препринта Национальных институтов здравоохранения.Препринты — это рабочие документы, ожидающие экспертной оценки.

Ротавирус распространен среди детей младшего возраста, вызывая тошноту и диарею, но вакцинация уже давно сократила его распространение во многих странах. По словам Филипа, комбинированная таргетная вакцина против ротавируса и COVID-19 станет огромным шагом вперед.

Используя уже существующие программы иммунизации против ротавируса, комбинированную вакцину можно было бы распространять и вводить детям грудного и раннего возраста по всему миру. Хотя дети составляют крошечную долю инфекций и смертей от COVID-19, они могут быть бессимптомными носителями болезни, что ставит под угрозу нашу способность достичь коллективного иммунитета.

Вакцина для детей младшего возраста также позволит школам открываться более свободно, позволяя проводить мероприятия, предполагающие тесный контакт. И процесс, используемый для создания комбинированных вакцин на основе ротавируса, также может оказаться полезным для вакцин против других кишечных вирусов, таких как норовирус.

В настоящее время группа IU работает над тем, чтобы определить, насколько успешно комбинированная вакцина против ротавируса, SARS-CoV-2 вызывает желаемый ответ антител. Между тем, их текущие результаты подчеркивают потенциал комбинированной вакцины, которая может стать рутинной иммунизацией детей в недалеком будущем.

IU Research

Исследователи мирового уровня IU продвигали важные инновации и творческие инициативы на протяжении 200 лет. От лечения рака яичек до сотрудничества с НАСА в поисках жизни на Марсе — IU заработала репутацию исследовательского учреждения мирового уровня. Получив в прошлом году 854 миллиона долларов от наших партнеров, исследователи IU налаживают сотрудничество и открывают новые решения, которые улучшают жизнь в Индиане и во всем мире.

Примечание для журналистов: Копию исследовательской работы можно получить в IU Research, vpr @ iu.edu. Статья была опубликована на сайте bioRxv в виде препринта 18 февраля 2021 г.

Ротавирус | Иммунизируйте BC

Вы знали?

Примерно 1 из 5 случаев тяжелой диареи и рвоты у детей вызван ротавирусом. Почти все канадские дети будут инфицированы ротавирусом хотя бы один раз к 5-летнему возрасту.

Что такое ротавирусная вакцина?

Вакцина против ротавируса помогает защитить детей от диареи и рвоты, вызываемых ротавирусом. Он не защищает от диареи и рвоты, вызванных другими вирусами.

Кому следует сделать вакцину против ротавируса?

  • Вакцина против ротавируса вводится младенцам с 2-месячного возраста.
  • В настоящее время в Британской Колумбии используются две разные ротавирусные вакцины: RotaTeq® и Rotarix®.
  • RotaTeq® вводится серией из 3 доз. Первая доза вводится в возрасте 2 месяцев, вторая — в 4 месяца, а третья — в 6 месяцев.
  • Rotarix® вводится сериями из 2 доз. Первая доза назначается в возрасте 2 месяцев, вторая — в 4 месяца.
  • Вакцины предоставляются бесплатно в рамках плановой иммунизации вашего ребенка.
  • Вакцины вводятся перорально. Несколько капель жидкой вакцины помещают в рот ребенку, чтобы он проглотил.
  • Важно, чтобы ваш ребенок вовремя прошел вакцинацию против ротавируса. Первая доза вакцины должна быть введена до достижения 20-недельного возраста, а вакцинация должна быть завершена к 8-месячному возрасту.
  • Вирус от вакцины может быть обнаружен в стуле вашего ребенка в течение как минимум 10 дней после иммунизации.Родители и опекуны должны тщательно мыть руки после смены подгузников.

Каковы преимущества вакцины?

Вакцина предотвращает более 3 из 4 случаев ротавирусной болезни и почти все тяжелые случаи, включая госпитализации. Делая прививки своему ребенку, вы также помогаете защитить других.

Каковы побочные эффекты?

Вакцины очень безопасны. Сделать вакцину намного безопаснее, чем заразиться ротавирусной инфекцией.

У большинства младенцев нет никаких реакций после вакцинации против ротавируса. У некоторых после иммунизации может подняться температура или возникнуть диарея, рвота и раздражительность.

В некоторых странах за пределами Канады в течение недели после первой дозы ротавирусной вакцины наблюдается очень редкий риск инвагинации (закупорка кишечника). Риск инвагинации составляет от 1 до 2 случаев на каждые 100 000 детей, получивших вакцину. В лучшем случае это может повлиять на 1 ребенка в год в B.C. Для сравнения, каждый год в Британской Колумбии около 1 из 4000 детей в возрасте до 1 года заболевают инвагинацией, не получив вакцины.

Признаки инвагинации могут включать вздутие живота, частую рвоту и кровавый стул. Ваш ребенок может казаться слабым и раздражительным, и у него может быть несколько приступов сильного плача. Если у вашего ребенка проявляются эти признаки, вам следует отвезти его в ближайшее отделение неотложной помощи.

Важно оставаться в клинике в течение 15 минут после вакцинации, потому что существует очень редкая возможность, от одного на 100000 до одного на миллион, опасной для жизни аллергической реакции, называемой анафилаксией.Это может включать крапивницу, затрудненное дыхание или отек горла, языка или губ. В случае возникновения такой реакции ваш лечащий врач готов ее лечить. Неотложное лечение включает введение адреналина (адреналина) и доставку на машине скорой помощи в ближайшее отделение неотложной помощи. Если симптомы развиваются после выписки из клиники, позвоните в службу 9-1-1 или по местному номеру службы экстренной помощи.

Важно всегда сообщать своему врачу о серьезных или неожиданных реакциях.

Где я могу узнать больше?

Ротавирусная вакцина с Dr.Ран Голдман

О ротавирусе

  • Ротавирус — это вирус, вызывающий гастроэнтерит, иногда называемый желудочным гриппом.
  • Ротавирус легко распространяется при контакте со стулом инфицированного ребенка, например при обращении с подгузниками.
  • Ротавирус является наиболее частой причиной диареи и госпитализации по поводу диареи у детей в возрасте до 5 лет.
  • Почти все дети заболеют хотя бы одной ротавирусной инфекцией в возрасте до 5 лет.
  • Первыми симптомами ротавирусной инфекции обычно являются лихорадка и рвота, за которыми следуют диарея и боль в желудке. Эти симптомы появляются через 1-3 дня после заражения человека вирусом. Диарея может длиться от 4 до 8 дней.
  • Сильная и частая диарея и / или рвота могут привести к обезвоживанию детей раннего возраста, что может привести к смерти, если не лечить.

Норовирус опережает ротавирус как ведущее заболевание желудочно-кишечного тракта среди детей в США

21 марта 2013 г. (Новости CIDRAP) — Согласно новому исследованию, проведенному группой исследователей из Центров по контролю и профилактике заболеваний (CDC), норовирус превзошел ротавирус как ведущую причину гастроэнтерита у детей в США и сопряжен со значительными затратами на инфекцию и лечение. ).

Это первое исследование, в котором оценивается бремя лабораторно подтвержденного заболевания, вызванного норовирусом, у детей, и проводится в то время, когда показатели заболеваемости гастроэнтеритом, вызываемым ротавирусом, снижаются из-за использования вакцины, а органы здравоохранения собирают информацию о норовирусе перед началом исследования. вакцина, которая находится на горизонте разработки.

По оценкам CDC, норовирусная инфекция, чрезвычайно заразное заболевание, распространяющееся в основном через контакт с больными людьми и зараженную пищу, воду и поверхности, приводит к более чем 21 миллиону инфекций и 800 смертельным исходам в Соединенных Штатах каждый год.

Чтобы оценить характер норовируса, исследователи провели наблюдение за лабораторно подтвержденными случаями в трех округах, расположенных в Рочестере, штат Нью-Йорк, Нэшвилле и Цинциннати. Исследователи CDC и их партнеры из трех округов опубликовали свои результаты сегодня в журнале New England Journal of Medicine .

Они наблюдали за детьми в возрасте до 5 лет, которым требовалась медицинская помощь по поводу гастроэнтерита с октября 2008 года по сентябрь 2010 года. В исследование было включено около 141 000 детей.Команда рассчитала популяционные показатели заболеваемости норовирусным гастроэнтеритом, проверила счета для определения медицинских расходов и экстраполировала результаты на всех детей в США младше 5 лет.

Норовирус был обнаружен на сопоставимых уровнях за 2 года: 21% в первый и 20% во второй. В контрольной группе здоровых малышей первого года жизни 4% имели норовирусную инфекцию. Ротавирус был обнаружен у 12% детей, обратившихся за помощью по поводу гастроэнтерита в течение обоих лет.

В целом, исследователи обнаружили, что норовирусные инфекции приводят к почти 1 миллиону медицинских посещений маленьких детей ежегодно.В частности, частота госпитализаций, посещений отделений неотложной помощи и амбулаторных посещений по поводу норовируса в 2009 г. составляла 8,6, 146,7 и 367,7 на 10 000 детей в возрасте до 5 лет. В 2010 г. эти показатели были ниже и составляли 5,8, 134,3 и 260,1 на 10 000 детей. , соответственно.

Около половины обращений за медицинской помощью по поводу норовируса приходилось на детей в возрасте от 6 до 18 месяцев, и вероятность госпитализации младенцев и годовалых была выше, чем у детей старшего возраста.

Что касается затрат, исследователи подсчитали, что в течение первого года стоимость госпитализации на одно заболевание составила 3918 долларов, посещение отделения неотложной помощи — 435 долларов, а амбулаторное посещение — 151 доллар.

Экстраполируя эти цифры на более широкую популяцию детей в возрасте до 5 лет в США, исследователи подсчитали, что количество посещений больниц, отделений неотложной помощи и поликлиник превысило 14 000, 281 000 и 627 000 человек соответственно.

Они выставили общий счет на ежегодные расходы на лечение норовирусного заболевания в возрастной группе более чем на 273 миллиона долларов в год.

Первый автор Дэниел Пейн, доктор философии, MSPH, эпидемиолог из отдела вирусных заболеваний CDC, сообщил в пресс-релизе CDC, что исследование подтверждает, что количество обращений к врачам по поводу ротавирусных инфекций сократилось.«Кроме того, наше исследование подтверждает успех программы вакцинации против ротавируса в США, а также подчеркивает ценность конкретных вмешательств для защиты от норовирусных заболеваний». Пейн конкретно упомянул разрабатываемые вакцины против норовируса.

В течение периода исследования группа обнаружила сдвиг в варианте норовируса GII.4, с G11.4 Minerva в первый год на GII.4 New Orleans во второй год. Авторы отметили эти результаты, а также недавнее обнаружение нового GII.4 Вариант Sydney 2012, может помочь экспертам определить лучшие кандидаты вакцины и целевые группы населения для вакцинации.

Payne DC, Vinje J, Szilagyi PG, et al. Норовирус и медицинский гастроэнтерит у детей в США. N Engl J Med 2013 21 марта; 368 (12): 1121-30 [Аннотация]

См. Также:

21 марта пресс-релиз CDC

Вакцина против ротавируса может стать ключом к защите детей от COVID-19

Newswise — Поскольку пандемия COVID-19 продолжает распространяться по всему миру, все думают о разработке вакцины.Джон Паттон из Университета Индианы не исключение.

Паттон, адъюнкт-профессор биологии и кафедра вирусологии Блатта в Колледже искусств и наук Блумингтонского университета, изучает вирусы более 30 лет. Его основное внимание было уделено ротавирусу. Как известно многим родителям, ротавирус может инфицировать младенцев и детей младшего возраста, вызывая тошноту и диарею. Сегодня большинство младенцев в Соединенных Штатах получают вакцину против ротавируса, а это означает, что за последние 20 лет или около того «исчезла ротавирус как основная причина отправки маленьких детей в больницу», — говорит Паттон.

Однако это не относится к развивающимся странам, где ротавирусные вакцины были менее эффективны по причинам, которые остаются неясными. Паттон и его коллеги из лаборатории продолжили свои исследования биологии ротавируса и его разработки в качестве вектора для создания эффективных вакцин против других вирусов.

Потом пришел COVID-19. Когда вирус начал распространяться из страны в страну, Паттон в начале февраля понял, что его лаборатория была нацелена на работу над вакциной COVID-19.

«Как вирусолог, — говорит Паттон, — я всегда думаю о других вирусах, будь то грипп, MERS или SARS. Я всегда пытаюсь понять, как я могу исследовать новые появляющиеся вирусы и раскрывать методы борьбы с их заболеваниями ».

Потенциальное решение, над которым сейчас работает лаборатория Паттона, уникально. Вместо того, чтобы использовать «гриппоподобный подход» к созданию новой вакцины, Паттон и его команда используют текущую работу лаборатории по изучению ротавируса для разработки вакцины, которая защитит детей от COVID-19.

«В отличие от многих вирусов, ротавирус очень гибок, позволяя вносить изменения в его геном», — объясняет Паттон. «Мы поняли, что можем реорганизовать ротавирус, чтобы создать штаммы вируса, которые производят шипящий белок коронавируса. вакцинирован ротавирусной вакциной, они не только вызовут защитный иммунный ответ против ротавируса, но, кроме того, вероятно, будут иметь аналогичный защитный иммунный ответ на COVID-19.

«Короче говоря, мы разрабатываем двойную вакцину, которая обеспечивает защита от обоих вирусов.«

Тот факт, что ротавирусная вакцина уже хорошо зарекомендовала себя для детей младшего возраста, делает этот подход с использованием двойной вакцины особенно интересным, — говорит Паттон.

« Разработка вакцин для младенцев и детей раннего возраста — всегда немного сложная задача », — говорит он. «Преимущество состоит в том, что мы не создаем совершенно новую вакцину, а модифицируем существующую вакцину, которая уже очень безопасно используется у детей».

По словам Паттона, вакцина для детей имеет решающее значение, потому что, несмотря на впечатление, что новый коронавирус поражает только взрослых, дети инфицируются, в некоторых случаях приводя к серьезным заболеваниям.Недавние исследования показали, что младенцы и дети дошкольного возраста более подвержены тяжелым заболеваниям, чем дети школьного возраста.

Но что еще более важно, отмечает Паттон, дети могут быть бессимптомными носителями, распространяя болезнь COVID-19 среди семей и сообществ.

«В долгосрочной перспективе нам, вероятно, потребуется вакцинировать младенцев и новорожденных, если мы хотим контролировать этот вирус», — говорит он.

На данный момент Паттон и его команда из лаборатории прилагают все усилия, чтобы сбалансировать безопасность и прогресс, поскольку они продвигаются вперед в разработке новых штаммов вирусов, содержащих шипованный белок COVID-19.Паттон надеется, что в течение нескольких месяцев они начнут видеть, будут ли новые штаммы работать на получение желаемого ответа антител.

Предполагая, что вакцинные штаммы жизнеспособны и Паттон очень хорошо оценивает их потенциал, следующим шагом будет тестирование, чтобы убедиться, что вакцина «безопасна, безопасна, безопасна» для людей, говорит Паттон, и что она действительно снижает серьезность болезни.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *